LETTERS. Disulphide-isomerase-enabled shedding of tumour-associated NKG2D ligands

Transcription

1 Vol My 2007 doi: /nture05768 LETTERS Disulphide-isomerse-enled shedding of tumour-ssoited NKG2D lignds Brett K. Kiser 1 *, Desong Yim 1 *, I-Ting Chow 1 *, Segundo Gonzlez 1 {, Zhenpeng Di 1, Henning H. Mnn 1, Rolnd K. Strong 1, Veronik Groh 1 & Thoms Spies 1 Tumour-ssoited lignds of the tivting NKG2D (nturl killer group 2, memer D; lso lled KLRK1) reeptor whih re indued y genotoxi or ellulr stress trigger tivtion of nturl killer ells nd o-stimultion of effetor T ells, nd my thus promote resistne to ner 1 6. However, mny progressing tumours in humns ounter this nti-tumour tivity y shedding the solule mjor histoomptiility omplex lss-i-relted lignd, whih indues internliztion nd degrdtion of NKG2D nd stimultes popultion expnsions of normlly rre NKG2D 1 CD4 1 T ells with negtive regultory funtions 7 9. Here we show tht on the surfe of tumour ells, ssoites with endoplsmi retiulum protein 5 (; lso lled PDIA6 or P5), whih, similr to protein disulphide isomerse, usully ssists in the folding of nsent proteins inside ells 10. Phrmologil inhiition of thioredutse tivity nd gene silening reveled tht ell-surfe funtion is required for shedding. nd memrne-nhored form trnsitory mixed disulphide omplexes from whih solule is relesed fter proteolyti levge ner the ell memrne. Redution of the seemingly inessile disulphide ond in the memrneproximl 3 domin of must involve lrge onformtionl hnge tht enles proteolyti levge. These results unover moleulr mehnism wherey domin-speifi deonstrution regultes protein shedding, therey promoting tumour immune evsion, nd identify surfe s strtegi trget for therpeuti intervention. NKG2D-medited tumour rejetion n e effetive t erly stges of tumour growth 1 3,5. However, sustined surfe expression nd shedding of solule (s) y lte-stge humn tumours negtively imprint on the lol nd systemi immune response, thus promoting tumour immune evsion 7 9. The signifine of this reltionship is highlighted y enefiil effets of neutrlizing nti- ntiodies tht were indued s result of immunotherpy in linil tril 11. These findings re supported y mouse model study tht onfirmed systemilly impired nturl killer ell nd CD8 T-ell funtions, ompnied y inresed tumour suseptiility, s result of NKG2D downmodultion y lolly sustined NKG2D lignd expression 12. However, mie lk sequenes tht re orthologous to humn nd the losely relted MICB, nd shedding of nturlly expressed NKG2D lignds hs not een oserved in mie 6. Erly studies of the intertions etween NKG2D nd its lignds used rndomly oligomerized reominnt or ULBP fmily lignds produed s immunogloulin fusion proteins, ll of whih ound exlusively to NKG2D-expressing lymphoytes 13,14. On testing nd ULBP2 tetrmers, we onfirmed tht these high-vidity regents stined the NKL nturl killer ell line nd tht inding ws entirely ounted for y NKG2D (Fig. 1). However, during the ourse of sreening,40 ell lines y flow ytometry, we oserved tht, ut not ULBP2, tetrmers stined ell types lking NKG2D. The highest fluoresene intensities were reorded with myelom ells nd ll of the ten epithelil tumour lines tested, nd orrelted with reltively lrge mounts of ell-surfe. Only monoyti ells were identified s negtive for tetrmer inding (Fig. 1). The tetrmers were prepred using glyosylted protein sereted y trnsfeted 293T ells. However, tetrmer inding ws not redued fter levge of ell-surfe polypeptide-linked rohydrtes ut ws inhiited in the presene of unglyosylted reominnt (Fig. 1). Thus, these results reveled n intertion involving ut not NKG2D lignds in generl nd n unidentified surfe protein. Cndidte -inding proteins were purified from nd negtive ontrol outer ell memrnes using -oupled sephrose eds. SDS polyrylmide gel eletrophoresis (SDS PAGE) nd silver stining reveled two sets of protein nds tht were deteted with ut not ells (Fig. 1). By mss spetrometry, two protein nds in the kilodlton (kd) moleulr mss rnge orresponded to het shok 70 kd protein 5 (gluoseregulted protein, 78 kd) (HSPA5, lso known s BiP). A mjor protein nd of 50 kd ws identified s (ref. 10), nd two dditionl proteins of out 47 nd 48 kd shred similrities with thioredoxin fmily memers. Beuse ll of these proteins re typilly intrellulr, we srutinized their outer ell memrne loliztion. Using the sme purifition protool nd surfe-iotinylted ells, immunolots proed with streptvidin-horse rdish peroxidse (HRP) or polylonl ntiodies demonstrted the presene of HSPA5, nd more prominently, on the surfe of ut not ells, whih ws onfirmed y stining for (Fig. 1, d). is relted to protein disulphide isomerse. Both proteins ontin two thioredoxin-like domins, eh with pir of tive site ysteines in CXXC motifs, nd medite the intrellulr formtion of nsent polypeptide disulphide onds; however, they hve lso een implited in extrellulr disulphide exhnge 10, In exploring funtionl reltionship etween nd, we were guided y the epithelil tumour-ssoited expression tht is hrteristi of ut not the ULBP fmily of NKG2D lignds 6,9. This ide ws enourged when freshly isolted tumour ells displyed similr ptterns of tetrmer nd nti- nd nti- ntiody inding, nd mthed serum smples were positive for s (Fig. 2). We thus tested for role of in shedding y exposing ells nd tumour lines HeL, A375 melnom, nd HCT116 nd LoVo olon rinom to DTNB (5,5-dithiois-(2- nitroenzoi id)) or PAO (phenylrsine oxide), whih impir 1 Fred Huthinson Cner Reserh Center, 1100 Firview Avenue North, Settle, Wshington 98109, USA. {Present ddress: Biologi Funionl, Universidd de Oviedo, IUOPA, Oviedo, Asturis 33006, Spin. *These uthors ontriuted eqully to this work. 482

2 NATURE Vol My 2007 LETTERS protein disulphide isomerse funtion y forming disulphide nd oordintion onds, respetively, with thiol groups in its tlyti sites 18. Both inhiitors redued the prodution of s t titred non-toxi onentrtions without ffeting surfe expression of (Fig. 2 nd dt not shown). Tretment with PAO lso diminished tetrmer inding, suggesting tht interts diretly with n tlyti site (Fig. 2). However, these inhiitors re reltively nonspeifi nd my hve pleiotropi effets. Therefore, nd to prelude n involvement of thiol isomerses other thn, we expressed short interfering (si)rna onstruts trgeting two regions of messenger RNA in A375 ells. As mesured y rel-time reverse trnsription PCR (RT PCR), mrna ws redued y,70 80% s result of the sirna trgeting (Fig. 3). As onsequene, surfe expression, tetrmer inding nd s shedding deresed, lthough the mount of surfe protein ws not notiely hnged (Fig. 3, ). Thus, the umultive evidene indited tht surfe funtion is required for shedding. The funtionl ssoition etween nd ws iohemilly nlysed. Initil filure to o-immunopreipitte these proteins from lystes of surfe-iotinylted HeL ells implied tht nd mintin no stle omplexes fter soluiliztion. However, o-immunopreipitted with when HeL ells were treted with trihloroeti id (TCA), whih trps mixed disulphide polypeptides nd quenhes thiol interhnge (Fig. 4, lne 1) 19. Sulphydryl groups in susequent ell lystes were lkylted nd immunoomplexes deglyosylted with N-glynse. This proedure ws modified y using HeL ells grown in the presene of dentured nd redued RNse (drnse), whih served s exess sustrte, shifting equilirium towrds the redued stte 20 nd therey fvouring disulphide exhnge with. Anlysis y SDS PAGE nd immunolotting showed tht inresing the onentrtion of drnse resulted in lrger mounts of o-immunopreipitting with (Fig. 4, lnes 1 4). Conomitntly, the polypeptide of 38 kd (shortened in HeL ells owing to homozygous ytoplsmi til deletion ) disppered, nd proteins with moleulr msses of nd 34 kd emerged. The 34-kD protein orresponded to trunted s, s determined y seondry preipittion from dissoited immunoomplexes nd omprison to s isolted from HeL ell ulture medi (Fig. 4, lnes 3, 4, 9 nd 12). The -kd protein my represent nother sustrte or o-ftor tht ws reruited into omplexes. Similr dt were otined using nti- for immunopreipittions (Fig. 4, lnes 5 nd 6). None of those iohemil hnges ws oserved when ells were grown in the presene of ntive RNse (Fig. 4). Thus, these results NKL NKL + ma 1D11 + ma 1D11 + r Melnom (9 ng ml 1 serum s) Brest tumour (12 ng ml 1 serum s) HeL HCT116 LoVo A375 + r Ovrin tumour (36 ng ml 1 serum s) Fluoresene ( ) nd ULBP2 ( ) tetrmers kd tetrmer Fluoresene HSPA5 Trx-like s (ng ml 1 ) HeL + DTNB + PAO A375 + DTNB + PAO Silver stin Streptvidin-HRP Anti-HSPA5 Anti- DTNB (mm) 0 PAO (mm) d HeL HCT116 HeL A Fluoresene Figure 1 Surfe intertions of with nd HSPA5., Flow ytometry onfirms (lk shding) nd ULBP2 (light-grey shding) tetrmer inding to NKL ells nd inhiition y nti-nkg2d monolonl ntiody 1D11 (drk-grey shding). ut not ULBP2 tetrmers ind to NKG2D-negtive, HeL, HCT116, LoVo nd A375 tumour ells, nd inding is inhiited y teril reominnt (drk-grey shding). ells re negtive for tetrmer inding. Open profiles re ontrol IgG stinings., Silver stining of nd outer ell memrne proteins enrihed for inding to eds. Trx, thioredoxin., Proing of ed-purified proteins from surfe iotinylted ells with streptvidin-hrp or speifi ntiser. Two dditionl nds in the nti- lne re ross-retive. d, Anti- stinings (lk shding). Open profiles re IgG ontrols. Fluoresene tetrmer ( ) or + ( ) PAO Figure 2 Tumour-ssoited surfe expression nd phrmologil inhiition of s shedding., Freshly isolted melnom, rest nd ovrin tumour ells re positive for, tetrmer inding nd surfe (lk shding; open profiles re IgG ontrol stinings for nti- nd nti-, nd phyoerythrin-streptvidin ontrols for tetrmer). Mthed ptient peripherl lood serum smples ontin the indited mounts of s. Dt re representtive of five mthed smple pirs., DTNB nd PAO redue shedding of s y HeL nd A375 ells in dose-dependent mnner, s determined y ELISA. Similr results were otined with HCT116 nd LoVo ells., PAO interferes with tetrmer inding. Open profiles re phyoerythrin-streptvidin ontrols. 483

3 LETTERS NATURE Vol My 2007 demonstrted dynmi intertions etween nd tht were losely tied to the prodution of s, whih ws orroorted y lrge inreses of s in drnse-treted HeL nd A375 ell ultures (Fig. 4). To demonstrte medited disulphide ond redution nd explore sustrte nd domin speifiities, terilly produed reominnt proteins were mixed nd inuted in the sene of reduing gents nd thus under oxidizing onditions. Non-reduing gel eletrophoresis nd omprison to -merptoethnol (-ME)- treted smples showed grdul redution of (Supplementry Fig. 1). This ws remrkle s ffeted n intt, properly folded, sustrte protein isoenergetilly nd in the sene of ny other ftor in solution. A similr result ws otined with the losely relted MICB (dt not shown). In ontrst, did not ffet unrelted proteins with reltively essile intr-hin (siderolin) or intr-hin nd inter-hin (KLRD1 NKG2A) disulphide onds (Supplementry Fig. 1). No synergisti effet ws oserved when ws exposed to together with HSPA5. Of the two thioredoxin-like domins, whih were expressed s two seprte polypeptides (mino id residues nd 135 4; Fig. 5), only the mino-terminl domin displyed funtionl tivity (Fig. 5 nd dt not shown). As with protein disulphide isomerse, uses tlyti mehnism wherey one tive site ysteine invdes the trget disulphide, trnsiently forming disulphide-linked heterodimer tht is resolved y disulphide exhnge with the seond tive site ysteine 10,15. Of two (1 118) mutnt frgments, the C36S point muttion showed no tivity on sustrte wheres C39S formed trpped disulphide-linked intermedite, thus onfirming the role of C36 s the invding nd C39 s the resolving ysteine in mrna in sirnatrnsdued A375 ells sirna-17 sirna-19 Ctrl Mok or irrelevnt sirna s shedding y sirna-trnsdued A375 ells Ctrl sirna-17 sirna Perentge of mok trnsdution s (ng ml 1 ) this retion (Fig. 5). By size-exlusion hromtogrphy, intt ws trimer in solution wheres the two individul domins ehved s monomers (dt not shown). Thus, multimeriztion ws not required for redution. Similr to onventionl mjor histoomptiility omplex lss I moleules, ontins three intr-hin disulphide onds loted etween mino id residues 36 nd 41, 96 nd 164, nd 202 nd 259 in the 1, 2 nd the C-type immunogloulin-like 3 domin, respetively 22. To identify the trget disulphide, the 12 pltform nd 3 memrne-proximl domins were expressed nd tested seprtely. displyed no tivity with the 12 domin (Fig. 5d). Beuse we were unle to eletrophoretilly resolve redued nd non-redued forms of the reltively smll 3 domin, we used the (1 118) polypeptide frgment with the C39S muttion for nlysis. Gel eletrophoresis reveled lrge protein nd shift orresponding to mixed disulphide heterodimer (Fig. 5e). Thus, the disulphide ond trgeted y ws in the 3 domin. Proteolyti levge of is thought to e medited y metlloproteinses 23. However, with HeL nd A375 ells we oserved no redution in s shedding y metlloproteinse inhiitors, suggesting tht diverse proteses my hve the ility to leve. To determine the levge site, we purified s from ultures of trnsfetnt C1R- ells, whih express modest mounts of ut proliferte vigorously in serum-free medi. Croxy-terminl sequening y mss spetrosopi nlysis of trypti peptide frgments reveled rgged C termini defined y severl neighouring mino id residues t or ner the trnsmemrne oundry. Our results suggest tht levge ours in omplex with efore mixed disulphide resolution, whih in ll likelihood results in immedite snp-k oxidiztion of the disulphide ond. espe from intrellulr retention is proly independent of, s intrellulr intertions hve not een oserved 24. Preedent for iologil funtions of surfe thiol isomerses inludes kd Primry IP Seondry IP Anti- Anti- Anti Anti- r s s? sirna-17 sirna-19 kd drnse (µm) Anti- 100 s (ng ml 1 ) A375 HeL Tetrmer Fluoresene Figure 3 is required for s shedding., Expression of sirna onstruts 17 or 19 in A375 ells results in,70 80% redution of mrna, s mesured y rel-time RT PCR., Knokdown of mrna dereses tetrmer inding nd surfe expression (lk shding in entre nd right olumns). expression (lk shding in left olumn) is unhnged; open profiles represent IgG ontrol stinings., Knokdown of mrna diminishes s shedding s determined y ELISA. Control rs in nd nd grey-shded ontrol profiles in represent mok-trnsdued ells or ells expressing irrelevnt sirna. Error rs in nd represent devitions mong three experiments RNse (µm) drnse (µm) Figure 4 disulphide exhnge enles levge., Tretment of surfe-iotinylted HeL ells with TCA efore lysis, immunopreipittion, SDS PAGE nd memrne trnsfer revels omplexes (lne 1). Protein identities re onfirmed y seondry preipittions (lnes 7, 8, 10), primry preipittions of (lnes 5, 6) nd y reominnt (lne 11). After ell ulture in the presene of drnse, o-immunopreipitted inreses (lnes 2 4), full-length disppers nd s emerges (lnes 3, 4). s identity is onfirmed y seondry preipittion (lne 9) nd omprison to s from ell ulture medi (lne 12)., Control experiment with ells grown in the presene of ntive RNse., drnse promotes s shedding. Error rs represent devitions mong three experiments.

4 NATURE Vol My 2007 LETTERS N + F β-me + F CGHC (h) kd CGHC 174 F118-C39* β-me F118- C39* C KDEL (h) kd * neutrliztion in stndrd NP-40 lysis uffer ontining protese inhiitors nd N-ethylmleimide. Immunopreipitted protein omplexes were treted with N-glynse nd sujeted to SDS PAGE nd memrne trnsfer. C-terminl truntion nlysis of s ws performed y mss spetrometry t the Hrvrd University Mirohemistry Fility. tivity ssys. All proteins, domins nd the C36S nd C39S mutnts (mde y Strtgene Quik Chnge methodology) were expressed in teri nd purified s desried 28. nd sustrte proteins were inuted t room temperture in PIPES uffer nd resolved in Tris-glyine or Bis-Tris NuPAGE (Invitrogen) gels. Full Methods nd ny ssoited referenes re ville in the online version of the pper t Reeived 1 Mrh; epted 22 Mrh Pulished online 9 My d α1α2 β-me (h) kd α1α2 45 e F118-C39* α3 β-me F118- C39* α (h) Figure 5 exhiits speifiity for the 3 domin., orgniztion with CGHC motifs within thioredoxin domins (open oxes). The top row of numers identifies mino id positions t domin oundries; the ottom row of numers identifies ysteine positions nd truntion sites of expressed frgments., is prtilly redued y (1 118) (F118)., nd the C39S mutnt (C39*) of (1 118) form mixed disulphide heterodimers (sterisk) tht re resolved y -ME. The C39S mutnt of (1 118) prtilly forms homodimers (see lso e). d, hs no effet on the 12 domin. The prtil redution in lne 2 is owing to leeding of -ME from lne 1. e, The C39S mutnt of (1 118) redues the 3 disulphide ond s indited y unresolved heterodimers (sterisk). Filled nd open rrowheds in d mrk the positions of non-redued nd redued forms, respetively, of sustrtes. ltertion of integrin ffinity sttes, CD4 homodimer formtion y inter-hin disulphide exhnge, whih enles HIV-1 T-ell infetion, nd swithing of ell-surfe tissue ftor funtionl sttes etween tivtion of ogultion nd G-protein-oupled signlling 16,17, The funtion of demonstrted here enles tumour immune evsion nd my influene utoimmune diseses through s-medited T-ell modultion 6. METHODS SUMMARY Tetrmers, ntiodies, protein identifition nd ELISA for s. Tetrmers were prepred from reominnt proteins, whih were expressed in trnsfeted 293T ells nd purified using Invitrogen methodology, y BirA enzymti iotinyltion nd onjugtion with phyoerythrin-streptvidin. Anti-NKG2D (monolonl ntiody 1D11) nd nti- (monolonl ntiody 2C10) ntiodies hve een desried 13,24. Rit nti- nd nti-hspa5 were from Affinity BioRegents nd Stressgen, respetively. inding proteins were purified from ells y doune-homogeniztion, dextrn-peg prtitioning, Triton X-114 phse seprtion, nd ffinity hromtogrphy using -onjugted sephrose eds, followed y nlysis of seprted protein nds y mss spetrometry. For immunolotting, -inding proteins were prepred fter ell-surfe iotinyltion with EZ-Link Sulfo-NHS-LC-Biotin (Piere). The enzyme-linked immunosorent ssy (ELISA) for s hs een desried 7. sirna expression nd rel-time RT PCR. Retrovirl trnsdution using pbabe-gfp onstruts nd Phoenix mphotropi pkging ells were used for sirna expression. As with rel-time RT PCR 9, oligonuleotide sequenes nd further detils re given in the Methods setion. Immunopreipittions nd levge. Dentured nd redued RNse A ws prepred s desried 20. HeL ells were exposed to drnse for 16 h, wshed nd surfe iotinylted, inuted in 10% (w/v) TCA in phosphteuffered sline (PBS) for 30 min on ie, wshed, nd lysed with immedite ph kd Cerwenk, A., Bron, J. L. & Lnier, L. L. Etopi expression of retinoi id erly induile-1 gene (RAE-1) permits nturl killer ell-medited rejetion of MHC lss I-ering tumor in vivo. Pro. Ntl Ad. Si. USA 98, (2001). 2. Diefenh, A., Jensen, E. R., Jmieson, A. M. & Rulet, D. H. Re1 nd H60 lignds of the NKG2D reeptor stimulte tumor immunity. Nture 413, (2001). 3. Girrdi, M. et l. Regultion of utneous mlignny y d T ells. Siene 294, (2001). 4. Gsser, S., Orsuli, S., Brown, E. J. & Rulet, D. H. The DNA dmge pthwy regultes innte immune system lignds of the NKG2D reeptor. Nture 436, (2005). 5. Smyth, M. J. et l. NKG2D funtion protets the host from tumor initition. J. Exp. Med. 202, (2005). 6. Gonzlez, S., Groh, V. & Spies, T. Immunoiology of humn NKG2D nd its lignds. Curr. Top. Miroiol. Immunol. 298, (2006). 7. Groh, V., Wu, J., Yee, C. & Spies, T. Tumour-derived solule MIC lignds impir expression of NKG2D nd T-ell tivtion. Nture 419, (2002). 8. Dourovin, E. S. et l. Evsion from NK ell immunity y MHC lss I hinrelted moleules expressing olon rinom. J. Immunol. 171, (2003). 9. Groh, V., Smythe, K., Di, Z. & Spies, T. Fs lignd-medited prrine T ell regultion y the reeptor NKG2D in tumor immunity. Nture Immunol. 7, (2006). 10. Ellgrd, L. & Ruddok, L. W. The humn protein disulphide isomerse fmily: sustrte intertions nd funtionl properties. EMBO Rep. 6, (2005). 11. Jinushi, M., Hodi, F. S. & Drnoff, G. Therpy-indued ntiodies to MHC lss I hin-relted protein A ntgonize immune suppression nd stimulte ntitumor ytotoxiity. Pro. Ntl Ad. Si. USA 103, (2006). 12. Oppenheim, D. E. et l. Sustined lolized expression of lignd for the tivting NKG2D reeptor impirs nturl ytotoxiity in vivo nd redues tumor immunosurveillne. Nture Immunol. 6, (2005). 13. Buer, S. et l. Ativtion of NK ells nd T ells y NKG2D, reeptor for stressinduile. Siene 285, (1999). 14. Cosmn, D. et l. ULBPs, novel MHC lss I-relted moleules, ind to CMV glyoprotein UL16 nd stimulte NK ytotoxiity through the NKG2D reeptor. Immunity 14, (2001). 15. Kikuhi, M., Doi, E., Tsujimoto, I., Horie, T. & Tsujimoto, Y. Funtionl nlysis of humn P5, protein disulfide isomerse homologue. J. Biohem. 132, (2002). 16. Turno, C., Coppri, S., Altieri, F. & Ferrro, A. P. Proteins of the PDI fmily: unpredited non-er loliztions nd funtions. J. Cell. Physiol. 193, (2002). 17. Jordn, P. A. & Giins, J. M. Extrellulr disulfide exhnge nd the regultion of ellulr funtion. Antioxid. Redox Signl. 8, (2006). 18. Gllin, A. et l. Inhiitors of protein-disulfide isomerse prevent levge of disulfide onds in reeptor-ound glyoprotein 120 nd prevent HIV-1 entry. J. Biol. Chem. 277, (2002). 19. Frnd, A. R. & Kiser, C. A. Ero1p oxidizes protein disulfide isomerse in pthwy for disulfide ond formtion in the endoplsmi retiulum. Mol. Cell 4, (1999). 20. Essex, D. W., Chen, K. & Switkowsk, M. Loliztion of protein disulfide isomerse to the externl surfe of the pltelet plsm memrne. Blood 86, (1995).. Groh, V. et l. Brod tumor-ssoited expression nd reognition y tumorderived d T ells of nd MICB. Pro. Ntl Ad. Si. USA 96, (1999). 22. Li, P. et l. Crystl struture of the MHC lss I homolog MIC-A, d T ell lignd. Immunity 10, (1999). 23. Slih, H. R., Rmmensee, H.-G. & Steinle, A. Down-regultion of on humn tumors y proteolyti shedding. J. Immunol. 169, (2002). 24. Groh, V. et l. Cell stress-regulted humn mjor histoomptiility omplex lss I gene expressed in gstrointestinl epithelium. Pro. Ntl Ad. Si. USA 93, (1996). 485

5 LETTERS NATURE Vol My Mtthis, L. J. et l. Disulfide exhnge in domin 2 of CD4 is required for entry of HIV-1. Nture Immunol. 3, (2002). 26. Ahmed, J. et l. Disulfide isomeriztion swithes tissue ftor from ogultion to ell signling. Pro. Ntl Ad. Si. USA 103, (2006). 27. Mekw, A., Shmidt, B. & Fzeks de St.. Groth, B. Snejound, Y.-H. & Hogg, P. J. Evidene for domin-swpped CD4 dimer s the oreeptor for inding to lss II MHC. J. Immunol. 176, (2006). 28. Li, P. et l. Complex struture of the tivting immunoreeptor NKG2D nd its MHC lss I-like lignd. Nture Immunol. 2, (2001). Supplementry Informtion is linked to the online version of the pper t Aknowledgements We thnk W. Crter for protein purifition dvie; M. Welker for help with sirna expression; W. Lne nd P. Gfkn for mss spetrometry nlyses; K. Smythe for tehnil ssistne; nd S. Riddell for omments on the mnusript. This work ws supported y the Cner Reserh Institute (B.K.K.), the Spnish Fondo de Investigiones Snitris (S.G.), the Deutshe Forshungsgemeinshft (H.H.M.), the Edson Fund, the Avon Foundtion Brest Cner Immunotherpy Reserh Inititive, nd y grnts from the NIH. Author Informtion Reprints nd permissions informtion is ville t The uthors delre no ompeting finnil interests. Correspondene nd requests for mterils should e ddressed to T.S. (tspies@fhr.org). 486

6 doi: /nture05768 METHODS Tumour smples nd ell lines, ntiodies, tetrmers, phrmologil inhiitors, nd ELISA for s. The soure of tumour ell suspensions hs een reported previously 7. Cell lines were from the Amerin Type Culture Colletion. Anti-NKG2D (monolonl ntiody 1D11) nd nti- (monolonl ntiody 2C10) ntiodies hve een desried 13,24. Rit polylonl nti- nd nti-hspa5 ntiodies were from Affinity BioRegents nd Stressgen, respetively. Reominnt *001 (residues 1 276) nd ULBP2 (residues 1 202) were produed in trnsfeted 293T ells nd purified from ulture superntnt using Invitrogen methodology. Tetrmers were prepred y BirA enzymti iotinyltion nd onjugtion with phyoerythrin-streptvidin. Cells were stined with sturting tetrmer onentrtions for 1 h t 4 uc nd exmined y flow ytometry. Non-glyosylted ws expressed in teri nd purified s desried 22. Cells were exposed to DTNB or PAO (Sigm) for 24 h t the indited onentrtions. For inhiition of tetrmer inding, ells were grown for 24 h in the presene of 0.5 mm PAO. Metlloproteinse inhiitors GM 6001 nd MMP inhiitor III were from Cliohem. The ELISA for s hs een desried 7. Identifition of -inding surfe proteins. nd ells (eh ) were doune-homogenized in 10 mm Tris-HCl (ph 7.6), 0.5 mm MgCl 2, 1 mm PMSF, 1 mg ml leupeptin, nd 1 mg ml pepsttin. Memrne frtions were isolted from lered superntnts y dextrn-peg prtitioning, wshed (8% surose, 5 mm Tris-HCl (ph 7.4)), nd dissoited in lysis uffer (50 mm Tris-Cl (ph 7.4), 1% Triton X-114, 150 mm NCl, 5 mm EDTA, 5 mm iodoetmide, protese inhiitors). Clered superntnts were wrmed to 37 uc nd proteins prtitioned during Triton X-114 phse seprtion. Proteins in queous frtions were ffinity purified using onjugted to ynogenromide-tivted sephrose eds, visulized y SDS PAGE nd silver stining, nd nlysed y MALDI-TOF t the FHCRC Mss Spetrometry Fility. For immunolotting, -inding proteins were prepred fter ell surfe iotinyltion with EZ-Link Sulfo-NHS-LC-Biotin (Piere). sirna expression nd rel-time RT PCR. Oligonuleotide pirs for sirna-17 nd sirna-19 trgeting (disulphide isomerse-relted protein P5; GenBnk ession numer D49489) mrna t positions nd were GATCTTGTTGTCAAAGTTGGTGCAGTTGTCTTCTTCTCAACTG- CACCAACTTTGACAACATTTTTG nd AATTCAAAAATGTTGTCAAAG- TTGGTGCAGTTGAGAAGAAGACAACTGCACCAACTTTGACAACAA, nd GATCTTGATAGTTCAAGTAAGAAGGATGTCTTCTTCTCATCCTTCTTA- CTTGAACTATCATTTTTG nd AATTCAAAAATGATAGTTCAAGTAAGA- AGGATGAGAAGAAGACATCCTTCTTACTTGAACTATAA, respetively (ll 59 39; internl hirpin sequene, 39-end termintion signl, nd BglII nd EoRI overhngs re underlined). An irrelevnt oligonuleotide pir with no homology to ny humn gene ws GATCTTATGTCAAGTTGTATAGTTA- TTCAAGAGATAACTATACAACTTGACATATTTTTG nd AATTCAAAAA- TATGTCAAGTTGTATAGTTATCTCTTGAATAACTATACAACTTGACATAA. Anneled primers were ligted into retrovirl vetor pbabe-gfp nd onstruts were sequened. Virus ws produed in Phoenix mphotropi pkging ells nd ulture superntnt used for infetion of A375 ells, whih were sorted for GFP expression. Rel-time RT PCR ws performed s desried 9, using primer sets TGCGGCACGCTGCAGGGCT nd TTGACAGTGACCACACCATGGAGCATA for omplementry DNA, nd GGAACGGAAAGGACCTCAGGATG nd CTGGGAGCTCCTGGTGCTGTTG for DNA, nd SYBR Green regents (Moleulr Proes). Preprtion of drnse nd pturing of omplexes. RNse A ws dentured nd redued in 0.1 M Tris-OH (ph 8.6), 6 M gunidine hydrohloride, nd 0.15 M dithiothreitol for 24 h t room temperture, nd deslted using D-Slt Dextrn olumns (Piere) equilirted with PBS semionfluent HeL ells were exposed to the indited onentrtions of drnse or ntive RNse for 16 h, wshed, nd surfe iotinylted with EZ-Link Sulfo- NHS-LC-Biotin (Piere). Lelled ells were inuted in 0.5 ml 10% (w/v) TCA in PBS for 30 min on ie, wshed sequentilly in 10% nd 5% TCA in PBS, nd lysed in 50 mm Tris (ph 7.4), 1% Surft-Amps NP-40 (Piere), 150 mm NCl, 5 mm EDTA, 40 mm N-ethylmleimide (Sigm), 1 mm PMSF, leupeptin (1 mg ml ), nd pepsttin (1 mg ml ). Lyste ph ws djusted to 7.0 with 1 M Tris-OH (ph 9.5). Protein omplexes were preipitted with monolonl ntiody 2C10 (nti-) or polylonl ntiody, treted with N-glynse, nd proessed for SDS PAGE. For sequentil preipittion, monolonl ntiody 2C10 immunoomplexes were dissoited in 150 mm Tris (ph 7.4), 0.5% SDS nd 10 mm dithiothreitol, diluted tenfold with lysis uffer ontining 25 mm iodoetmide, inuted for 1 h t room temperture for dithiothreitol neutrliztion nd sulphydryl lkyltion, nd re-preipitted with nti- monolonl ntiody BAMO-1 (Axxor) or nti-. For determintion of s C-terminl levge, superntnt from C1R- trnsfetnts grown in Opti-MEM (Gio) ws onentrted using Amion Ultr-15 entrifugl filters (Millipore). Immunopreipitted s ws treted with N-glynse, isolted y SDS PAGE, nd sujeted to peptide frgmenttion nlysis y MALDI mss spetrometry t the Hrvrd University Mirohemistry Fility. tivity ssys. Etodomin-only, siderolin nd KLRD1 NKG2A were expressed in teri nd purified s desried 28. We similrly produed (residues 1 4 of the mture protein), the frgments nd 135 4, the C36S nd C39S mutnts (mde y Strtgene Quik Chnge methodology) of (1 118), nd the isolted 12 pltform (residues 1 180) nd 3 domins (residues ) 22. All sequenes were fused to N-terminl hexhistidine trts nd inluded C-terminl stop odon to prevent expression of the djent hexhistidine in pet22(). Reominnt proteins were purified y metl ffinity (BD Tlon, Clonteh) nd size-exlusion hromtogrphy (Superdex 200, Phrmi). For testing of funtionl tivity, or derivtive proteins (2 mg) were inuted t room temperture with sustrtes or ontrol proteins (1.5 mg) in PNEA (25 mm PIPES (ph 7), 150 mm NCl, 1 mm EDTA, nd 0.02% sodium zide) in totl volume of 5 ml per time point smple, mixed with 2x SDS PAGE smple uffer (5 ml) with or without -ME, nd resolved in 15% Tris-glyine or 12% Bis-Tris NuPAGE (Invitrogen) gels.