Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Transcription

1 Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21 -/- mice at day 3 (d3, n=5 per group) and day 7 (d7, n=5 per group) after the last dose of caerulein. Scale bars=200µm. (b) Percentage of necrotic cells. NS: not significant.

2 Supplementary Figure 2. Knockout of mir-21 protects pancreatitisassociated lung injury in mice. (a) Representative histological sections of lung stained with hematoxylin and eosin from caerulein-treated WT and mir-21 -/- mice at day 1 (d1, n=12 per group) after the last caerulein injection. Scale bars=100µm. (b) MPO activity was measured as described in Materials and Methods. ** indicates a significant difference between WT and mir-21 -/- mice (P<0.01).

3 Supplementary Figure 3. Response of WT and mir-21 -/- bone marrowderived macrophages (BMDMs) to LPS and IL-4. Real-time PCR analysis of gene expression in BMDMs isolated from WT and mir-21 -/- mice and treated with LPS (a) and IL-4 (b). Values are mean±sd (n=5). ** indicates a significant difference between WT and mir-21 -/- BMDMs treated with LPS or IL-4 (P<0.01).

4 Supplementary Figure 4: Analysis of circulating blood cells in mice transplanted with bone marrow cells isolated from WT or mir-21 -/- mice. (a) Leukocyte analysis. (b-f) show levels of chimerism in blood as determined by FACS. (b) Leukocytes (% of CD45.2 cells). (c) Granulocytes (% of CD45.2 among Gr-1 pos cells). (d) B-lymphocytes (% of CD45.2 among B220 pos cells). (e) T-lymphocytes (% of CD45.2 among CD3 pos cells). (f) Monocytes (% of CD45.2 among CD11b pos cells). There are no significant differences between mice transplanted from WT bone marrow and those transplanted from mir-21 -/- bone marrow.

5 Supplementary Figure 5: Gating for flow cytometry analysis of mice with transplantation. A representative gating image is shown for the analysis of donor derived cells (CD45.2) among (a) whole leukocyte population, (b) granulocytes, (c) B-cells, (d) T-cells and (e) monocytes.

6 Supplementary Figure 6. The effects of mir-21 deletion on cholecystokinin receptor, A (CCKAR) and B (CCKBR). (a) Western blotting analyses of CCKAR and CCKBR expression in pancreata. Pancreata of WT and mir-21 -/- mice treated with caerulein were harvested at d1 after the last dose injection (each lane for one animal). (b) Acinar cells were treated with CCK-8 for 2, 4 and 6 h, and then CCKAR and CCKBR were measured using western blotting. (c) Acinar cells were treated with CCK-8 for 1, 2 and 4 h, and the supernatants were collected to measure the amylase activity as described in Materials and Methods. NS: not significant.

7 Supplementary Figure 7. Caspase 8 inhibition reverses the protective effect of mir-21 loss in acute pancreatitis induced by caerulein. (a) mir-21 -/- mice were intraperitoneally injected with z-vad-fmk (5mg kg 1 ) 1h before injection of caerulein (n=6 per group). At d1 after the last caerulein injection, pancreata were fixed and stained with hematoxylin. Scale bars=200µm. (b) Percentage of necrotic cells in (a). (c) mir-21 -/- mice were intraperitoneally injected with z- IETD-fmk (5mg kg 1 ) 1h before injection of caerulein (n=6 per group). At d1 after the last caerulein injection, pancreata were fixed and stained with hematoxylin. Scale bars=200µm. (d) Percentage of necrotic cells in (c). ** indicates a significant difference between the marked two groups (P<0.01).

8 Supplementary Figure 8. mir-21 deletion protects L-arginine-induced acute pancreatitis. (a) Representative histological sections of pancreata stained with hematoxylin from L-arginine (L-Arg)-treated WT and mir-21 -/- mice at day 3 (n=5 for untreated and PBS treated, n=7 for L-Arg). Scale bars=200µm. (b) Serum amylase level in L-Arg-treated WT and mir-21 -/- mice at day 3 (n=5 for untreated and PBS, n=7 for L-Arg). (c) Serum lipase in L-Arg-treated WT and mir-21 -/- mice at day 3 (n=5 for untreated and PBS, n=7 for L-Arg). (d) Percentage of necrotic cells. ** P<0.01 indicates significant difference between WT and mir-21 -/- groups.

9 Supplementary Figure 9. The impact of FasL on caerulein-induced pancreatitis in WT or mir-21 -/- mice. (a) Representative histological sections of pancreata stained with hematoxylin from caerulein or caerulein plus FasL treated WT mice (n=5 for each group). FasL was mixed with caerulein, and intraperitoneally injected into mice. Scale bars=200µm. (b) Percentage of necrotic cells. (d) Representative histological sections of pancreata stained with hematoxylin from caerulein or caerulein+mfl3 treated mir-21 -/- mice (n=5 for each group). MFL3 (200μg) was injected intravenously 15min before injection of caerulein. Scale bars=200µm. (d) Percentage of necrotic cells. NS: not significant.

10 Supplementary Figure 10. The effect of necrostatin-1 on caerulein-induced pancreatitis in WT and mir-21 -/- mice. (a) Representative histological sections of pancreata stained with hematoxylin from caerulein or caerulein+necrostatin-1 (Nec-1) treated WT and mir-21 -/- mice (n = 5 for each group). Nec-1 (1.65 mg kg 1 ) was injected intraperitoneally in WT and mir-21 -/- mice with caerulein. Scale bars = 200µm. (b) Percentage of necrotic cells s. * P<0.05 and ** P<0.01 indicate a significant difference between the marked groups. NS: not significant.

11 Supplementary Figure 11. The effect of necrostatin-1 on TNFα-induced shock in WT and mir-21 -/- mice. Representative histological sections of ileum (a), kidney (c), and liver (e) stained with hematoxylin and eosin 3 h after TNF-α or TNF-α+necrostatin-1(Nec-1) injection in WT and mir-21 -/- mice. Nec-1(125 μg) was delivered intravenously 15 min before injection of TNFα. Scale bars = 200 µm for ileum and 100 µm for kidney and liver (n=5 for both PBS and treated groups). Tissue damage scores for ileum (b), kidney (d) and liver (f) were evaluated. *P<0.05 indicate significant difference between WT and mir-21 -/- mice treated with TNF-α or TNFα+Nec1. NS: not significant.

12 Supplemental Figure 12. Unedited scan for all Western blotting images. White arrow and dashed line box show the lanes of the unedited gel correspond to those shown in the cropped images used in figures and supplementary figures. Full unedited gel for Figure 3e RIP1 Full unedited gel for Figure 3e RIP3 Full unedited gel for Figure 3e FADD 1 Full unedited gel for Figure 3e FADD 2 Full unedited gel for Figure 3e GAPDH 1

13 Full unedited gel for Figure 3e GAPDH 2 Full unedited gel for Figure 3f PTEN 1 GAPDH 75 Full unedited gel for Figure 3f PTEN 2 Full unedited gel for Figure 3f PDCD Full unedited gel for Figure 3f FasL Full unedited gel for Figure 3f Spry2

14 Full unedited gel for Figure 3f Bcl 2 Full unedited gel for Figure 3f GAPDH 10 Full unedited gel for Figure 3g Total Caspase8 Full unedited gel for Figure 3g p43(cleaved Caspase8) Full unedited gel for Figure 3g Total Caspase3 Full unedited gel for Figure 3g GAPDH

15 Full unedited gel for Figure 3k RIP1 Full unedited gel for Figure 3k RIP3 Full unedited gel for Figure 3k FADD Full unedited gel for Figure 3k GAPDH 25 Full unedited gel for Figure 3l Pten Full unedited gel for Figure 3l FasL

16 Full unedited gel for Figure 3l GAPDH Full unedited gel for Figure 4b Pten 75 Full unedited gel for Figure 4b FasL Full unedited gel for Figure 4b GAPDH Full unedited gel for Figure 6e IP:FADD; WB:RIP3 Full unedited gel for Figure 6e IP:FADD; WB:RIP1

17 Full unedited gel for Figure 6e IP:FADD; WB:FADD Full unedited gel for Figure 6e Input:RIP3 Full unedited gel for Figure 6e Input:RIP1 Full unedited gel for Figure 6e Input:FADD 75 Full unedited gel for Figure 6e Input:β actin Full unedited gel for Figure 6f Pten 75

18 Full unedited gel for Figure 6f FasL Full unedited gel for Figure 6f β actin Full unedited gel for Figure 6h IP:FADD;WB:RIP3 Full unedited gel for Figure 6h IP:FADD;WB:RIP1 75 Full unedited gel for Figure 6h IP:FADD;WB:FADD Full unedited gel for Figure 6h Input:RIP3

19 Full unedited gel for Figure 6h Input:RIP1 Full unedited gel for Figure 6H Input:FADD 75 Full unedited gel for Figure 6h Input:β actin Full unedited gel for Supplementary Figure 7a CCKAR Full unedited gel for Supplementary Figure 7a CCKBR Full unedited gel for Supplementary Figure 7a GAPDH

20 Full unedited gel for Supplementary Figure 7b CCKAR Full unedited gel for Supplementary Figure 7b CCKBR 75 Full unedited gel for Supplementary Figure 7b GAPDH

21 Supplementary Table 1. Primer sequences of M1 and M2 genes in real-time PCR analysis Gene name Forward Reverse IL12A ccatcagcagatcattctagacaa cgccattatgattcagagactg IL23 tccctactaggactcagccaac tgggcatctgttgggtct IL6 gctaccaaactggatataatcagga ccaggtagctatggtactccagaa TNFa tcttctcattcctgcttgtgg ggtctgggccatagaactga IL1b tgtaatgaaagacggcacacc tcttctttgggtattgcttgg CXCL9 cttttcctcttgggcatcat gcatcgtgcattccttatca CXCL10 gctgccgtcattttctgc tctcactggcccgtcatc H2-Ab1 gtggtgctgatggtgctg ccatgaactggtacacgaaatg CD86 gaagccgaatcagcctagc cagcgttactatcccgctct NOS2 gggctgtcacggagatca ccatgatggtcacattctgc PTGS2 gatgctcttccgagctgtg ggattggaacagcaaggattt ARG1 cctgaaggaactgaaaggaaag ttggcagatatgcagggagt CD163 tctcagtgcctctgctgtca cgccagtctcagttccttct CSF1 caacagctttgctaagtgctcta cactgctaggggtggcttta IL10 cagagccacatgctcctaga gtccagctggtcctttgttt MMP9 acgacatagacggcatcca gctgtggttcagttgtggtg MRC1 ccacagcattgaggagtttg acagctcatcatttggctca VEGFA aaaaacgaaagcgcaagaaa tttctccgctctgaacaagg CCL22 tcttgctgtggcaattcaga gagggtgacggatgtagtcc IFNG atctggaggaactggcaaaa ttcaagacttcaaagagtctgaggta CCL17 tgcttctggggacttttctg gaatggcccctttgaagtaa ACTB ctaaggccaaccgtgaaaag accagaggcatacagggaca