% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.

Size: px

Start display at page:

Download "% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1."

Jesse Haynes
5 years ago
Views:

1 A B C T cell count (1 6 ) * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index * Division Index D E %Ki67+ cells % of Cells 8 ormoxia 6 ypoxia 4 2 * Annexin V - Annexin V + Annexin V + 7AAD - 7AAD - 7AAD + Supplementary Figure 1

2 Supplementary Figure 1. ypoxia impairs proliferation and survival of human peripheral blood T cells (PB-Ts). PB-Ts were activated with OKT3/a-CD28 Abs in either normoxia () or hypoxia (). (A) Cell counts of PB-Ts at 72 hrs after activation. Dashed line indicates cell counts of plated cells. =6; *: p=.7 (paired Student s t-test). (B) CFSE dilution of CFSE-labeled PB- Ts at 72 hrs. (C) Quantitative analysis of the CFSE dilution in (B). The proliferation and division indexes were calculated using Flowjo. =6; *: p=.1; : p=.3 (paired Student s t-test). (D) Expression of Ki67 in PB-Ts at 72 hrs. =4; : p<.1 (paired Student s t-test). (E) Annexin- V and 7-AAD staining of PB-Ts at 72 hrs. =6; : p<.1; *: p=.1; : p=.12 (twoway AOVA with Bonferroni post-hoc analysis). Error bars indicate standard deviatio.

A B C PB-Ts CCR7 21% 56% 35% 11% 13% 1%.5% 53.

6 4 2 CD45RA + CD45RA - CD45RA - CCR7 - CCR7 + CCR7 - PB-Ts % of Cells 8

CD4 CD4 CD4 72% 38% 4% 41% 3% 65% 1% 33% % 44% 15% 43% 13% 38% 6% 44% 4%

3 A B C PB-Ts CCR7 21% 56% 35% 11% 13% 1%.5% 53.5% 22% 15% 59% 13% 58% 5% CD45RA CD45RO 1% 18% CD45RA % of Total Cells CD45RA + CD45RA - CD45RA - CCR7 - CCR7 + CCR7 - PB-Ts % of Cells CD4 CD8 PB-Ts T EM D T EM E T EM F T EM 2% 53% 1% 31% 2% 64% % 56% CD4 CD4 CD4 72% 38% 4% 41% 3% 65% 1% 33% % 44% 15% 43% 13% 38% 6% 44% 4% 51% CD8 CD8 CD8 41% 25% CD27 4% 2% 19% 3% CD62L 6% 44% 1% 44% CD28 CD45RO CD25 Supplementary Figure 2

4 Supplementary Figure 2. Phenotypic analysis of PB-Ts and ex vivo expanded human effectormemory T cells ( ). (A) Expression of CD45RA and CCR7 on PB-Ts (top) and (bottom). (B) Percentage of CD45RA + CCR7 +, CD45RA - CCR7 + and CD45RA - CCR7 - cells in PB-T and populatio. (C) Percentage of CD4 + and CD8 + cells in PB-T, and FACS-sorted T EM populatio. =3 (D-F) Expression of memory-related surface markers CD27, CD28, CD45RO, CD62L and CD25 on CD4 + or CD8 + FACS-sorted T EM and cells. =3.

5 BCL2 BIP3 BCL2L1 (to ACTB) (to ACTB) * (to ACTB) FAS FASLG TP53 (to ACTB) (to ACTB) (to ACTB) BAX BAK BAD (to ACTB) (to ACTB) (to ACTB) Supplementary Figure 3

6 Supplementary Figure 3. Apoptosis gene expression profile. Expression of 3 anti-apoptotic (BCL2, BIP3 and BCL2L1) and 6 pro-apoptotic genes (FAS, FASLG, TP53, BAX, BAK and BAD) in that were activated with OKT3/a-CD28 Abs in either normoxia () or hypoxia () for 24 hrs. =4, : p=.76 for BCL2; *: p=.269 for BIP3; : p=.24 for FAS (paired Student s t-test).

7 A B C % of Cells % of Max CD4 + CD8 + ormoxia ypoxia o Stim. Division Index * * CD4 CD8 CellTrace Violet. CD4 CD8 D % of Cells CD4 + ormoxia ypoxia * % of Cells * CD8 + E ng/ml/1 6 cells ormoxia ypoxia IL-2 IF-γ TF-α F CD4 CD8 CD4 CD8 ormoxia ypoxia Isotype o Stim % of Max * ormoxia ypoxia Annexin V - Annexin V + Annexin V + 7AAD - 7AAD - 7AAD + Annexin V - Annexin V + Annexin V + 7AAD - 7AAD - 7AAD + OKT3/aCD28 CD25 CD69 Supplementary Figure 4

8 Supplementary Figure 4. ypoxia does not affect CD4/CD8 ratio, cytokine production and expression of activation markers in. were activated with OKT3/a-CD28 Abs in either normoxia () or hypoxia () for 24 hrs. (A) Percentage of CD4 + and CD8 + cells. =4. (B) CellTrace Violet (CTV) dilution of CTV-labeled CD4 + or CD8 + at 72 hrs after activation. =3. (C) The division indexes were calculated using Flowjo. =3; *: p<.1 (two-way AOVA with Bonferroni post-hoc analysis). (D) Annexin-V and 7-AAD staining of CD4 + or CD8 + at 72 hrs after activation. =3. *: p<.5; : p<.1; *: p<.1 (two-way AOVA with Bonferroni post-hoc analysis). (E) Secretion of IL-2, IF-γ and TF-α. =4. (F) Expression of CD25 and CD69 in 24 hrs after activation. =5.

9 T M B T T M B T B uman PBMCs T T Pan-T cells selection T T T T uman T cells T FACS sorting CCR7 T CM 2% T EM 7% CD45RA T aive 62% T T CM T EM Starting After Sorting #PBMCs # T cells T aive T CM T EM Donor 1 13M 4M 14M 6.8M 3M Donor 2 2M 5M 1.8M 12M 6M Donor 3 3M 55M 16M 5.9M 1.7M Supplementary Figure 5

10 Supplementary Figure 5. FACS-sorting of T, T CM and T EM from human PBMCs and cell number before and after sorting.

11 A B % of Cells % Specific Lysis 1 5 * * * ormoxic-car.gd2-t ypoxic-car.gd2-t ormoxic-t ypoxic-t CD4 CD8 4:1 2:1 1:1 5:1 CAR.GD2-T:Tumor ratios Supplementary Figure 6

12 Supplementary Figure 6. ypoxia enhances per-cell cytotoxicity of CAR.GD2-T. (A) CD4 and CD8 composition of CAR.GD2-T co-cultured with LA--1 target cells in hypoxia or normoxia for 48 hrs. =3. (B) LA--1 GFP + cells were labeled with 51 Cr and co-cultured with CAR.GD2-T or non-traduced (T) in normoxia or hypoxia at 4:1, 2:1, 1:1, 5:1 effector:target ratio. The cytotoxic activity of CAR.GD2-T was determined after 6 hrs of co-culture. =3. : p<.1; *: p<.1 (two-way AOVA with Bonferroni post-hoc analysis).

13 A Cell umber (x1 6 ) µM 1µM B Cell umber (x1 6 ) * 5nM 1nM C Cell umber (x1 6 ) Ctrl IF1α-Td BAY DMOG D E F G % Live cells * % KI67 + cells % of Max Ctrl ormoxia IF1αTd ormoxia o Stim. (to ACTB) x Ctrl IF1α-Td Ctrl IF1α-Td CellTrace Violet. PB-Ts Supplementary Figure 7

14 Supplementary Figure 7. IF1α is required and sufficient for enhancing functionality of in hypoxia. (A) Cell counts of stimulated with OKT3/a-CD28 Abs in normoxia () or hypoxia () for 72 hrs with or without the IF1α inhibitor BAY (BAY). =3; : p=.47; : p<.1 (one-way AOVA with Bonferroni post-hoc analysis). (B) Cell counts of stimulated with OKT3/a-CD28 Abs in or for 72 hrs with or without the IF1α activator DMOG. =3; *: p=.2; : p>.5 (one-way AOVA with Bonferroni post-hoc analysis). (C-F) IF1α traduced (IF1α-Td) or mock-traduced (Ctrl) were stimulated with OKT3/a-CD28 Abs in. Total cell counts (C), cell viability (D) and Ki67-expressing cells (E) at 72 hrs post stimulation. =7 for (C, D); : p<.1; *: p=.6; =4 for (E); : p=23 (paired Student s t-test). (F) CellTrace Violet dilution of labeled IF1α-Td or Ctrl at 72 hrs after stimulation. -3. (G) mra expression of EPAS1 (IF2α) in PB-Ts and. Expression level is normalized to ACTB. Error bars indicate standard deviation.

15 A B o Stim or o Stim yp OKT3/aCD28 or OKT3/aCD28 yp IF1α MFI Isotype IF1α S S Act Act C D T o Stim or o Stim yp OKT3/aCD28 or OKT3/aCD28 yp IF1α MFI T T CM TEM T CM 5 Isotype S S ACT ACT T EM IF1α Supplementary Figure 8

16 Supplementary Figure 8. Intracellular staining of IF1α in and T cell memory subsets. (A-B) and FACS-sorted T, T CM and T EM (C-D) were utimulated or stimulated with OKT3/a-CD28 Abs in normoxia () or hypoxia () for 24 hrs and stained for intracellular IF1α. =2 for and =3 for T memory subsets.

17 A Deitometry E o Stim GLUT1 * o Stim OKT3/a-CD28 OKT3/a-CD28 * PB-Ts F B Glucose Coumption (ng) ±4.4 o Tx 51±2.5 2DG C Proliferation Index o Tx 2DG Oligo G * ormoxia ypoxia D Divison Index * o Tx 2DG Oligo ormoxia ypoxia Cell umber (x1 6 ) o Tx ormoxia ypoxia Oligo % Live cells o Tx ormoxia ypoxia Oligo Supplementary Figure 9

18 Supplementary Figure 9. display elevated IF1α expression and glycolytic activity. (A) Deitometric analysis of GLUT1 protein in Fig. 5C. =3. *: p<.5; : p<.1; *: p<.5 (two-way AOVA with Bonferroni post-hoc analysis). (B) Glucose coumption of that were untreated (o Tx) or were treated with 1mM 2DG under conditio of normoxia. =3. umbers above the bar indicates mean coumption ± standard deviation. Proliferation index (C) and division index (D) of that were untreated or exposed to 1mM 2DG or 5nM oligomycin (Oligo) after stimulation with OKT3/a-CD28 Abs in or. (E,F) PB-Ts were treated with 5nM oligomycin or left untreated and stimulated with OKT3/a-CD28 Abs in or. Cell counts (E) and cell viability (F) were determined 72 hrs post-activation. =6. : p<.1; : p=.11 (two-way AOVA with Bonferroni post-hoc analysis). (G) CellTrace Violet dilution of labeled PB- T at 72 hrs post-stimulation. =3. Error bars indicate standard deviation.

19 A C o Stim IF1A OKT3 a-cd28 PB-Ts B ng per 1 6 cells o Stim DMSO o Stim OKT3/a-CD28 OKT3/a-CD28 ng per 1 6 cells o Stim MG132 * * o Stim OKT3/a-CD28 OKT3/a-CD28 PB-Ts o Stim OKT3 acd28 o Stim OKT3 acd28 PB-Ts ormoxia ypoxia Isotype p-s6 p-mtor Supplementary Figure 1

20 Supplementary Figure 1. Comparison of IF1A mra, IF1α proteasomal degradation, and mtor activity in PB-Ts and. (A) IF1Α mra expression in PB-Ts and that were utimulated or stimulated with OKT3/a-CD28 Abs in hypoxia () for 24 hrs. Expression was normalized agait the house keeping control 18S RA and then standardized to 1. in utimulated PB-Ts. =3. (B) Quantification of IF1α protein expression by quantitative IF1α ELISA in PB-Ts and that were utimulated or stimulated with OKT3/a-CD28 Abs in the presence of DMSO or 1µM MG132 in normoxia or. =3 for PB-Ts and =4 for ; *: p<.5; : p<.1 (two-way AOVA with Bonferroni post-hoc analysis). (C) Phosphorylation of S6 and mtor in PB-Ts and that were utimulated or stimulated with OKT3/a-CD28 Abs in or for 24 hrs. =3. Error bars indicate standard deviation.

21 A B uman IF1α 3 UTR GCTTTTTCTTAATTTCATTCCTTTTTTTGGACACTGGTGGCTCATTACCTAAAGCAGTCTATTTATATTTT CTACATCTAATTTTAGAAGCCTGGCTACAATACTGCACAAACTTGGTTAGTTCAATTTTGATCCCCTTTCT ACTTAATTTACATTAATGCTCTTTTTTAGTATGTTCTTTAATGCTGGATCACAGACAGCTCATTTTCTCAG TTTTTTGGTATTTAAACCATTGCATTGCAGTAGCATCATTTTAAAAAATGCACCTTTTTATTTATTTATTT TTGGCTAGGGAGTTTATCCCTTTTTCGAATTATTTTTAAGAAGATGCCAATATAATTTTTGTAAGAAGGCA GTAACCTTTCATCATGATCATAGGCAGTTGAAAAATTTTTACACCTTTTTTTTCACATTTTACATAAATAA TAATGCTTTGCCAGCAGTACGTGGTAGCCACAATTGCACAATATATTTTCTTAAAAAATACCAGCAGTTAC TCATGGAATATATTCTGCGTTTATAAAACTAGTTTTTAAGAAGAAATTTTTTTTGGCCTATGAAATTGTTA AACCTGGAACATGACATTGTTAATCATATAATAATGATTCTTAAATGCTGTATGGTTTATTATTTAAATGG GTAAAGCCATTTACATAATATAGAAAGATATGCATATATCTAGAAGGTATGTGGCATTTATTTGGATAAAA TTCTCAATTCAGAGAAATCATCTGATGTTTCTATAGTCACTTTGCCAGCTCAAAAGAAAACAATACCCTAT GTAGTTGTGGAAGTTTATGCTAATATTGTGTAACTGATATTAAACCTAAATGTTCTGCCTACCCTGTTGGT ATAAAGATATTTTGAGCAGACTGTAAACAAGAAAAAAAAAATCATGCATTCTTAGCAAAATTGCCTAGTAT GTTAATTTGCTCAAAATACAATGTTTGATTTTATGCACTTTGTCGCTATTAACATCCTTTTTTTCATGTAG ATTTCAATAATTGAGTAATTTTAGAAGCATTATTTTAGGAATATATAGTTGTCACAGTAAATATCTTGTTT TTTCTATGTACATTGTACAAATTTTTCATTCCTTTTGCTCTTTGTGGTTGGATCTAACACTAACTGTATTG TTTTGTTACATCAAATAAACATCTTCTGTGGACCAGGCAAAAAAAAAAAAAAAAAAAAAAA C 3 UTR: Ctrl IF1α IF1α ΔARE MFI: 5927 MFI: 5445 MFI: % 33% 35% MFI: 4688 MFI: 1842 MFI: 3829 GFP MFI (1 4 ) * * 3'UTR: Ctrl IF1α IF1a ΔARE +2DG 34% 15% 26% : o Tx 2-DG GFP Supplementary Figure 11

22 Supplementary Figure 11. Regulation of IF1α expression by 3 UTR (A) Sequence of the human IF1A mra 3 UTR. Yellow highlights pentamer AREs and red and blue highlight two coecutive nonamer AREs. ARE, AU-rich element. (B) were cultured with IL-2 with or without 1mM 2DG for 48 hrs and subsequently trafected with reporter cotructs containing different 3 UTR sequences by nucleofection. Expression of GFP reporter was measured 8 hrs post nucleofection. =3. *: p<.5 (Paired student s t-test).

23 A D G CCR GAPD mra Mock GAPD-Td Mock GAPD-Td 36% 27% 22% 13% 33% 4% 6% 5% 1% 31% 13% 23% 41% 18% 48% 16% CD45RA B CD4 CD8 Relative Inteity E Mock Glucose Coumption (ng per 24hrs) Donor 1 Donor 2 GAPD Td * Mock GAPD Td GAPD CD3ζ Mock GAPD-Td C F % KI67+ T cells o Stim IF1A o Stim OKT3/a-CD28 OKT3/a-CD28 T GAPD-Td Mock GAPD-Td % of Ki67 + Cells P1 - P1 + Mock CAR.GD2-T GAPD CAR.GD2-T Supplementary Figure 12

24 Supplementary Figure 12. The expression of IF1α in T cell memory subsets is tralationally regulated by GAPD. Mock-traduced (mock) or GAPD-traduced (GAPD-Td) were stimulated with OKT3/a-CD28 Abs stimulated in normoxia () or hypoxia (). GAPD mra (A) and protein (B) expression of mock or GAPD-Td cells determined by qpcr and western blot, respectively. =3 for mra and =2 for protein. (C) Detection of IF1α mra expression in mock or GAPD-Td 72 hrs after stimulation. =3. (D) Expression of CD45RA and CCR7 on CD4 + and CD8 + mock or GAPD-TD cells. =3. (E) Glucose coumption at 24 hrs post-stimulation. =3; *p=.194; p=.17 (two-way AOVA with post-hoc analysis). (F) Percentage of Ki67 + mock-traduced or GAPD-traduced at 72 hrs post-stimulation. =3; : p<.1 (two-way AOVA with post-hoc analysis). (G) In vivo proliferation of CAR.GD2-T co-traduced with GAPD or mock vector in normoxic (P1 - ) or hypoxic (P1 + ) tumor area. : p=.25 (Two-way AOVA with Bonferroni post-hoc analysis). Error bars indicate standard deviation.

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry