Endothelial Dysfunction in Rheumatoid Arthritis: the Role of Monocyte Chemotactic

Size: px

Start display at page:

Download "Endothelial Dysfunction in Rheumatoid Arthritis: the Role of Monocyte Chemotactic"

Austin Small
5 years ago
Views:

1 Supplemental file Endothelial Dysfunction in Rheumatoid Arthritis: the Role of Monocyte Chemotactic Protein-1-Induced Protein Ming He, Xiao Liang, Lan He, Wen Wen, Sijia Zhao, Liang Wen, Yan Liu, John Y-J. Shyy, Zuyi Yuan

2 Supplemental Table I. Characteristics of patients with osteoarthritis and rheumatoid arthritis Group OA RA Gender Male Female Male Female Number Age 59.33± ± ± ±9.41 Disease duration, Years* 7± ± ± ±8.63 ζ DAS-28 NA NA 5.57± ±1.37 ESR (mm/h)** 19± ± ± ±26.03 CRP level (mg/l)** 2.56± ± ± ±29.15 Glucose (mmol/l) 5.16± ± ± ±0.51 Cholesterol level (mmol/l) 4.12± ± ± ±1.16 Triglyceride level (mmol/l)** 1.74± ± ± ±0.36 MCP-1 level (ng/ml)** 0.6± ± ± ±12.8 Data are number or mean±sd. DAS-28: disease activity score in 28 joints; ESR: erythrocyte sedimentation rate; CRP: C-reactive protein; MCP-1: monocyte chemotactic protein 1. * P<0.05; ** P<0.01 compared with OA group. ζ P<0.01 compared with Male RA patients.

3 Supplemental Table II. Primers used for real-time PCR 1-3 Gene Forward 5-3 Reverse 5-3 NM Code For Real-Time PCR GAPDH TCAACGGCACAGTCAAGG ACTCCACGACATACTCAGC NM_ MCP-1 CAGGTCCCTGTCATGCTTCT TCTGGACCCATTCCTTCTTG NM_ CCR2 ACCTGTAAATGCCATGCAAGT TGTCTTCCATTTCCTTTGATTTG NM_ MCPIP CTGGAGAGCCAGATGTCAGAATTA GTACTCTCTGGATGGGTAGGTGG NM_ For ChIP MCPIP CCTGAGAAGCAGAGCCACGCACCC CTTAGAAGGAAACAGAGGTGAATT For sirna MCPIP 5 -CGA GGC CAC ACA GAU AUU ATT UAA UAU CUG UGU GGC CUC GTT-3 GAPDH 5 -CAC UCA AGA UUG UCA GCA ATT UUG CUG ACA AUC UUG AGU GAG-3 1. Zhou L, Azfer A, Niu J, Graham S, Choudhury M, Adamski FM, Younce C, Binkley PF, Kolattukudy PE. Monocyte chemoattractant protein-1 induces a novel transcription factor that causes cardiac myocyte apoptosis and ventricular dysfunction. Circ Res. 2006;98: Palazuelos J, Davoust N, Julien B, Hatterer E, Aguado T, Mechoulam R, Benito C, Romero J, Silva A, Guzmán M, Nataf S, Galve-Roperh I. The CB(2) cannabinoid receptor controls myeloid progenitor trafficking: involvement in the pathogenesis of an animal model of multiple sclerosis. J Biol Chem. 2008;283: Skalniak L, Mizgalska D, Zarebski A, Wyrzykowska P, Koj A, Jura J. Regulatory feedback loop between NF-kappaB and MCP-1-induced protein 1 RNase. FEBS J. 2009;276:

4 Supplemental Table III. Characteristics of mice used in the study Group Sex Wight (g) C-Scores P-Scores Glucose (mmol/l) Cholesterol (mmol/l) Triglyceride (mmol/l) Arthritis animal model DBA ± ± ± ±0.26 CIA ± ± ± ± ± ±0.24 MCP-1 neutralizing antibody treatment CIA ± ± ± ± ± ±0.36 CIA+Treat ± ± ± ± ± ±0.31 Simvastatin treatment DBA ± ± ± ±0.30 DBA+Treat ± ± ±0.33* 1.41±0.29 CIA ± ± ± ± ± ±0.33 CIA+Treat ± ± ± ± ±0.32* 1.37±0.29 CIA:collagen-induced arthritis;dba:dba/1j mice;c-scores: clinical scores; P-scores: pathology scores; * P<0.05 when compared with control group.

5 Supplemental Fig. I Supplemental Fig. I. MCP-1 reduces the endothelium-dependent vaso-relaxation ex vivo. (A) and (B) show the endothelium-dependent (Ach) and -independent (SNP) vaso-relaxation of aortas from DBA/1j mice with or without indicated concentrations of MCP-1 for 12 hr. * P<0.05 when MCP-1 (3 ng/ml) group compared with control; Δ P<0.05 MCP-1 (2 ng/ml) group compared with control.

6 Supplemental Fig. II Supplemental Fig. II. MCP-1 level is increased in the ankle and aorta of CIA mice. RT-PCR analysis of MCP-1 mrna in ankle, liver, and aorta in CIAor control mice. GAPDH level was the normalization control. The bar graphs below are mean±sd from 3 independent experiments. * P<0.05 and ** P<0.01 when compared with control group (dotted line).

7 Supplemental Fig. III Supplemental Fig. III. Atorvastatin decreases the MCPIP expression in EOMA cells. EOMA cells were pre-treated with atovasatin at the indicated concentrations for 3 hr, then MCP-1 (12 nmol/l) for 12 hr. Western blot analysis of protein level of MCPIP. GADPH was a normalization control. Data are mean±sd from 3 independent experiments. ** P<0.01 as compared with control (dotted line).

8 Supplemental Fig. Ⅳ Supplemental Fig. Ⅳ. Statin decreases the MCPIP expression in EOMA cells. EOMA cells were pre-treated with simvastatin or atovasatin at the indicated concentrations for 3 hr, then MCP-1 (12 nmol/l) for 12 hr. RT-PCR analysis of mrna level of MCPIP. GAPDH level was an internal reference. Data are mean±sd from 3 independent experiments. * P<0.05 and ** P<0.01 as compared with control (dotted line).

9 Supplemental Fig. Ⅴ Supplemental Fig. Ⅴ. The correlation analysis between MCP-1 and CRP level in serum from human subject (n=40).

Bacterial Gene Finding CMSC 423

Bacterial Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would