Diabetic silkworms for evaluation of therapeutically effective drugs
|
|
|
- Dulcie Barton
- 5 years ago
- Views:
Transcription
1 Supplementary information Diabetic silkworms for evaluation of therapeutically effective drugs against type II diabetes. Yasuhiko Matsumoto, Masaki Ishii, Yohei Hayashi, Shinya Miyazaki, Takuya Sugita, Eriko Sumiya, and Kazuhisa Sekimizu 1 Laboratory of Microbiology, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo , Japan. Correspondence to: Dr. Kazuhisa Sekimizu, Laboratory of Microbiology, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo , Japan; sekimizu@mol.f.y-tokyo.ac.jp 1
2 Supplementary figure 1 Effects of pioglitazone and metformin on hemolymph sugar levels in silkworms made hyperglycemic by intake of a high-glucose diet for 1 h. (A) Experimental design. (B, C) Silkworms were fed a diet containing 10% (w/w) glucose (G.D.) for 1 h. (B) Pioglitazone (100 µg/larvae) or saline (0.9% NaCl) was injected into the silkworm hemolymph. (C) Metformin (100 µg/larvae) or saline (0.9% NaCl) was injected into the silkworm hemolymph. Hemolymph sugar levels of the silkworms were determined after starvation for 6 h (n = 4-5/group). Data represent mean ± SEM. Significant differences between groups were evaluated using Student s t-test. 2
3 Supplementary figure 2 Effect of high glucose on Akt phosphorylation in the fat bodies of silkworms in vitro. Silkworms were fed a normal diet (N.D.) for 18 h, and then the fat bodies were isolated. Fat bodies were cultured in Grace s insect medium with or without glucose (350 mg/dl) at 27 C for 3 h (n = 3/group). Phosphorylated Akt and β-actin were determined by Western blot analysis (Top). Samples were loaded in the same gel. Cropped blots were used. Relative amount of phosphorylated Akt was determined (Bottom). Data represent mean ± SEM. Significant differences between groups were evaluated using Student s t-test. 3
4 Supplementary figure 3 Increases in glucose levels in the hyperlipidemic silkworm. (A-C) Silkworms were fed a normal diet (N.D.) or a diet containing 10% (w/w) glucose (G.D.) for 18 h. (A) Total sugar levels in hemolymph of the silkworms were determined using the phenol-sulfuric acid method (n = 7/group). (B) Glucose levels in hemolymph of the silkworms were determined using a glucometer (Accu-Chek Aviva, Roche) (n = 7/group). (C) Non-glucose sugar levels in hemolymph of the silkworms were determined by subtracting the amount of glucose from total sugar (n = 7/group). Data represent mean ± SEM. Statistical significance between groups were evaluated using Student s t-test. 4
5 Supplementary figure 4 Relation of developmental age and hemolymph sugar level in silkworms. (A and B) Silkworms were fed a normal diet (N.D.) for 2 days. (A) Body weight of the silkworms were determined (n = 3/group). (B) Total sugar levels in hemolymph of the silkworms were determined using the phenol-sulfuric acid method (n = 3/group). Data represent mean ± SEM. 5
6 Supplementary figure 5 Effects of pioglitazone and metformin against JNK, Akt, AMPK signaling pathway. Silkworms were fed a diet containing 10% (w/w) glucose (G.D.) for 18 h. Pioglitazone (250 µg/larvae) or control solution (0.01 M HCl in PBS) was injected into the silkworm hemolymph. Metformin (200 µg/larvae) or saline (0.9% NaCl) was injected into the silkworm hemolymph. Fat bodies of the silkworms were isolated at 24 h after injection (n = 4/group). Phosphorylated JNK, phosphorylated Akt, phosphorylated AMPK and β-actin were determined by Western blot analysis. Samples were loaded in the same gel. Cropped blots were used. Relative amounts of phosphorylated JNK, phosphorylated Akt, and phosphorylated AMPK were determined. Data represent mean ± SEM. Significant differences between groups were evaluated using Student s t-test. 6
7 Matsumoto, et al. Supplementary figure 6 Full-length blots of Figure 2, 3, and 5D. 7
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production
activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
Supplementary Information
Supplementary Information J. Braz. Chem. Soc., Vol. 24, No. 12, S1-S21, 2013. Printed in Brazil - 2013 Sociedade Brasileira de Química 0103-5053 $6.00+0.00 SI Rui He, a,b,c Bochu Wang,*,b Toshiyuki Wakimoto,
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines
Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei
Supplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila
SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila Ayako Kohyama-Koganeya, 1,2 Takuji Nabetani, 1 Masayuki Miura, 2,3 Yoshio Hirabayashi
Supporting Information High-Yielding One-Pot Synthesis of Glucose from Cellulose Using Simple Activated Carbons and Trace Hydrochloric Acid
Supporting Information High-Yielding ne-pot Synthesis of Glucose from Cellulose Using Simple Activated Carbons and Trace Hydrochloric Acid Hirokazu Kobayashi, Mizuho Yabushita, Tasuku Komanoya, Kenji Hara,
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Drug Discoveries & Therapeutics. 2016; 10(1):
Review Drug Discoveries & Therapeutics. 2016; 10(1):9-13. 9 DOI: 10.5582/ddt.2016.01015 Usefulness of silkworm as a host animal for understanding pathogenicity of Cryptococcus neoformans Masaki Ishii,
SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
Pathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
PROCEDURES: Spruce Haven Farm and Research Center, Auburn, NY.
Effects of feeding a ruminally protected lysine (AjiPro -L) from calving to the fourth week of lactation on production of high producing lactation dairy cattle. J. E. Nocek* 1, T. Takagi 2 and I. Shinzato
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
Fig. S1. High K+ increases intracellular calcium level.
Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence
Successful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis
icell Skeletal Myoblasts Application Protocol Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis Introduction The skeletal muscle is one of the
Amersham ECL Prime Western blotting reagent
GE Healthcare Life Sciences Data file 28-9857-23 AA Western blotting reagents Amersham ECL Prime Western blotting reagent Since its introduction in 199, the enhanced chemiluminescence (ECL) Western Blotting
Pyruvate Alanine 0.15 *** ** ***
SUPPLEMENTARY FIGURES Glucose ΔµM from fresh media / mg protein -1-2 -3 - -.1 -.3 -.5 Lactate Alanine Formate ΔµM from fresh media / mg protein 5 3 2 1.15.1.5.6..2.. NS-3 WT-NS G93A-NS Supplementary Figure
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
Serum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supporting Information
Supporting Information Development of a Highly Sensitive Fluorescence Probe for Hydrogen Peroxide Masahiro Abo,, Yasuteru Urano, Kenjiro Hanaoka,, Takuya Terai,, Toru Komatsu, and Tetsuo Nagano,, * Graduate
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
Involvement of FKBP6 in hepatitis C virus replication
Supplementary Information Involvement of FKBP6 in hepatitis C virus replication Hirotake Kasai 1,*, Kunihiro Kawakami 2,*, Hiromasa Yokoe 3, Kentaro Yoshimura 4, Masanori Matsuda 5, Jun Yasumoto 1, Shinya
stable I. Diet Ingredients Diet Group (g/100 g Dry Weight) High!-3 Low!-3 High!-6 Variable diet fat Palm oil Olive oil Safflower oil 0
stable I. Diet Ingredients Ingredient Diet Group (g/100 g Dry Weight) High!-3 Low!-3 High!-6 Variable diet fat Palm oil 8 10 6.5 Olive oil 3 0 0 Safflower oil 0 3 6.5 EPA 1 1 0 0 DHA 1 1 0 0 Fixed diet
Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
Urgent field safety notice
Accu-Chek Aviva Urgent field safety notice May 2018 Important information on selected lots of Accu-Chek Aviva (50s, 10s) potentially showing an increased number of strip errors prior to dosing or biased
Supplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
The Use of Sea Buckthorn (Hippophae rhamnoides) and Milk Thistle (Silybum marianum) in Alloxan Induced Diabetes Mellitus in Rats
The Use of Sea Buckthorn (Hippophae rhamnoides) and Milk Thistle (Silybum marianum) in Alloxan Induced Diabetes Mellitus in Rats Florin Muselin*, Diana Brezovan, Jelena Savici, Romeo T. Cristna, Eugenia
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
![TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]](/thumbs/89/99233308.jpg "TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]")
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
ALKA VITA DIABETES TEST
ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O
Supporting Online Material for
www.sciencemag.org/cgi/content/full/science.118828/dc1 Supporting Online Material for Is an Anti-Inflammatory Adipokine That Modulates Metabolic Dysfunction in Obesity Noriyuki Ouchi, Akiko Higuchi, Koji
mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions
Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/11/eaaq0723/dc1 Supplementary Materials for Synthetic smart gel provides glucose-responsive insulin delivery in diabetic mice Akira Matsumoto, Miyako Tanaka,
KILLER CARBS: EFFECTS OF 50% DEXTROSE TREATMENT ON POSTNATAL HYPOGLYCEMIC RATS
KILLER CARBS: EFFECTS OF 50% DEXTROSE TREATMENT ON POSTNATAL HYPOGLYCEMIC RATS K. L. G. Hinz Breck School, Minneapolis, MN Hypoglycemia that affects 5-15% of all newborns can cause seizures that lead to
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance
ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3
Evaluation of drug-induced tissue injury by measuring alanine aminotransferase (ALT) activity in silkworm hemolymph
Inagaki et al. BMC Pharmacology and Toxicology 212, 13:13 RESEARCH ARTICLE Open Access Evaluation of drug-induced tissue injury by measuring alanine aminotransferase (ALT) activity in silkworm hemolymph
AMPK Phosphorylation Assay Kit
AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Journal of Chemical and Pharmaceutical Research
Available on line www.jocpr.com Journal of Chemical and Pharmaceutical Research ISSN No: 0975-7384 CODEN(USA): JCPRC5 J. Chem. Pharm. Res., 2011, 3(1):452-456 Evaluation of anti hyperglycaemic activity
SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
Effectiveness of inhaled furosemide for acute asthma exacerbation: a meta-analysis
Inokuchi et al. Critical Care 2014, 18:621 LETTER Effectiveness of inhaled furosemide for acute asthma exacerbation: a meta-analysis Ryota Inokuchi 1,2*, Ai Aoki 1,3,4, Yuta Aoki 1,4 and Naoki Yahagi 1
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Biomechanism of chlorogenic acid complex mediated plasma free fatty acid metabolism in rat liver
H.V. et al. BMC Complementary and Alternative Medicine (2016) 16:274 DOI 10.1186/s12906-016-1258-y RESEARCH ARTICLE Open Access Biomechanism of chlorogenic acid complex mediated plasma free fatty acid
Metabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
EmergencyKT: New Onset Diabetes, Non-DKA Definition: ED patient with newly discovered hyperglycemia, >200 mg %
EmergencyKT: New Onset, Non-DKA Definition: ED patient with newly discovered hyperglycemia, >200 mg % Obtain: CBCD EP1 VBG Serum Ketone Hemoglobin A1c (for follow up) UA β-hcg (female at risk for pregnancy)
Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
![Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.](/thumbs/90/103696086.jpg "Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.")
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
Supplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
2-D DIGE * 1,2. * src Src ras 2002 LC-MS/ MS. prefractionation. Proteome Letters
Proteome Letters 2016 1 11-18 2015 2-D DIGE * 1,2 *E-mail: hattoris@pharm.kitasato-u.ac.jp 1 108-8639 4-6-1 2 108-8641 5-9-1 2016 4 22 2016 5 31 2016 6 1 two-dimensional fluorescence difference gel electrophoresis:
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Metabolic Syndrome: What s so big about BIG?
Tuesday, 10:00 11:30, A2 Objectives: Notes: Metabolic Syndrome: What s so big about BIG? Patrice Conrad pbconrad1@att.net 1. Identify advances in clinical assessment and management of selected healthcare
Accuracy and Precision Performance of the Accu-Chek Mobile System. Introduction. Method
Accuracy and Precision Performance of the Accu-Chek Mobile System I. ACCURACY The accuracy of the system was assessed according to ISO 15197. Introduction The purpose of this study was to determine the
LONG-TERM ADMINISTRATION OF MELATONIN ATTENUATES NEUROINFLAMMATION IN THE AGED MOUSE BRAIN
Supplementary data to: LONG-TERM ADMINISTRATION OF MELATONIN ATTENUATES NEUROINFLAMMATION IN THE AGED MOUSE BRAIN Kannika Permpoonputtana 1, Patlada Tangweerasing 2, Sujira Mukda 2, Parichart Boontem 3,
islets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
![2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein](/thumbs/86/94743397.jpg "2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein")
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
Title: Vectorization of biomacromolecules into cells using extracellular vesicles with enhanced internalization induced by macropinocytosis
Scientific Reports Supplementary information Title: Vectorization of biomacromolecules into cells using extracellular vesicles with enhanced internalization induced by macropinocytosis Authors: Ikuhiko
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Evaluation of hypoglycemic and antihyperglycemic effects of Luffa cylindrica fruit extract in rats
Evaluation of hypoglycemic and antihyperglycemic effects of Luffa cylindrica fruit extract in rats Manjusha Hazra 1, Sriparna KunduSen 2*, Sanjib Bhattacharya 3, Pallab K Haldar 2, Malaya Gupta 2, Upal
Supplementary Information
Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Obese Type 2 Diabetic Model. Rat Model with Early Onset of Diabetic Complications. SDT fatty rats. SDT fatty rats
Obese Type 2 Diabetic Model rats Rat Model with Early Onset of Diabetic Complications rats Background and Origin In 24, Dr. Masuyama and Dr. Shinohara (Research Laboratories of Torii Pharmaceutical Co.,