SERINC3 and SERINC5 restrict HIV-1 infectivity and are counteracted by Nef

Transcription

1 doi:1.138/nture154 SERINC3 nd SERINC5 restrict HIV-1 infectivity nd re countercted y Nef Yoshiko Usmi 1, Yunfei Wu 1 & Heinrich G. Göttlinger 1 HIV-1 Nef nd the unrelted mouse leukemi virus glycosylted Gg (glycogg) strongly enhnce the infectivity of HIV-1 virions produced in certin cell types in clthrin-dependent mnner. Here we show tht Nef nd glycogg prevent the incorportion of the multipss trnsmemrne proteins serine incorportor 3 (SERINC3) nd SERINC5 into HIV-1 virions to n extent tht correltes with infectivity enhncement. Silencing of oth SERINC3 nd SERINC5 precisely phenocopied the effects of Nef nd glycogg on HIV-1 infectivity. The infectivity of nef-deficient virions incresed more thn 1-fold when produced in doule-knockout humn CD4 1 T cells tht lck oth SERINC3 nd SERINC5, nd re-expression experiments confirmed tht the sence of SERINC3 nd SERINC5 ccounted for the infectivity enhncement. Furthermore, SERINC3 nd SERINC5 together restricted HIV-1 repliction, nd this restriction ws evded y Nef. SERINC3 nd SERINC5 re highly expressed in primry humn HIV-1 trget cells, nd inhiiting their downregultion y Nef is potentil strtegy to comt HIV/AIDS. Nef is n ccessory protein encoded y HIV-1 nd other primte lentiviruses. In vivo, Nef is mjor pthogenicity determinnt tht is required for high virus lods 1 3. Although not essentil for virus repliction in cell culture, Nef enhnces virus spreding in primry CD4 1 T cells, prticulrly when such cells re infected efore mitogenic stimultion 4 6. Nef roustly downregultes the virl entry receptor CD4 from the surfce of virus-producing cells y inducing its clthrin-dependent endocytosis nd susequent lysosoml degrdtion 7 1. A recent study suggests tht n importnt physiologicl function of CD4 downregultion y Nef is to prevent the CD4-induced exposure of epitopes in HIV-1 envelope (Env) tht mke infected cells susceptile to ntiody-dependent cell-medited cytotoxicity 11. Aprt from CD4, Nef downregultes severl other cell surfce proteins 12. The selective down-modultion of HLA-A nd HLA-B ut not of HLA-C y Nef serves to protect infected cells oth from cytotoxic T cells nd from nturl killer cells The Nef proteins of most primte lentiviruses lso down-modulte the T cell receptor complex, which is thought to protect infected T cells from ctivtioninduced cell deth in non-pthogenic nturl SIV infections 16.This function of Nef ws lost in HIV-1 nd closely relted viruses, which my contriute to the pthogenicity of HIV-1 in humns 16. One of the most conserved yet poorly understood functions of Nef is the enhncement of progeny virion infectivity 17,18. Although Nef exerts its effect on HIV-1 infectivity in virus producer cells, it does not detectly ffect virus morphogenesis or mturtion Nevertheless, progeny virions produced in the sence of Nef do not efficiently reverse trnscrie their genome in trget cells 19,2.It hs een reported tht high levels of cell-surfce CD4 inhiit the relese or infectivity of HIV-1 progeny virions, nd tht Nef relieves these effects 23,24. However, the enhncement of HIV-1 infectivity depends on residues within Nef tht re dispensle for its ility to downregulte CD4 (ref. 25). Furthermore, Nef enhnces HIV-1 progeny virion infectivity even when CD4 is not expressed or cnnot e downregulted 17,19,2. Finlly, the glycogg protein of Moloney murine leukemi virus (MLV) closely mimics the effect of Nef on HIV-1 infectivity, even though glycogg does not downregulte CD4 (ref. 26). MLV glycogg is n ccessory protein whose trnsltion egins t n inefficient CTG strt codon upstrem nd in-frme with the gg gene 27. The resulting product is type II trnsmemrne protein with n mino-terminl cytosolic non-gg portion nd n extrcellulr Gg domin 28. The potent Nef-like ctivity of glycogg on HIV-1 infectivity resides entirely in its cytosolic domin, which is unrelted to Nef 29. Nevertheless, the effects of Nef nd glycogg on HIV-1 infectivity pper mechnisticlly relted. Both re similrly dependent on the producer cell type 26, re similrly determined y vrile regions of HIV-1 Env 3, nd exhiit similr relince on clthrin-medited endocytosis 29,31,32. However, the moleculr sis for these similrities remins unknown. Nef inhiits the incorportion of SERINC proteins Becuse of the essentil role of the endocytic mchinery in the enhncement of HIV-1 infectivity y Nef or glycogg, we exmined the possiility tht oth proteins downregulte restriction fctor tht gets incorported into ssemling virions in their sence. To identify fctors whose incorportion is prevented y oth Nef nd glycogg, we conducted proteomic nlysis of OptiPrep grdientpurified virions produced y T lymphoid cells infected with wild-type (Nef 1 ) or Nef 2 HIV-1 NL43, or with version tht encodes fully ctive miniml glycogg (termed glycoma 3 ) insted of Nef (Extended Dt Fig. 1). The only host protein tht could reproducily e identified in Nef 2 virion smples in independent experiments ut ws not identified in ny Nef 1 or glycoma virion smple ws SERINC3, memer of fmily of puttive crrier proteins with t lest 1 trnsmemrne domins 33 (Extended Dt Fig. 1). In one experiment, STOM nd PFKP were lso identified in Nef 2 ut not in Nef 1 or glycoma virion smples (Extended Dt Fig. 1). However, in nother experiment, STOM ws identified in ll virions smples, nd PFKP ws not identified in ny smple. Thus, STOM nd PFKP were not further pursued. Immunolotting of virion smples confirmed tht the incorportion of hemgglutinin (HA)-tgged SERINC3 is strongly inhiited y the Nef proteins of severl lortory-dpted nd primry HIV-1 isoltes from different cldes 1 Deprtment of Moleculr, Cell nd Cncer Biology, University of Msschusetts Medicl School, Worcester, Msschusetts 165, USA. These uthors contriuted eqully to this work N AT U R E V O L O C T O B E R G215 Mcmilln Pulishers Limited. All rights reserved

2 RESEARCH (Fig. 1) nd y glycoma (Extended Dt Fig. 2). Furthermore, the effects of glycoma trunction mutnts on the incorportion of SERINC3 HA (Extended Dt Fig. 2) correlted closely with their ilities to enhnce HIV-1 infectivity 29. Two of the Nef proteins tested did not inhiit the incorportion of SERINC3 HA (Fig. 1), nd one of these (Nef 9CF56 ) lso hd no effect on HIV-1 infectivity (Fig. 1c). Becuse the other (Nef SF2 ) did enhnce HIV-1 infectivity (Fig. 1c), we exmined its effect on the incorportion of other humn SERINC fmily memers. Although Nef SF2 did not ffect the incorportion of SERINC3 HA (Fig. 1), it strongly inhiited the incorportion of SERINC5 HA (Fig. 1). Among the primry Nef proteins exmined, those tht were most ctive in enhncing HIV-1 infectivity (Nef 97ZA12 nd Nef 93BR2 ) strongly inhiited the incorportion of oth SERINC3 nd SERINC5, the less ctive Nef 94UG114 ws less effective inhiitor prticulrly of SERINC5 incorportion, nd the inctive Nef 9CF56 inhiited neither SERINC3 nor SERINC5 incorportion (Fig. 1 c). Like the most ctive Nef proteins, wild-type glycoma, which enhnces HIV-1 infectivity t lest s potently 3, lso strongly inhiited the incorportion of oth SERINC3 nd SERINC5 (Extended Dt Fig. 2, ). Furthermore, the effects of glycoma trunction mutnts on SERINC5 incorportion (Extended Dt Fig. 2), like those on SERINC3 incorportion (Extended Dt Fig. 2), correlted with their effects on HIV-1 infectivity enhncement 29. Sucellulr locliztion of SERINC5 SERINC5 mcherry clerly loclized to the plsm memrne nd to filopodi-like protrusions when expressed lone, ut ccumulted in perinucler vesicles when co-expressed with Nef or glycogg (Extended Dt Fig. 3 nd dt not shown). Furthermore, SERINC5(iHA), which contins n internl HA tg next to conserved consensus glycosyltion site within proposed extrcellulr loop 34, could e redily detected on the surfce of trnsfected Jurkt TAg (JTAg) T lymphoid cells y flow cytometry, nd its surfce expression ws gretly reduced when either Nef SF2 or glycogg were co-expressed (Extended Dt Fig. 3). We infer tht Nef nd glycogg decrese the virion-ssocition of SERINC5 y decresing its cell surfce levels. Effects of exogenous SERINCs on HIV infectivity HIV-1 virions produced in Jurkt T lymphoid cells re more dependent on Nef for optiml infectivity thn virions produced in 293T cells 26, which in turn re more dependent on Nef thn virions produced in exceptionlly permissive MT4 cells 35. Interestingly, the reltive requirement for Nef correltes with SERINC5 messenger RNA levels, which re high in Jurkt cells, lower in 293T cells, nd lower yet in MT4 cells (Extended Dt Fig. 4, ). SERINC5 mrna levels in unstimulted or stimulted humn peripherl lood mononucler cells (PBMC) were even higher thn in Jurkt cells, nd were not further incresed y tretment with interferon- (INF-) (Extended Dt Fig. 4, c). In single cycle repliction ssys, exogenous SERINC5 reduced the specific infectivity of Nef 2 HIV-1 virions produced in 293T cells for TZM-l indictor trget cells.1-fold, even when s little s 1 ng of the reltively wek pbj5-sed SERINC5 expression vector ws used (Fig. 2). Under the sme conditions, exogenous SERINC3 reduced progeny virus infectivity only two- to threefold (Fig. 2). However, lthough endogenous SERINC5 mrna levels in 293T cells re low, these cells hve reltively high endogenous SERINC3 mrna levels (Extended Dt Fig. 4). Even t 5 ng, the vectors expressing SERINC3 or SERINC5 did not ffect virus prticle production, Gg processing, or HIV-1 Env incorportion (Fig. 2). However, lte reverse trnscriptse products in trget cells exposed to Nef 2 HIV-1 virions produced in 293T cells trnsfected with 5 ng of the SERINC5 expression vector were reduced.1-fold (Fig. 2c). To exmine whether SERINC5 ffects HIV-1 virion fusion with trget cells, we co-expressed chimeric -lctmse-vpr (BlM- Vpr) protein tht is tken up into virions 36. Fusion ws then quntified sed on the clevge of fluorescent sustrte fter the trnsfer of BlM-Vpr from virions into trget cells. We initilly used 1 mg of the SERINC5 expression vector to compenste for potentil competition y the strong promoter driving BlM-Vpr expression, nd found tht the ility of Nef 2 HIV-1 progeny virions to fuse with trget cells ws lrgely olished (Extended Dt Fig. 5). However, 1 ng of the SERINC5 expression vector, which reduced the infectivity of Nef 2 HIV-1 virions,2-fold when co-trnsfected with the BlM-Vpr expression vector, cused only n,4-fold reduction in the ility to fuse with trget cells (Extended Dt Fig. 5). The effects on HIV-1 infectivity were specific, ecuse 5 ng of the vectors expressing SERINC3 or SERINC5 hd t most modest effects on the infectivities of Env 2 HIV-1 prticles pseudotyped with the vesiculr stomtitis virus G protein (VSV-G) (Fig. 2d), which do not require Nef or glycogg for optiml infectivity 26,37,38. Surprisingly, the incorportion of HA-tgged SERINC5 into Env 2 HIV-1 prticles ws reduced in the presence of VSV-G (Fig. 2e). Thus, reduced incorportion my hve contriuted to the reltive resistnce of VSV-G-pseudotyped HIV-1 to exogenous SERINC5. Crucilly, the effect of exogenous SERINC5 on Nef 2 HIV-1 ws countercted y Nef SF2 or glycogg expressed in trns (Fig. 2f). Indeed, exogenous SERINC5 hd no effect whtsoever in the presence of glycogg (Fig. 2f). In two independent experiments performed with cells from different donors, exogenous SERINC5 lso gretly reduced the infectivity of Nef 2 HIV-1 virions produced in 293T cells for primry humn trget cells (Extended Dt Fig. 6). Nef (clde): B B C D F H Nef (clde): B C D F H Virus Cells Nef LAI FS Nef LAI Nef SF2 Nef 97ZA12 Nef 94UG114 Nef 93BR2 Nef 9CF56 S3 HA S3 HA HIV CA Nef HA Virus Cells Figure 1 Inhiition of incorportion of SERINC proteins into HIV-1 virions y Nef correltes with infectivity enhncement.,, Western lots showing the effects of Nef proteins from vrious HIV-1 cldes on the incorportion of SERINC3 HA (S3 HA) () or SERINC5 HA (S5 HA) () into Nef 2 HIV-1 virions. The white nds mrked y sterisks re cused y co-migrting HIV-1 Pr55 gg. The experiment shown in ws performed twice. Supplementry Informtion contins full scns for nd. c, Aility of Nef SF2 Nef 97ZA12 Nef 94UG114 Nef 93BR2 Nef 9CF56 Nef LAI FS S5-HA HIV-1 CA S5 HA Nef HA c Reltive infectivity Ctrl Nef SF2 Nef 97ZA12 Nef 94UG114 NS Nef 93BR2 Nef 9CF56 Nef proteins from different HIV-1 cldes to enhnce HIV-1 infectivity. Env 2 /Nef 2 HIV-1 HXB2 prticles trns-complemented with Env HXB2 were produced in JTAg cells in the sence or presence of the indicted Nef proteins, nd infectivities normlized for p24 ntigen were determined using TZM-l indictor trget cells (n 5 3). Dt re men nd s.d. P,.5, P,.1, NS, not significnt (P..5) (two-tiled unpired t-test with Welch s correction in cse of unequl vrince; F-test, 5.25). Ctrl, control. 8 OCTOBER 215 VOL 526 NATURE 219 G215 Mcmilln Pulishers Limited. All rights reserved

3 RESEARCH ARTICLE Reltive infectivity CA Ctrl S3 S5 Ctrl S3 S5 Ctrl S5 1 ng ech 5 ng ech 5 ng ech 5 ng ech d Env: VSV-G e f Env: HIV-1 HXB2 VSV-G: 1.4 NS Gg: Ctrl SERINC5 1.2 NS S5 HA Cells NS S5 HA Pr Virus p Reltive infectivity Env: HIV-1 HXB2 Ctrl S3 S5 5 ng ech Virus CA Env: HIV-1 HXB2 c Env: HIV-1 NL43 Ctrl SERINC3 SERINC5 Reltive infectivity.5 gp41 Pr55 p41 Ctrl Nef SF2 Lte RT products (reltive levels) Ctrl Glyco Gg Figure 2 Effects of exogenous SERINCs on HIV-1 infectivity., Overexpression of SERINC5 in virus producer cells drmticlly reduces Nef 2 HIV-1 progeny virus single-round infectivity. The effects of exogenous SERINC3 (S3) nd SERINC5 (S5) were mesured using TZM-l indictor cells (n 5 3)., Western lots showing tht virus production, Gg processing, nd gp41 (Env) incorportion were unffected. c, Nef 2 HIV-1 progeny virions produced in the presence of exogenous SERINC5 re defective in the synthesis of lte reverse trnscriptse (RT) products (n 5 2). d, Effects of exogenous SERINCs on the single-round infectivity of VSV-G-pseudotyped Nef 2 HIV-1 virions mesured s in (n 5 3). e, VSV-G reduces the ssocition of SERINC5 HA with Env 2 HIV-1 virions. The HIV-1 provirl plsmid in lne 1 hs disrupted gg gene. This experiment ws repeted twice. Supplementry Informtion contins full scns for nd e. f, Nef SF2 nd glycogg expressed in trns in virus producer cells counterct the effect of exogenous SERINC5 on Nef 2 HIV-1 progeny virion infectivity (n 5 3). Dt re men nd s.d. P,.5, P,.1 (two-tiled unpired t-test with Welch s correction in cse of unequl vrince). sirna: sirna: e sictrl sis3 sictrl sis Env: Reltive infectivity V1V2 S3 HA Actin S5 HA Actin Vector Nef 97ZA12 SF162 NS SF(JR V1/V2) Reltive infectivity sirna: Env: HIV-1 HXB2 Jurkt-derived virus sictrl 4 nm SF162 SF(JR V1/V2) sictrl sis35 SF162 SF(JR V1/V2) sis Env: Reltive infectivity sis5 V1V2 Vector Nef 97ZA12 JRFL Jurkt-derived virus sis35 sictrl 8 nm Env: HIV MDM-derived virus creltive infectivity JRFL JR(SF V1/V2) sictrl sis35 JR(SF V1/V2) sictrl JRFL JR(SF V1/V2) sis35 f Virus d Reltive infectivity SF162 Env: HIV-1 HXB2 sictrl sis Jurkt-derived virus JRFL Nef Nef ggg SF(JR V1/V2) JR(SF V1/V2) Env: sictrl: sis35: Jurkt-derived virus gp12 Figure 3 Effects of depleting SERINCs in virus producer cells., Depletion of HA-tgged SERINCs in JTAg cells y specific sirnas. sictrl, non-trgeting sirna control; sis3, sirna trgeting SERINC3; sis5, sirna trgeting SERINC5., Single-round infectivities of Nef 2 HIV-1 virions produced in JTAg cells (n 5 3) sujected to non-trgeting sirna or to sirnas trgeting SERINC3 (sis3), SERINC5 (sis5), or oth (sis3 1 5). c, Single-round infectivities of Nef 2 HIV-1 virions produced in primry monocyte-derived mcrophges (MDM) sujected to sirnas (n 5 3). d, Simultneous depletion of SERINC3 nd SERINC5 hs negligile effects on Nef 2 HIV-1 progeny virion infectivity when Nef or glycogg re provided in trns (n 5 3). e, The effects of depleting SERINC3 together with SERINC5 on virus infectivity re governed y the sme determinnts in gp12 V1/V2 tht govern Nefresponsiveness (n 5 3). f, Western lots showing tht the comined sirnas trgeting SERINC3 nd SERINC5 did not ffect prticle production, Gg processing, or Env incorportion. Supplementry Informtion contins full scns for nd f. Dt re men nd s.d. P,.5, P,.1, P,.1, P,.1, (two-tiled unpired t-test with Welch s correction in cse of unequl vrince). The experiments shown in nd were performed twice. Pr55 p41 CA Effects of SERINC depletion on HIV infectivity JTAg T lymphoid cells express oth SERINC3 nd SERINC5 t reltively high levels (Extended Dt Fig. 4). Short interfering RNAs (sirnas) tht knocked down HA-tgged SERINC3 or SERINC5 (Fig. 3) enhnced the specific infectivity of Nef 2, Env HXB2 -pseudotyped HIV-1 prticles produced in JTAg cells y.4- or.8-fold, respectively (Fig. 3). In five independent experiments, oth sirnas together enhnced the specific infectivity of Nef 2 progeny virions 18- to 45-fold (Fig. 3, d nd dt not shown). The sirnas ginst SERINC3 nd SERINC5 together lso significntly enhnced the infectivity of Nef 2, Env ering HIV-1 virions produced y infected primry mcrophges (Fig. 3c). However, they hd little effect on the lredy high specific infectivity of Nef 2 progeny virions produced in JTAg cells tht ws oserved when Nef 97ZA12 or glycogg were expressed in trns (Fig. 3d). The Env proteins of the R5-tropic primry HIV-1 isoltes SF162 nd JRFL differ considerly in their responsiveness to Nef or glycogg, which is determined y vrile regions 1 nd 2 (V1/V2) of gp12 (ref. 3). Remrkly, the sirnas ginst SERINC3 nd SERINC5 together precisely phenocopied the differentil effects of Nef 97ZA12 on the specific infectivities of Nef 2 HIV-1 progeny prticles ering Env SF162 or Env JRFL (Fig. 3e). Furthermore, responsiveness to Nef 97ZA12 nd to the sirnas trgeting SERINC3 nd SERINC5 could e switched simultneously y exchnging the V1/V2 regions of Env SF162 nd Env JRFL (Fig. 3e). Nef 2 HIV-1 virions ering Env proteins tht differed profoundly in their responsiveness to Nef or to SERINC depletion incorported comprle mounts of SERINC5 HA (Extended Dt Fig. 7). Furthermore, Nef 97ZA12 lrgely prevented the incorportion of SERINC5 HA in the presence of oth Env proteins (Extended Dt Fig. 7). Importntly, the simultneous depletion of SERINC3 nd SERINC5 in virus producer cells ffected neither prticle morphogenesis nor Env incorportion (Fig. 3f). Collectively, these dt indicte tht SERINC3 nd SERINC5 together ccount for the effects of Nef nd glycogg on HIV-1 infectivity. HIV infectivity in SERINC knockout cells Next, we knocked out the SERINC3 nd SERINC5 genes in JTAg cells using the clustered regulrly interspced short plindromic repets (CRISPR)-Cs9 system 39 (Extended Dt Fig. 8). Nef 2, Env HXB2 - pseudotyped HIV-1 prticles produced in JTAg clones lcking either SERINC3 or SERINC5 were,5-fold or 13 2-fold more infectious, respectively, thn prticles produced in the prentl cells (Fig. 4). Notly, the specific infectivity of prticles produced in douleknockout cells lcking SERINC3 nd SERINC5 ws.1-fold higher (Fig. 4). Furthermore, the mrkedly incresed specific infectivity of virl prticles produced in doule-knockout cells could e confirmed y visulizing green fluorescence protein (GFP)-positive cells fter exposure to recominnt HIV-1 expressing GFP (Fig. 4). Nef nd glycogg potently enhnced the specific infectivity of prticles produced in prentl JTAg cells s expected, ut hd no significnt effects 2 2 N AT U R E V O L O C T O B E R G215 Mcmilln Pulishers Limited. All rights reserved

4 RESEARCH Reltive infectivity Prentl Nef virus S3 / (1) S3 / (2) Prentl JTAg S5 / (1) S5 / (2) S3 / S5 / (1) S3 / S5 / (2) c Reltive infectivity Virus producer cells Virus producer cells: HIV-1 GFP (Nef ) Nef Nef GlycoGg JTAg S3 / S5 / (1) doule-ko cells Nef virus on the lredy highly infectious prticles produced in douleknockout cells (Fig. 4c). The introduction of expression cssettes for SERINC3, for SERINC5, nd for oth, into the doule-knockout cells vi retrovirl trnsduction led to 3.6-fold, 5.7-fold, nd 32-fold reductions, respectively, in the specific infectivities of Nef 2 HIV-1 prticles produced in these cells (Fig. 4d). These dt confirm tht SERINC3 nd SERINC5 synergisticlly restrict HIV-1 infectivity in the sence of Nef. The effects of Nef on HIV-1 repliction in cell lines hve generlly een more modest thn in primry lymphocytes 4,6. However, prt from Jurkt cells, T cell lines often express only low levels of SERINC5 mrna (Extended Dt Fig. 4 nd dt not shown). We oserved tht t low input virus concentrtions, Nef NL43 nd Nef 97ZA12 roustly enhnced HIV-1 spreding in highly permissive Jurkt E6.1 cells (Fig. 5). Nef NL43 nd Nef 97ZA12 lso enhnced HIV-1 repliction in JTAg cells, s judged from Gg protein expression levels in the infected cells nd from the relese of p24 ntigen over time (Fig. 5, c). In mrked contrst, the Nef 1 nd Nef 2 viruses replicted with similr kinetics in doule-knockout JTAg cells lcking SERINC3 nd SERINC5, which were generlly more permissive thn the prentl cells (Fig. 5, c). Crucilly, the requirement for Nef ws restored in Prentl NS NS S3 / S5 / (1) d Reltive infectivity vector S3 S5 S3/ S5 S3 / S5 / (1) Figure 4 Effects of SERINC knockout nd reconstitution on HIV-1 infectivity., Single-round infectivities of Nef 2 HIV-1 progeny virions produced in prentl or in knockout JTAg cells lcking SERINC3 (S3 2/2 ), SERINC5 (S5 2/2 )oroth(s3 2/2 S5 2/2 )(n 5 3). Numers in prentheses denote clone numers., TZM-l cells were incuted with equl mounts of single-cycle Nef 2 HIV-1-GFP produced in prentl or doule-knockout (KO) cells lcking SERIN3 nd SERINC5. Infected TZM-l cells expressing GFP were detected y fluorescence microscopy. c, Effects of Nef nd glycogg provided in trns on the single-round infectivities of Nef 2 HIV-1 virions produced in prentl or doule-knockout cells (n 5 3). d, Effects of introducing expression cssettes for SERINC3, SERINC5 or oth into the doule-knockout cells on Nef 2 HIV-1 progeny virus infectivities (n 5 3). Dt re men nd s.d. P,.5, P,.1, P,.1, P,.1 (two-tiled unpired t-test with Welch s correction in cse of unequl vrince). The experiments shown in nd were repeted three times. Nef: c p24 (µg ml 1 ) Dy 9 fter infection NL43 97ZA12 NL43 97ZA12 Infected Jurkt E6.1 cells Prentl cells Nef Nef Dys fter infection Infected JTAg cells NL43 97ZA12 NL43 97ZA12 NL43 97ZA12 Nef: Pr55 p41 CA Actin Dy 13 fter infection Prentl Doule-KO Doule-KO cells Dys fter infection Doule-KO/ reconstituted doule-knockout cells reconstituted with SERINC3 nd SERINC5 expression cssettes (Fig. 5, c). While the levels of SERINC3 nd SERINC5 in the reconstituted cells were higher thn in the prentl cells (Extended Dt Fig. 9), they were comprle to those in humn PBMC (Extended Dt Fig. 4). Although endogenous CD4 levels in JTAg cells re low, similr results were otined with more permissive CD4 high versions generted y retrovirl trnsduction. In the presence of extr CD4, Nef gin clerly enhnced virus repliction in prentl JTAg cells, ut ws entirely dispensle in doule-knockout cells lcking SERINC3 nd SERINC5 (Extended Dt Fig. 1). Furthermore, the role of Nef in virus repliction ws restored fter reconstitution of SERINC3 nd SERINC5 expression in the doule-knockout cells (Extended Dt Fig. 1). These results demonstrte tht SERINC3 nd SERINC5 together restrict HIV-1 repliction, nd tht Nef ntgonizes this restriction. Discussion Our findings revel tht HIV-1 Nef nd MLV glycogg efficiently downregulte SERINC3 nd SERINC5 from the cell surfce, which prevents their incorportion into HIV-1 virions nd consequently countercts their inhiitory effect on HIV-1 infectivity. Importntly, these findings offer n explntion for why the enhncement of HIV-1 infectivity y Nef nd glycogg is highly dependent on dynmin 2, clthrin nd the AP-2 clthrin dptor complex 29,31.SERINCfmily memers re present in ll eukryotes, ut their functions remin lrgely unknown. SERINC proteins reportedly enhnce the incorportion of serine into phosphtidylserine nd sphingolipids 33. In principle, this ctivity could ffect the lipid composition of the virl envelope, which is considered crucil for virion infectivity 4. Our dt demonstrte tht Pr55 p41 CA Actin Doule-KO cells/reconstituted Dys fter infection Figure 5 Nef countercts inhiition of HIV-1 repliction y SERINC3 nd SERINC5., Effect of Nef on HIV-1 spreding in Jurkt E6.1 cells infected t low input virus concentrtion (1 pg ml 21 p24). Gg protein expression in the cultures 9 nd 13 dys fter infection ws exmined y western lotting s mesure of virus repliction., c, Effects of Nef on virus spreding in prentl JTAg cells, doule-knockout cells lcking SERINC3 nd SERINC5, nd SERINC31SERINC5-reconstituted doule-knockout cells. The spreding of HIV-1 NL43 -sed viruses encoding either wild-type or disrupted versions of Nef NL43 or Nef 97ZA12 ws exmined y western lotting of cell lystes with nti-ca ntiody 9 dys fter infection with 2 ng ml 21 p24 (), or y monitoring p24 ccumultion in the superntnts fter infection with 4ngml 21 p24 (c). Reltively high input virus concentrtions were used to compenste for low CD4 levels on JTAg cells. The experiment shown in ws repeted twice. Supplementry Informtion contins full scns for nd. 8 OCTOBER 215 VOL 526 NATURE 221 G215 Mcmilln Pulishers Limited. All rights reserved

5 RESEARCH ARTICLE SERINC3 nd SERINC5 together ccount for most if not ll of the effects of Nef on HIV-1 infectivity nd on HIV-1 repliction in JTAg cells. Notly, Nef enhnces HIV-1 infectivity nd stimultes HIV-1 repliction in humn PBMC 4 6,18,41,whoseSERINC3 nd SERINC5 mrna levels exceed those of Jurkt cells (Extended Dt Fig. 4). The ility of virions produced in the sence of Nef to reverse trnscrie their genome in trget cells is impired 17,19,2. Consistent with these oservtions, we find tht SERINC5 in virus producer cells strongly inhiits the ility of Nef 2 HIV-1 virions to complete reverse trnscription. We lso find tht SERINC5 cn in principle olish the ility of progeny HIV-1 virions to fuse with trget cells. However, lower levels of SERINC5 inhiited the fusion step to lesser extent thn the ility of progeny virions to productively infect trget cells. Although there is controversy out the effect of Nef on HIV-1 entry 35,42,43, twofold reduction in the ility of Nef 2 HIV-1 virions to fuse with trget cells ws noted in one study 35. In ll of these studies, virus ws produced in 293T cells, whose endogenous SERINC5 mrna levels re low (Extended Dt Fig. 4). It is conceivle tht reltively low levels of virion-ssocited SERINC5 impir primrily fusion pore enlrgement, which poses higher energy rrier to overcome thn pore formtion 44. This would e expected to impir pssge of the virl core ut not necessrily of the much smller BlM- Vpr fusion indictor into trget cells. Consistent with role in entry, Nef enhnces the cytoplsmic delivery of virl cores 45. Further, the requirement for Nef is determined y HIV-1 Env 3. Interestingly, the Env proteins of HIV-1 NL43 nd HIV-1 SF162,which re highly responsive to Nef nd glycogg, require higher numer of Env trimers to complete entry thn the poorly Nef/glycoGg-responsive Env JRFL 3,46. Furthermore, the nturlly occurring Asn16Lys muttion in the V2 loop of HIV-1 Env, which results in the loss of glycosyltion site, cn increse oth the responsiveness to Nef nd glycogg nd the stoichiometry of entry 3,46. Mechnisticlly, link etween Nef/glycoGg responsiveness nd the stoichiometry of entry could e due to n inhiitory effect of virion-ssocited SERINCs on the clustering of Env trimers. Notly, such clusters hve een visulized on the surfce of mture HIV-1 virions nd, most prominently, t virus-cell contct zones 47,48. Alterntively, SERINCs emedded in the virion memrne could increse the energy rrier for fusion pore expnsion. In oth scenrios, differences in Nef/glycoGgresponsiveness mong HIV-1 Envs, s well s differences in SERINCsensitivity, my ultimtely e due to differences in the mount of energy tht these Envs provide towrds fusion. Regrdless of the mechnism, our oservtion tht viruses s distnt s HIV-1 nd MLV hve evolved to counterct SERINC3 nd SERINC5 rises the possiility tht these proteins hve roder role in innte ntivirl immunity. Online Content Methods, long with ny dditionl Extended Dt disply items ndsource Dt, re ville in the online version of the pper; references unique to these sections pper only in the online pper. Received 28 My; ccepted 18 August 215. Pulished online 3 Septemer Kestier, H. W. III et l. Importnce of the nef gene for mintennce of high virus lods nd for development of AIDS. Cell 65, (1991). 2. Decon, N. J. et l. Genomic structure of n ttenuted qusi species of HIV-1 from lood trnsfusion donor nd recipients. Science 27, (1995). 3. Zou, W. et l. Nef functions in BLT mice to enhnce HIV-1 repliction nd deplete CD4 1 CD8 1 thymocytes. Retrovirology 9, 44 (212). 4. Kim, S., Ikeuchi, K., Byrn, R., Groopmn, J. & Bltimore, D. Lck of negtive influence on virl growth y the nef geneof humn immunodeficiency virus type 1. Proc. Ntl Acd. Sci. USA 86, (1989). 5. Miller, M. D., Wrmerdm, M. T., Gston, I., Greene, W. C. & Feinerg, M. B. The humn immunodeficiency virus-1 nef gene product: positive fctor for virl infection nd repliction in primry lymphocytes nd mcrophges. J. Exp. Med. 179, (1994). 6. Spin, C. A., Kwoh, T. J., Chowers, M. Y., Gutelli, J. C. & Richmn, D. D. The importnce of nef in the induction of humn immunodeficiency virus type 1 repliction from primry quiescent CD4 lymphocytes. J. Exp. Med. 179, (1994). 7. Grci, J. V. & Miller, A. D. Serine phosphoryltion-independent downregultion of cell-surfce CD4 y nef. Nture 35, (1991). 8. Aiken, C., Konner, J., Lndu, N. R., Lenurg, M. E. & Trono, D. Nef induces CD4 endocytosis: requirement for criticl dileucine motif in the memrne-proximl CD4 cytoplsmic domin. Cell 76, (1994). 9. Rhee, S. S. & Mrsh, J. W. Humn immunodeficiency virus type 1 Nef-induced down-modultion of CD4 is due to rpid internliztion nd degrdtion of surfce CD4. J. Virol. 68, (1994). 1. Chudhuri, R., Lindwsser, O. W., Smith, W. J., Hurley, J. H. & Bonifcino, J. S. Downregultion of CD4 y humn immunodeficiency virus type 1 Nef is dependent on clthrin nd involves direct interction of Nef with the AP2 clthrin dptor. J. Virol. 81, (27). 11. Veillette, M. et l. Interction with cellulr CD4 exposes HIV-1 envelope epitopes trgeted y ntiody-dependent cell-medited cytotoxicity. J. Virol. 88, (214). 12. Hller, C. et l. HIV-1 Nef nd Vpu re functionlly redundnt rod-spectrum modultors of cell surfce receptors, including tetrspnins. J. Virol. 88, (214). 13. Schwrtz, O., Mrechl, V., Le Gll, S., Lemonnier, F. & Herd, J. M. Endocytosis of mjor histocomptiility complex clss I molecules is induced y the HIV-1 Nef protein. Nture Med. 2, (1996). 14. Collins, K. L., Chen, B. K., Klms, S. A., Wlker, B. D. & Bltimore, D. HIV-1 Nef protein protects infected primry cells ginst killing y cytotoxic T lymphocytes. Nture 391, (1998). 15. Cohen, G. B. et l. The selective downregultion of clss I mjor histocomptiility complex proteins y HIV-1 protects HIV-infected cells from NK cells. Immunity 1, (1999). 16. Schindler, M. et l. Nef-medited suppression of T cell ctivtion ws lost in lentivirl linege tht gve rise to HIV-1. Cell 125, (26). 17. Chowers, M. Y., Pndori, M. W., Spin, C. A., Richmn, D. D. & Gutelli, J. C. The growth dvntge conferred y HIV-1 nef is determined t the level of virl DNA formtion nd is independent of CD4 downregultion. Virology 212, (1995). 18. Münch, J. et l. Nef-medited enhncement of virion infectivity nd stimultion of virl repliction re fundmentl properties of primte lentiviruses. J. Virol. 81, (27). 19. Aiken, C. & Trono, D. Nef stimulteshumn immunodeficiency virus type1 provirl DNA synthesis. J. Virol. 69, (1995). 2. Schwrtz, O., Mrechl, V., Dnos, O. & Herd, J. M. Humn immunodeficiency virus type 1 Nef increses the efficiency of reverse trnscription in the infected cell. J. Virol. 69, (1995). 21. Miller, M. D., Wrmerdm, M. T., Pge, K. A., Feinerg, M. B. & Greene, W. C. Expression of the humn immunodeficiency virus type 1 (HIV-1) nef gene during HIV-1 production increses progeny prticle infectivity independently of gp16 or virl entry. J. Virol. 69, (1995). 22. Forshey, B. M. & Aiken, C. Disssemly of humn immunodeficiency virus type 1 cores in vitro revels ssocition of Nef with the suvirl rionucleoprotein complex. J. Virol. 77, (23). 23. Ross, T. M., Orn, A. E. & Cullen, B. R. Inhiition of HIV-1 progeny virion relese y cell-surfce CD4 is relieved y expression of the virl Nef protein. Curr. Biol. 9, (1999). 24. Lm, J., Mngsrin, A. & Trono, D. Cell-surfce expression ofcd4reduceshiv-1 infectivity y locking Env incorportion in Nef- nd Vpu-inhiitle mnner. Curr. Biol. 9, (1999). 25. Goldsmith, M. A., Wrmerdm, M. T., Atchison, R. E., Miller, M. D. & Greene, W. C. Dissocition of the CD4 downregultion nd virl infectivity enhncement functions of humn immunodeficiency virus type 1 Nef. J. Virol. 69, (1995). 26. Pizzto, M. MLV glycosylted-gg is n infectivity fctor tht rescues Nef-deficient HIV-1. Proc. Ntl Acd. Sci. USA 17, (21). 27. Prts, A. C., De Billy, G., Wng, P. & Drlix, J. L. CUG initition codon used for the synthesis of cell surfce ntigen coded y the murine leukemi virus. J. Mol. Biol. 25, (1989). 28. Pillemer, E. A., Kooistr, D. A., Witte, O. N. & Weissmn, I. L. Monoclonl ntiody to the mino-terminl L sequence of murine leukemi virus glycosylted gg polyproteins demonstrtes their unusul orienttion in the cell memrne. J. Virol. 57, (1986). 29. Usmi, Y., Popov, S. & Gottlinger, H. G. The Nef-like effect of murine leukemi virus glycosylted gg on HIV-1 infectivity is medited y its cytoplsmic domin nd depends on the AP-2 dptor complex. J. Virol. 88, (214). 3. Usmi, Y. & Gottlinger, H. HIV-1 Nef Responsiveness Is Determined y Env Vrile Regions Involved in Trimer Assocition nd Correltes with Neutrliztion Sensitivity. Cell Rep. 5, (213). 31. Pizzto, M. et l. Dynmin 2 is required for the enhncement of HIV-1 infectivity y Nef. Proc. Ntl Acd. Sci. USA 14, (27). 32. Crig, H. M., Pndori, M. W. & Gutelli, J. C. Interction of HIV-1 Nef with the cellulr dileucine-sed sorting pthwy is required for CD4 down-regultion nd optiml virl infectivity. Proc. Ntl Acd. Sci. USA 95, (1998). 33. Inuzuk, M., Hykw, M. & Ingi, T. Serinc, n ctivity-regulted protein fmily, incorportes serine into memrne lipid synthesis. J. Biol. Chem. 28, (25). 34. Grossmn, T. R., Luque, J. M. & Nelson, N. Identifiction of uiquitous fmily of memrne proteins nd their expression in mouse rin. J. Exp. Biol. 23, (2). 35. Dy, J. R., Munk, C. & Gutelli, J. C. The memrne-proximl tyrosine-sed sorting signl of humn immunodeficiency virus type 1 gp41 is required for optiml virl infectivity. J. Virol. 78, (24) N AT U R E V O L O C T O B E R G215 Mcmilln Pulishers Limited. All rights reserved

6 RESEARCH 36. Cvrois, M., De Noronh, C. & Greene, W. C. A sensitive nd specific enzyme-sed ssy detecting HIV-1 virion fusion in primry T lymphocytes. Nture Biotechnol. 2, (22). 37. Aiken, C. Pseudotyping humn immunodeficiency virus type 1 (HIV-1) y the glycoprotein of vesiculr stomtitis virus trgets HIV-1 entry to n endocytic pthwy nd suppresses oth the requirement for Nef nd the sensitivity to cyclosporin A. J. Virol. 71, (1997). 38. Luo, T., Dougls, J. L., Livingston, R. L. & Grci, J. V. Infectivity enhncement y HIV- 1 Nef is dependent on the pthwy of virus entry: implictions for HIV-sed gene trnsfer systems. Virology 241, (1998). 39. Mli, P., Esvelt, K. M. & Church, G. M. Cs9s verstile toolfor engineering iology. Nture Methods 1, (213). 4. Wheed, A. A. & Freed, E. O. The Role of Lipids in Retrovirus Repliction. Viruses 2, (21). 41. Lundquist, C. A., Toiume, M., Zhou, J., Unutmz, D. & Aiken, C. Nef-medited downregultion of CD4 enhnces humn immunodeficiency virus type 1 repliction in primry T lymphocytes. J. Virol. 76, (22). 42. Toiume, M., Lineerger, J. E., Lundquist, C. A., Miller, M. D. & Aiken, C. Nef does not ffect the efficiency of humn immunodeficiency virus type 1 fusion with trget cells. J. Virol. 77, (23). 43. Cvrois, M., Neidlemn, J., Yonemoto, W., Fenrd, D. & Greene, W. C. HIV-1 virion fusion ssy: uncoting not required nd no effect of Nef on fusion. Virology 328, (24). 44. Cohen, F. S. & Melikyn, G. B. The energetics of memrne fusion from inding, through hemifusion, pore formtion, nd pore enlrgement. J. Memr. Biol. 199, 1 14 (24). 45. Scheffer, E., Geleziuns, R. & Greene, W. C. Humn immunodeficiency virus type1 Nef functions t the level of virus entry y enhncing cytoplsmic delivery of virions. J. Virol. 75, (21). 46. Brndenerg, O. F., Mgnus, C., Rusert, P., Regoes, R. R. & Trkol, A. Different infectivity of HIV-1 strins is linked to numer of envelope trimers required for entry. PLoS Pthog. 11, e14595 (215). 47. Sougrt, R. et l. Electron tomogrphy of the contct etween T cells nd SIV/HIV-1: implictions for virl entry. PLoS Pthog. 3, e63 (27). 48. Chojncki, J. et l. Mturtion-dependent HIV-1 surfce protein redistriution reveled y fluorescence nnoscopy. Science 338, (212). Supplementry Informtion is ville in the online version of the pper. Acknowledgements We thnk J. Leszyk nd S. Shffer for protein microsequencing, BGI Americs for RNA-seq, R. Mehr for sgrna nd Cs9 expression plsmids, J. Sodroski for HIVec2.GFP, T. Akgi for pcxsr, nd the AIDS Reserch nd Reference Regent Progrm, Division of AIDS, NIAID, NIH for p89.6, indinvir, mrviroc, the monoclonl ntiodies 183-H12-5C nd Chessie 8, nd TZM-l cells. This work ws supported y NIAID/NIH grnt R1AI29873 nd y NIDA/NIH grnt DP1DA3834. Author Contriutions Y.U., Y.W. nd H.G.G. designedthe experiments nd nlysed the dt. Y.U. crried out the nlysis of virions nd the SERINC overexpression nd depletion experiments. Y.W. generted nd chrcterized the SERINC knockout cells, crried out ll experiments involving knockout cells nd primry cells, nd performed the qrt PCR experiments nd the BlM-Vpr-sed fusion ssys. H.G.G. wrote the mnuscript. Author Informtion Reprints nd permissions informtion is ville t The uthors declre no competing finncil interests. Reders re welcome to comment on the online version of the pper. Correspondence nd requests for mterils should e ddressed to H.G.G. (heinrich.gottlinger@umssmed.edu). 8 OCTOBER 215 VOL 526 NATURE 223 G215 Mcmilln Pulishers Limited. All rights reserved

7 RESEARCH ARTICLE METHODS No sttisticl methods were used to predetermine smple size. Investigtors were not linded to lloction during experiments nd outcome ssessment, nd experiments were not rndomized. Cells. JTAg, 293T, MT4, A549 nd U2-OS cells were gifts from G. Crtree, D. Bltimore, W. Hseltine, M. Bujny nd A. Brss, respectively. Jurkt E6.1 nd MOLT-3 cells were otined from the ATCC. TZM-l cells were otined from the AIDS Reserch nd Reference Regent Progrm, Division of AIDS, NIAID, NIH. PBMC were isolted from the lood of helthy donors y Ficoll- Hypque density grdient centrifugtion. The MycoSensor PCR ssy system (Agilent) ws used to check ll cell lines for mycoplsm. The cell lines were not uthenticted for this study. HIV-1 provirl constructs. NL4-3/Nefstop, the nef-deficient vrint of the prototypic HIV-1 NL4-3 used in this study, hs nef codons replced y three consecutive premture termintion codons. NL-nef 97ZA12 is version of HIV- 1 NL4-3 tht hs the nef gene precisely replced y tht of p97za12.1 (GenBnk ccession AF286227), ner full-length moleculr clone of primry sutype C HIV-1 isolte 49. NL-nef 97ZA12 FS is nef-deficient vrint of NL-nef 97ZA12 owing to frmeshift t unique XhoI site in nef. HXB/89.6 ecto -GFP is mcrophge-tropic vrint of the infectious HIV-1 moleculr clone HXBH1 tht encodes GFP within the nef region, nd tht hs KpnI-BmHI frgment (nucleotides of K3455) encoding the Env ectodomin replced y the corresponding frgment from p89.6, iologiclly ctive moleculr clone of the primry HIV isolte 5. The provirl plsmids NL4-3/glycoMA, HXB/ Env 2 /Nef 1, HXB/Env 2 /Nef 2, nd HXBH1-gg 2 hve een descried 29,51,52. Expression plsmids. The pbj5-sed Nef expression vectors used, the nefdeficient control vector pnef LAI FS, nd the pbj5-sed expression vectors for glycogg HA, for wild-type glycoma HA, nd for its trunction mutnts hve een descried 29,31 The ltter plsmids were used s templtes to mplify frgments encoding croxy-terminlly Flg-tgged versions of wild-type glycoma nd of its mutnts, which were lso cloned into the mmmlin expression vector pbj5. The HIV-1 Env expression vectors used hve lso een descried 3. The coding sequences for SERINC3 nd SERINC5 without or with C-terminl HAtg were mplified from BC688 (SERINC3) nd from BC11281 nd AW5635 (SERINC5) (GE Helthcre). The primers included Kozk sequence nd XhoI nd NotI cloning sites for insertion into pbj5. The vectors expressing SERINC5(iHA) nd SERINC5 mcherry re lso pbj5-sed. SERINC5(iHA) hs n HA tg inserted etween residues 29 nd 291 of SERINC5. SERINC5 mcherry hs Thr-Gly-Al-Gly linker inserted etween SERINC5 nd mcherry. Retrovirl vectors. The humn SERINC3 nd SERINC5 coding sequences preceded y Kozk sequence were inserted into pmscvhyg nd pmscvpuro, respectively (Clontech). The humn CD4 coding sequence ws inserted into the retrovirl vector pcxsr 53. Protein identifiction. For the identifiction of virus-ssocited host proteins, virions relesed y chroniclly infected T-lymphoid MOLT-3 cells were pelleted through sucrose, resuspended in PBS, nd further purified in OptiPrep velocity grdients s descried 54. OptiPrep grdient frctions were collected from the top nd diluted with PBS. Virl prticles were hrvested from the frctions y ultrcentrifugtion nd lysed in SDS PAGE loding uffer (6 mm Tris-HCl, ph 6.8, 1% SDS, 1% (v/v) glycerol,.5% romophenol lue, 5% (v/v) 2-mercptoethnol). Virus-contining frctions were then identified y western lotting with ntiody 183-H12-5C ginst HIV-1 cpsid (CA) 55. For mss spectrometry, virion-ssocited proteins were riefly run into n SDS PAGE gel to llow removl of SDS. After in-gel digestion with trypsin, peptides were seprted on NnoAcquity (Wters) UPLC nd nlysed with Q Exctive hyrid mss spectrometer (Thermo). The run conditions followed the sensitive settings recommended for optimizing the Q Exctive for low undnce proteins 56. Rw dt files were pek processed with Proteome Discoverer (version 1.3, Thermo) efore serching with Mscot Server (version 2.4) ginst the SwissProt dtse. Serch results were then loded into the Scffold Viewer (Proteome Softwre, Inc.). Virl prticle nlysis. To exmine the incorportion of SERINCs, 293T cells were co-trnsfected with NL4-3/Nefstop, vectors expressing HA-tgged SERINCs, nd vectors expressing vrious epitope-tgged Nef or glycogg proteins, or the pproprite control vectors. To exmine whether VSV-G ffects SERINC5 incorportion, 293T cells were co-trnsfected with 1 mg HXBH1- gg 2 ( control HIV-1 provirl construct unle to express Gg) or HXB/Env 2 / Nef 2, 1 ng of plsmid expressing VSV-G or control vector, nd 5 ng of plsmid expressing SERINC5 HA. Virions relesed into the medium were pelleted through sucrose, nd virus- nd cell-ssocited proteins were detected y western lotting s descried previously 57. Smples used for the detection of SERINCs were mximlly heted to 37 uc, ecuse SERINC proteins re highly ggregtion-prone t higher tempertures (dt not shown). In some cses, 25 mm TCEP ws used s the reducing gent. The ntiodies used were 183-H12-5C ginst HIV-1 CA, HA.11 (Covnce) ginst the HA epitope, M2 ginst the Flg epitope (Sigm- Aldrich), nd AC-4 (Sigm-Aldrich) ginst ctin. To exmine Env incorportion, virions produced y trnsiently trnsfected 293T or JTAg cells were pelleted through 2% sucrose cushions y ultrcentrifugtion, nd exmined y western lotting using the nti-gp41 monoclonl ntiody Chessie 8 (ref. 58), n nti-gp12 polyclonl ntiody (2-HG81; Fitzgerld), nd the nti-ca monoclonl ntiody 183-H12-5C. SERINC overexpression experiments. Pseudovirions cple of single round of repliction were produced y trnsfecting 293T cells in triplicte using clcium phosphte precipittion method. The cells were co-trnsfected with 1 mg HXB/Env 2 /Nef 2, 1 ng of plsmid expressing Env HXB2 or VSV-G, nd 1 or 5 ng of plsmids expressing SERINC3 or SERINC5, or with equimolr mounts of the empty vector. To exmine the effects of Nef or glycogg, 293T cells were co-trnsfected with 1 mg HXB/Env 2 /Nef 2, plsmid expressing Env HXB2 (1 ng), plsmid expressing SERINC5 (1 ng) or the empty vector, nd plsmids expressing Nef SF2 (2 mg) or glycogg (2 ng) or the empty vector. Superntnts contining progeny virions were collected two dys fter trnsfection, clrified y low-speed centrifugtion, filtered through.45-mm pore filters, nd then used immeditely to infect TZM-l indictor cells in T25 flsks. Aliquots of the filtered virus stocks were frozen for HIV-1 CA (p24) ntigen quntittion y stndrd ELISA. Three to five dys fter infection, the indictor cells were lysed in reporter lysis uffer (Promeg), nd -glctosidse ctivity ws determined s mesure of infection using kit (E2; Promeg) ccording to the mnufcturer s instructions. To exmine the effects of exogenous SERINC5 on the single-cycle infectivity of nef-deficient HIV-1 for primry trget cells, virl stocks were otined y cotrnsfecting 293T cells with HXB/Env 2 /Nef 2, plsmid expressing Env HXB2, plsmid expressing SERINC5 or the empty vector, nd n HIV-1-sed lentivirl vector expressing GFP. Filtered virl stocks normlized for p24 ntigen were used to infect humn PBMC, nd infected cells expressing GFP were quntified y flow cytometry. SERINC depletion experiments. To otin pseudovirions cple of single round of repliction, Lipofectmine 2 (Invitrogen) ws used to trnsfect JTAg cells in triplicte with 1 mg HXB/Env 2 /Nef 2, 1 ng of n HIV-1 Env expression plsmid, nd sirnas (4 nm ech). Additionlly, 5 ng of plsmid expressing Nef 97ZA12, or 2 ng of plsmid expressing glycogg, or the empty pbj5 expression plsmid, were co-trnsfected in some experiments. The sirnas trgeting SERINC3 (HsTDE12; trget sequence: 59-CACGGTGACTCGCCT CATTTA-39) or SERINC5 (HsC5orf123; trget sequence: 59-CACCGTCT ACATCTACTCCTA-39), nd AllStrs negtive control sirna were purchsed from Qigen. As control for experiments in which the sirnas trgeting SERINC3 nd SERINC5 were co-trnsfected, the concentrtion of the control sirna ws douled. The infectivities of JTAg-derived virus stocks normlized for p24 ntigen content were determined s ove using TZM-l indictor cells. To exmine the effects of SERINC proteins on the infectivity of HIV-1 progeny virions produced in primry cells, monocyte-derived mcrophges were infected with repliction-competent, dul-tropic HXB/89.6 ecto -GFP. On dy 5 fter infection, Lipofectmine 2 ws used to simultneously trnsfect the monocytederived mcrophges with the sirnas trgeting SERINC3 nd SERINC5 (24 nm ech), or with the negtive control sirna. The cells were wshed 5 h lter to remove the trnsfection gent. Virus-contining culture medium ws collected on dy 3 fter trnsfection, nd infectivities normlized for p24 ntigen were determined using TZM-l indictor cells. Indinvir (2 mm) ws dded to the TZM-l cells together with virus to limit repliction to single cycle, nd AMD31 (5 mm) nd mrviroc (5 nm) were dded the next dy to prevent Env-induced cell cell fusion. Genertion nd use of knockout cells. Expression plsmids for single-guide RNAs (sgrnas) trgeting exons within the SERINC3 nd SERINC5 genes were trnsiently trnsfected into JTAg cells y nucleofection, long with plsmid expressing Cs9. The sites trgeted y the sgrnas re depicted in Extended Dt Fig. 8. Wheres the two sgrnas trgeting the SERINC3 gene were expressed individully, the two sgrnas trgeting the SERINC5 gene were expressed together. To otin doule-knockout cells, JTAg S3 2/2 (2) cells were co-trnsfected with the two sgrnas trgeting the SERINC5 gene nd the Cs9 expression plsmid. Nine dys fter trnsfection, gene editing in the ulk cultures ws confirmed y PCR mplifiction of the trgeted regions of the genome, followed y digestion of the PCR products with pproprite restriction enzymes (NcoI nd BtsCI for trget sites A nd B within the SERINC3 gene, respectively; BsoBI for trget site B within the SERINC5 gene). Clones were then otined y limiting dilution in 96-well flt-ottomed culture pltes. Whenever possile, the clones were pre-screened y PCR mplifiction of the trgeted G215 Mcmilln Pulishers Limited. All rights reserved

8 RESEARCH regions of the genome nd restriction nlysis. Furthermore, the PCR products were cloned into pcr-blunt II-TOPO (Invitrogen/Life Technologies), nd up to 1 independent clones were sequenced in ech cse. The primer pirs used for PCR mplifiction of the sgrna trget sites were: 59-CCATAGTCAGTCTTG CAGTTG-39 nd 59-GTACGTAGTATCTAGCATAGTGC-39 (SERINC3 trget site A), 59-CTTCTAGGCTAATGTTGTCC-39 nd 59-GTGAGTTGCAGGTA CTAAGTC-39 (SERINC3 trget site B), 59-CACACGATCCATTTCCACAG-39 nd 59-CGCATCATGGTACCAGGTG-39 (SERINC5 trget site A), nd 59- GATCATTGGCAGGTAAGAGC-39 nd 59-CACACCGCAAACACAAGC-39 (SERINC5 trget site B). Deletions etween SERINC5 trget sites A nd B were identified using primers 59-CACACGATCCATTTCCACAG-39 nd 59-CACAC CGCAAACACAAGC-39 for PCR mplifiction nd direct sequencing of the products. An inversion etween SERINC5 trget sites A nd B ws chrcterized using primer pir 59-CACACGATCCATTTCCACAG-39 nd 59-GATCATTGG CAGGTAAGAGC-39, nd primer pir 59-CGCATCATGGTACCAGGTG-39 nd 59-CACACCGCAAACACAAGC-39. Ectopic SERINC expression cssettes were introduced into the doule-knockout cells y retrovirl trnsduction with MSCVhygSERINC3 nd/or MSCVpuroSERINC5, followed y selection with hygromycin nd/or puromycin. SERINC3 expression ws exmined y western lotting with rit nti-tde1 (SERINC3) ntiody (GTX115512; GeneTex). To determine the effects of SERINC proteins on HIV-1 infectivity in the sence of Nef, prentl, knockout, doule-knockout, nd gene-reconstituted doule-knockout JTAg cells were co-trnsfected in triplicte with plsmid expressing Env HXB2 nd HXB/Env 2 /Nef 2. To determine the effects of Nef nd glycogg in cells lcking SERINC genes, prentl nd doule-knockout JTAg cells were co-trnsfected with plsmid expressing Env HXB2 nd HXB/Env 2 /Nef 2, HXB/Env 2 /Nef 1 or HXB/Env 2 /Nef 2 together with plsmid expressing glycogg. Progeny virus infectivities normlized for p24 ntigen were determined using TZM-l indictor cells. Alterntively, the HIV-1 vector HIVec2.GFP ws co-trnsfected together with HXB/Env 2 /Nef 2 nd the Env expression plsmid. After exposure to equl mounts of virus, infected TZM-l cells were then identified sed on GFP expression. For virus repliction studies, repliction-competent HIV-1 ws produced y trnsiently trnsfecting 293T cells with NL4-3, NL4-3/Nefstop, NL-nef 97ZA12 or NL-nef 97ZA12 FS. Virus-contining superntnts were pssed through.45-mm filters, normlized for p24 ntigen, nd used to infect prentl, doule-knockout nd gene-reconstituted doule-knockout JTAg cells, or CD4 high versions otined y retrovirl trnsduction with pcxsrcd4 nd selection with lsticidin. Anlysis of mrna expression. Totl cellulr RNA ws extrcted from cell lines nd PBMC using n RNesy mini kit (Qigen) nd treted with RNse-free DNse (Qigen). The A 26 nm /A 28 nm rtio ws.2. for ll smples nlysed. Quntittive reverse trnscription PCR (qrt PCR) ws performed in triplicte for ech iologicl smple using LightCycler 96 rel-time PCR system (Roche) nd Kp SYBR FAST One-Step qrt PCR Universl kit (Kp Biosystems) ccording to the mnufcturer s instructions. Threshold cycle vlues were normlized for those otined for GAPDH, nd reltive expression levels were clculted using the 2 2DDCt method 59. The primer pirs used were: SERINC3, 59-AATTCAGGAACACCAGCCTC-39 nd 59-GGTTGGGATTGCAGGAAC GA-39; SERINC5, 59-ATCGAGTTCTGACGCTCTGC-39 nd 59-GCTCTTC AGTGTCCTCTCCAC-39; GAPDH, 59-TGCACCACCAACTGCTTAGC-39 nd 59-GGCATGGACTGTGGTCATGAG-39. Anlysis of lte reverse trnscriptse products. Virions were produced y co-trnsfecting 293T cells with NL4-3/Nefstop (1.5 mg) nd the pbj5-sed vector expressing SERINC5 (5 ng) or n equimolr mount of empty pbj5. Cell-free virions were treted with RNse-free DNse I (Roche), nd used to infect A549/ CD4/CXCR4 cells in duplicte in T25 flsks for 14 h in the sence or presence of cocktil of reverse trnscriptse inhiitors. Genomic DNA ws extrcted with DNAzol (Life Technologies), nd 1 ng of ech templte DNA ws used for quntittive PCR using LightCycler 96 rel-time qpcr system (Roche) nd Kp SYBR FAST Universl qpcr kit (Kp Biosystems) ccording to the mnufcturer s instructions. The primers used to quntify lte reverse trnscriptse products were J1 forwrd 59-ACAAGCTAGTACCAGTTGAGCCAGATAAG- 39, nd J2 reverse 59-GCCGTGCGCGCTTCAGCAAGC-39. The J1 forwrd primer exploits differences etween the 59 nd 39 long terminl repets of pnl4-3 to help distinguish etween lte reverse trnscriptse products nd contminting plsmid DNA. Stndrd curves were otined from tenfold seril dilutions of DNA extrcted from cells infected with virions produced in the sence of exogenous SERINC5. Quntittive PCR results were normlized for input virus sed on p24 ntigen quntifictions. A549/CD4/CXCR4 trget cells were generted y trnsduction with retrovirl vectors expressing CD4 (pmscvpurocd4) nd CXCR4 (pcxsrcxcr4). Virion fusion ssy. Virions contining BlM-Vpr were produced y trnsfecting 293T cells with HXB/Env 2 /Nef 2 (2.5 mg), vector expressing the Env protein of HIV-1 HXB2 or frmeshifted version unle to express Env (2 ng), the BlM- Vpr expression vector pmm31 (1 mg), nd pbj5-sed vector expressing SERINC5 (1 mg or 1 ng) or n equimolr mount of empty pbj5 (.7 mg or 7 ng). Cell-free virions were normlized for p24 ntigen nd incuted with TZM-l or A549/CD4/CXCR4 cells in 6-well pltes for 4 h t 37 uc. After wshing with PBS, 1 ml CCF4-AM dye solution in phenol-free DMEM/ 2% FBS ws dded to the cells. The CCF4-AM dye solution ws prepred using LiveBLAzer FRET-B/G loding kit (Life Technologies) ccording to the lterntive protocol recommended y the mnufcturer. After incution for h t 11 uc in n ECHOterm chilling incutor (Torrey Pines Scientific), the cells were wshed 3 3 with PBS, detched with Versene (Life Technologies), fixed in 2% prformldehyde/pbs, nd nlysed on Becton Dickinson LSR II flow cytometer. Smples were excited with 45-nm violet lser, nd fluorescence emission ws mesured in the Pcific Blue chnnel (45/5-nm filter) nd in the AmCyn chnnel (525/2-nm filter). 49. Rodenurg, C. M. et l. Ner full-length clones nd reference sequences for sutype C isoltes of HIV type 1 from three different continents. AIDS Res. Hum. Retroviruses 17, (21). 5. Collmn, R. et l. An infectious moleculr clone of n unusul mcrophge-tropic nd highly cytopthic strin of humn immunodeficiency virus type 1. J. Virol. 66, (1992). 51. Dorfmn, T., Popov, E., Pizzto, M. & Gottlinger, H. G. Nef enhnces humn immunodeficiency virus type 1 infectivity in the sence of mtrix. J. Virol. 76, (22). 52. Dorfmn, T., Mmmno, F., Hseltine, W. A. & Gottlinger, H. G. Role of the mtrix protein in the virion ssocition of the humn immunodeficiency virus type 1 envelope glycoprotein. J. Virol. 68, (1994). 53. Akgi, T., Shishido, T., Murt, K. & Hnfus, H. v-crk ctivtes the phosphoinositide 3-kinse/AKT pthwy in trnsformtion. Proc. Ntl Acd. Sci. USA 97, (2). 54. Dettenhofer, M. & Yu, X. F. Highly purified humn immunodeficiency virus type 1 revels virtul sence of Vif in virions. J. Virol. 73, (1999). 55. Chesero, B., Wehrly, K., Nishio, J. & Perrymn, S. Mcrophge-tropic humn immunodeficiency virus isoltes from different ptients exhiit unusul V3 envelope sequence homogeneity in comprison with T-cell-tropic isoltes: definition of criticl mino cids involved in cell tropism. J. Virol. 66, (1992). 56. Kelstrup, C. D., Young, C., Lvllee, R., Nielsen, M. L. & Olsen, J. V. Optimizedfst nd sensitive cquisition methods for shotgun proteomics on qudrupole oritrp mss spectrometer. J. Proteome Res. 11, (212). 57. Accol, M. A., Strck, B. & Gottlinger, H. G. Efficient prticle production y miniml gg constructs which retin the croxy-terminl domin of humn immunodeficiency virus type 1 cpsid-p2 nd lte ssemly domin. J. Virol. 74, (2). 58. Acioglu, Y. H. et l. Epitope mpping nd topology of culovirus-expressed HIV-1 gp16 determined with pnel of murine monoclonl ntiodies. AIDS Res. Hum. Retroviruses 1, (1994). 59. Schmittgen, T. D. & Livk, K. J. Anlyzing rel-time PCR dt y the comprtive C(T) method. Nture Protocols 3, (28). G215 Mcmilln Pulishers Limited. All rights reserved

9 RESEARCH ARTICLE HIV1 NL43 : Nef Nef Nef NefglycoMA NefglycoMA NefglycoMA CA frction 8 frction 9 frction 1 Proteins identified only in Nef - virions Experiment 1 Experiment 2 Protein Symol SERINC3 STOM PFKP SERINC3 Grdient Frction Totl Spectrum Count % Coverge Proteins identified with t lest 5% coverge oth in frction 8 nd in frction 9 re shown Extended Dt Figure 1 Identifiction of SERINC3 s cndidte trget of Nef nd glycogg., Anti-HIV-1 CA immunolot of Nef 1, Nef 2 nd glycoma 1 HIV-1 virions collected from the indicted frctions of OptiPrep grdients., Proteins identified y mss spectrometry in Nef 2 ut not in Nef 1 or glycoma 1 virion lystes. The dt re from two independent experiments. G215 Mcmilln Pulishers Limited. All rights reserved

10 RESEARCH HIV-1: glycoma-ha: NL4-3glycoMA NL4-3/Nefstop WT HIV-1: glycoma-flag: NL4-3/Nefstop WT Virus SERINC3 HA HIV-1 CA Virus SERINC5 HA HIV-1 CA Cells SERINC3 HA glycoma HA Extended Dt Figure 2 MLV glycogg inhiits the incorportion of SERINC3 nd SERINC5 into HIV-1 virions.,, Western lots showing the effects of wild-type or mutnt glycoma on the incorportion of SERINC3 HA () or SERINC5 HA () into Nef 2 HIV-1 virions. The NL4-3/glycoMA Cells SERINC5 HA glycoma FLAG provirl construct expresses untgged glycoma in cis. In ll other cses, HAtgged () or Flg-tgged () glycoma proteins were expressed in trns. The white nds mrked y sterisks re cused y co-migrting HIV-1 Pr55 gg. Both experiments were performed twice. G215 Mcmilln Pulishers Limited. All rights reserved

11 RESEARCH ARTICLE HeL cells SERINC5-mCherry U2-OS cells SERINC5-mCherry empty vector SERINC5-mCherry glycogg 1.K 8 Empty vectors SERINC5(iHA) SERINC5(iHA) SERINC5(iHA) vector Nef SF2 glycogg FSC HA-PE Extended Dt Figure 3 Nef nd glycogg downregulte SERINC5 from the cell surfce., SERINC5 re-loclizes from the plsm memrne to perinucler vesicles in the presence of glycogg. HeL or U2-OS cells trnsiently expressing SERINC5 mcherry lone or together with glycogg were exmined y live-cell fluorescence microscopy., Nef nd glycogg oth downregulte SERINC5. JTAg cells trnsiently expressing SERINC5(iHA), either lone or together with Nef SF2 or glycogg, were surfce-stined with nti-ha ntiody nd nlysed y flow cytometry. Per cent frctions of cells expressing SERINC5(iHA) on the surfce re indicted. This experiment ws performed twice. G215 Mcmilln Pulishers Limited. All rights reserved

12 RESEARCH RPKM Jurkt E6.1 uninfected Nef Nef - SERINC1 SERINC2 SERINC3 SERINC4 SERINC5 TSG11 HPRT1 Normlized mrna level SERINC3 SERINC5 c SERINC NS JTAg 293T MT4 PBMC -PHA PBMC PHA JTAg 293T MT4 PBMC -PHA PBMC PHA INFα: none 1 U Extended Dt Figure 4 SERINC mrna expression levels., Expression of SERINC fmily memers in uninfected nd HIV-infected Jurkt E6.1 cells. RNA ws extrcted t the pek of infection with wild-type (Nef 1 ) or Nef 2 HIV- 1 NL43, nd gene expression ws quntified y RNA-seq s reds per kilose of coding sequence per million reds (RPKM) (n 5 1). The HIV-1 udding fctor TSG11 nd the housekeeping gene HPRT1 re included for comprison., Levels of SERINC3 nd SERINC5 mrna (ritrry units) in cell lines nd primry cells, s mesured y qrt PCR (n 5 3). PBMC were left unstimulted or stimulted with.5 mgml 21 phytohemgglutinin (PHA) nd 2 U ml 21 IL-2 for 2 dys. c, SERINC5 mrna expression is not induced y INF-. PBMC were left untreted or treted with 1, U ml 21 humn INF- 2 (PBL Assy Science) for 14 h (n 5 2). Dt re men nd s.d. NS, not significnt (P..5) two-tiled unpired t-test. G215 Mcmilln Pulishers Limited. All rights reserved

13 RESEARCH ARTICLE.2 % 34.1 %.9 % TZM-l TZM-l TZM-l Env /vector (.7 μg) Env /vector (.7 μg) Env /SERINC5 (1 μg).1 % 38.3 %.3 % A549 A549 A549 Env /vector (.7 μg) Env /vector (.7 μg) Env /SERINC5 (1 μg).1 % 3. % 7.3 % A549 A549 A549 Env /vector (7 ng) Env /vector (7 ng) Env /SERINC5 (1 ng) Extended Dt Figure 5 Exogenous SERINC5 inhiits the fusion of progeny virions with trget cells. TZM-l or A549/CD4/CXCR4 cells were exposed to equl mounts of virus contining BlM-Vpr, nd fusion ws nlysed y mesuring the Env-dependent increse in lue fluorescence using multiprmeter flow cytometry. Virions were produced in 293T cells trnsfected with n Env 2 HIV-1 provirus, vector expressing Env HXB2 (Env 1 ) or frmeshift mutnt (Env 2 ), vector expressing BlM-Vpr, nd vector expressing SERINC5 (1 mg or 1 ng) or n equimolr mount of the empty vector (.7 mg or 7 ng). The percentge of cells displying incresed lue fluorescence is indicted. G215 Mcmilln Pulishers Limited. All rights reserved

14 RESEARCH HIV-1-GFP: SERINC5: 1.K 8 Donor 1 FSC GFP fluorescence Donor 2 FSC 1.K Extended Dt Figure 6 Exogenous SERINC5 reduces the infectivity of Nef 2 HIV-1 progeny virions for primry trget cells. In two independent experiments, PHA-stimulted PBMC from different donors were infected with GFP fluorescence equl mounts of single-cycle GFP HIV-1 virions produced in 293T cells in the sence or presence of exogenous SERINC5. Per cent frctions of infected (GFP-positive) cells re indicted. G215 Mcmilln Pulishers Limited. All rights reserved

15 RESEARCH ARTICLE Env: Nef: Virus JRFL JR(SF V1/V2) SERINC5-HA Pr55 p CA Cells SERINC5-HA Nef-HA Extended Dt Figure 7 SERINC5 incorportion into HIV-1 virions tht differ in Nef responsiveness. Recominnt virions were produced in 293T cells co-trnsfected with the HXB/Env 2 /Nef 2 provirus nd vectors expressing the poorly Nef-responsive Env JRFL or the highly Nef-responsive JR(SF V1/V2) Env chimer, long with vector expressing SERINC5 HA. Empty pbj5 vector or version expressing HA-tgged Nef 97ZA12 ws lso co-trnsfected. SERINC5 HA in purified virions ws detected y western lotting. This experiment ws performed twice. G215 Mcmilln Pulishers Limited. All rights reserved

16 RESEARCH SERINC3 Gene sequence Trget site A TGTGTATCGGATCAGCTTTGCCATGGCCATCT JTAg S3 -/- (1) TGTGTATCGGATCAGCTTTGGCCATGGCCATCT (1 p insertion) TGTGTATCGTCT (2 p deletion) Gene sequence Trget site B ATGGTTGGCTCTTTCTACATCCCTGGGGGCTAT JTAg S3 -/- (2) ATGGTTGGCTCTTTCTACCCCTGGGGGCTAT ATGGTTGGCTCTTTCTACATAT (2 p deletion) (11 p deletion) SERINC5 Trget site A Trget site B Gene sequence GGTGACACCTGTGAGAAGCTGGTGGGATATT / 11.5 k/ GACAGCCACACTCGGGGCTCTTACAATCAGGGGT JTAg S5 -/- (1) GGTGACACCTGTGAGAAGCTCGGGGCTCTTACAATCAGGGGT GACAGCCACACTTCGGGGCTCTTACAATCAGGGGT JTAg S5 -/- (2) GGTGACACCTGTGAGAAGCTTCGGGGCTCTTACAATCAGGGGT GACAGCCACACGTCGGGGCTCTTACAATCAGGGGT GACAGCCACACTTCGGGGCTCTTACAATCAGGGGT JTAg S3 -/- S5 -/- (1) GGTGACACCTGTGAGAAGCTAGTGTGGCTGTC / 11.5 k/ AATATCCCACCGGGGCTCTTACAATCAGGGGT GGTGACACCTGTGAGAAGCTTGGTGGGATATT / 11.5 k/ GACAGCCACACATCGGGGCTCTTACAATCAGGGGT JTAg S3 -/- S5 -/- (2) GGTGACACCTGTGAGAAGCTTGGGGT GACAGCCACACTTCGGGGCTCTTACAATCAGGGGT Extended Dt Figure 8 Chrcteriztion of JTAg knockout cells., Mutnt SERINC3 lleles identified in SERINC3 knockout clones., Mutnt SERINC5 lleles identified in SERINC5 knockout nd SERINC3/5 douleknockout clones. The single-guide RNA (sgrna) trget sites re highlighted, nd the predicted Cs9 trget sites re indicted y rrowheds. Inserted nucleotides re in red. One of the two mutted SERINC5 lleles in JTAg S3 2/2 S5 2/2 (1) cells hs n inversion etween sgrna trget sites A nd B. JTAg S5 2/2 (2) cells contin three mutted SERINC5 lleles. All muttions cuse frmeshifts nd/or lrge deletions of coding sequence. No wild-type lleles were detected in ny of the knockout clones. G215 Mcmilln Pulishers Limited. All rights reserved

17 RESEARCH ARTICLE SERINC3 4.5 SERINC5 Prentl Doule-KO Doule-KO/ reconstituted SERINC3 Normlized mrna level Actin Prentl Doule-KO/ reconstituted Extended Dt Figure 9 SERINC3 nd SERINC5 expression levels in reconstituted doule-knockout cells., SERINC3 protein levels in prentl, doule-knockout, nd reconstituted doule-knockout JTAg cells were compred y western lotting. SERINC3 migrted close to prominent ckground nd tht ws lso recognized y the nti-serinc3 ntiody., SERINC5 mrna levels in prentl nd reconstituted doule-knockout JTAg cells were compred y qrt PCR (n 5 3). G215 Mcmilln Pulishers Limited. All rights reserved

18 RESEARCH Nef: NL43 97ZA12 NL43 97ZA12 NL43 97ZA12 NL43 97ZA12 NL43 97ZA12 NL43 97ZA12 Pr55 p41 CA Actin Prentl Doule-KO Doule-KO/ reconstituted Prentl Doule-KO Doule-KO/ reconstituted Dy 9 fter infection Dy 11 fter infection Infected CD4 high JTAg cells Extended Dt Figure 1 Effects of SERINC knockout nd reconstitution on HIV-1 repliction. Prentl, doule-knockout nd SERINC31SERINC5- reconstituted doule-knockout CD4 high JTAg cells were nlysed y immunolotting with nti-hiv CA t dys 9 nd 11 fter infection with equl mounts (2 ng ml 21 p24) of HIV-1 NL43 encoding either wild-type or disrupted versions of Nef NL43 or Nef 97ZA12. G215 Mcmilln Pulishers Limited. All rights reserved