CPI-17 Silencing Reduced Responsiveness in Control and TNF-a Treated Human Bronchi

Transcription

1 CPI-17 Silencing Reduced Responsiveness in Control and TNF-a Treated Human Bronchi Caroline Morin 1, Marco Sirois 2, Vincent Echave 2, and Eric Rousseau 1 1 Le Bilarium, Department of Physiology and Biophysics, and 2 Service of Thoracic Surgery, Faculty of Medicine and Health Sciences, Université de Sherbrooke, Sherbrooke, Quebec, Canada Under pathophysiologic conditions, the modulation of Ca 21 sensitivity and reactivity of bronchial smooth muscle is controlled by protein kinase C dependent phosphorylation of the newly described protein, CPI-17. The goal of the present study was to assess the key role of this regulatory protein in airway hyperresponsiveness (AHR) using control and TNF-a treated human bronchi as well as a specific sirna duplex against human CPI-17 transcripts. Validity of a mixed transfection strategy was assessed using the reversible permeabilization method to introduce X-TremeGene (X-TG) sirna complexes in an overreactive model of human bronchi treated with TNF. Data demonstrate that X-TG sirna complexes targeted against CPI-17 transcripts resulted in a reduction in mrna and specific protein expression in human bronchial tissues. This approach revealed that overall reactivity of bronchial smooth muscle to methacholine was reduced, while their relaxing responses to b 2 -agonist were increased, when compared with responses triggered in control TNF-a treated bronchi. Quantification analysis showed that Ca 21 -sensitivity in both untreated and TNF-a treated bronchi were largely reduced upon transfection with human CPI-17 sirna X- TremeGene complexes, while Western blot analysis corroborated the decrease in CPI-17 and MLC phosphorylation levels in pretreated human bronchi. Identical results were obtained upon treatment with an antiinflammatory eicosanoid, 14,15-EET, known to inhibit CPI-17 phosphorylation. Together these results are consistent with a key molecular role for CPI-17 in AHR, in the absence of bronchial wall remodeling. Keywords: CPI-17; TNF-a; epoxyeicosatrienoic acid; bronchial hyperresponsiveness; human lung Increased bronchial responsiveness to nonspecific stimuli is an important typical feature of human respiratory pathologies, including asthma and chronic obstructive pulmonary disease (COPD) (1). Several mechanisms have been suggested to explain airway hyperresponsiveness (AHR), such as alterations in neural control of airway smooth muscle (ASM) (2, 3), inflammatory processes resulting in the release of cytokines and lipid mediators (4), and abnormal calcium handling by ASM cells (5). Contraction of ASM occurs via two related mechanisms. The first is a rise in cytosolic calcium concentration ([Ca 21 ] i ) resulting in the formation of calcium/calmodulin complexes and activation of the myosin light chain (MLC) kinase (MLCK). This activated MLCK phosphorylates the 20-kD MLC (6), which in turn results in ASM cell contraction. The second is a Ca 21 -independent mechanism, which requires either the activation of the Rho-kinase pathway, or (Received in original form May 12, 2008 and in final form August 25, 2008) This work was supported by CIHR grant MOP C.M. is a recipient of a Ph.D.-studentship from the NSERC of Canada. E.R. is a member of the Respiratory Health Network of the FRSQ. Correspondence and requests for reprints should be addressed to Eric Rousseau, Ph.D., Le Bilarium, Department of Physiology and Biophysics, Faculty of Medicine and Health Sciences, Université desherbrooke, 3001, 12th Avenue North, Sherbrooke, PQ, J1H 5N4 Canada. Eric.Rousseau@USherbrooke.ca Am J Respir Cell Mol Biol Vol 39. pp , 2008 Originally Published in Press as DOI: /rcmb RC on August 28, 2008 Internet address: CLINICAL RELEVANCE The present work represents both a technical advance and a mechanistic study, since it provides evidence that a new regulatory protein, CPI-17 expression and phosphorylation, plays a key role in modulating pharmacomechanical coupling in human bronchi. protein kinase C (PKC)-dependent phosphorylation of the 17- kd myosin phosphatase inhibitor protein (referred to as CPI-17) to maintain tone (7). These pathways regulate both myosin phosphorylation and dephosphorylation processes. The Ca 21 sensitization mechanism occurs during agonist-induced activation of the Rho-kinase or PKC/CPI-17 pathway, and leads to the inhibition of MLC phosphatase (MLCP). Rho-kinase inhibits MLCP activity by phosphorylating the myosin-binding subunit (MYPT1) of the MLCP. Alternatively, CPI-17 phosphorylation also results in an inhibition of the MLCP activity, which in turn maintains steadystate tension in ASM (8, 9). In contrast, CPI-17 dephosphorylation facilitates relaxation. Several reports have shown that the activation of the Rho kinase pathway may play key roles in promoting a hypercontractile ASM phenotype (10). Differences in ASM contractility involve a modulation of Ca 21 sensitivity of the contractile apparatus, due to an increase in phosphorylation levels of MYPT1, MLC, and tone (1, 11, 12). Other studies have described the activation of RhoA Rho kinase pathway by a variety of cytokines associated with the development of AHR (13, 14). However, in human bronchi, the specific role of PKC/ CPI-17 pathway in AHR has never been shown and remains unclear. In human lung, TNF-a is a proinflammatory cytokine that has been implicated in the airway pathologies, such as asthma (15, 16). TNF-a mrna and protein were increased in the airways from patients with asthma. Moreover, the administration of inhaled recombinant TNF-a to normal subjects led to the development of inflammatory responses and AHR (16). However, the precise biochemical mechanism behind this process has not been fully elucidated. In this study, TNF-a pretreatments were used to induce a hyperresponsiveness, which included hyperreactivity and Ca 21 hypersensitivity, in a model of human bronchi. Recently, our laboratory has developed an organ culture model to study the physiologic properties and intracellular processes triggered by TNF-a, which lead to an enhanced Ca 21 sensitivity in human bronchi (17). The goal of the present study was to assess the role of CPI-17 as a regulatory protein in untreated bronchi (control condition) and in a model of AHR using TNF-a treated human bronchi and specific sirna against hcpi-17 transcripts. We report herein that a reduction in specific mrna and protein expression can be achieved by the use of hcpi-17 sirna duplexes in reversible permeabilized bronchial explants. We also demonstrate that silencing CPI-17 significantly decreases the pharmacologic reactivity and Ca 21 -sensitivity in untreated (control) and TNF-a treated human bronchi.

2 Rapid Communication 639 MATERIALS AND METHODS Isolation and Organ Culture of Human Bronchi The study was approved by our institution s Ethics Committee (Protocol number CRC S1). Human lung tissues were obtained from 15 patients undergoing surgery for lung carcinoma. After lobectomy and transport in sterile physiologic saline solution, lung samples, distant from the malignant lesion, were dissected by the pathologist. The absence of tumoral infiltration was retrospectively established in all bronchi by pathologic analysis. Tissue samples were immediately placed in Krebs solution. Paired rings of similar weight and length (inner diameter of mm) were microdissected from the same bronchial segment, and bronchial rings were placed into individual wells of 24-well culture plates containing DMEM-F12 culture medium (1 ml/well) and maintained in culture in a humidified incubator at 378C under 5% CO 2 (18). Explants were either untreated (control) or treated with 10 ng/ml TNF-a for 2 days. In some experiments, bronchial explants were treated with 10 ng/ml TNF-a combined with 100 nm 14,15-Epoxyeicosatrienoic acid (14,15-EET) before pharmacologic or Ca 21 challenges. Reversible Permeabilization and sirna Transfection Down-regulation of CPI-17 expression in isolated human bronchi was accomplished by designing a CPI-17 sirna duplex complementary to human CPI-17 mrna. The CPI-17 sirna sequence used for these studies was 59-GAAACCTGTCGAGGACTTCAT-39. Transfection efficiency was determined by control micro-spectrofluorimetry experiments using a nonsilencing sirna tagged with rhodamine at the 39- end. All primers and sirna were obtained from Invitrogen, Inc. (Carlsbad, CA). Silencing RNA duplexes complexed to X-TremeGene were introduced into intact bronchi using a reversible permeabilization procedure as previously described (19, 20). The X-TremeGene (X-TG) transfection reagent, coupled to various sirna (Roche Diagnostics, Laval, PQ, Canada) was successfully used to transfect ASM cells (21). After reversible permeabilization and transfection, control or TNF-a treated bronchi were cultured for 48 hours in DMEM/F-12 medium to allow CPI-17 silencing. RT-PCR and Specific Fragment Detections Total RNA was extracted from 48-hour cultured human bronchi using the Qiagen RNeasy Mini Kit (Qiagen, Mississauga, ON, Canada), according to the manufacturer s instructions. A total of 350 ng total RNA was reverse-transcribed into cdna with a Qiagen Omniscript RT kit (Qiagen Canada) according to the manufacturer s instructions. Primer sequences used for detection of human transcripts were as follows. CPI-17: forward, CTGAGCAAGCTGCAGTCTCCA; reverse, CTTATACACAAGCAAGCTGGGCGG. GAPDH: forward, GTGGTCTCCTCTGACTTCAAC; reverse, GCTGTAGCCAAATT CGTTGTC, respectively. Aliquots of the reverse-transcribed cdna were then amplified by PCR reactions (35 cycles) (21). After PCR, the samples were migrated for 75 minutes on a 1% agar gel 1 ethydium bromide, and images acquired using a Multi-imager system, under ultraviolet light. SDS-PAGE and Western Blot Analysis For SDS-PAGE, protein samples (20 mg of protein/well) from homogenate fractions were separated on 12% SDS-PAGE, using a 3% stacking gel and cast into a mini-protean III dual cell (Bio-Rad, Mississauga, ON, Canada). Western blots using specific antibodies against CPI-17, its phosphorylated form (Anti P-CPI-17), MLC phosphorylated form, and b-actin proteins were performed as previously reported (17). Immunostainings were digitized and analyzed with Lab-Image software v2.7 2 (Kaplan GmbH, Germany). Isometric Tension Measurements and b-escin Permeabilization Bronchial rings were mounted in isolated organ baths containing 6 ml of Krebs solution at 378C, bubbled continuously with a 95% O 2 /5% CO 2 gas mixture, to which an initial load of 0.8 g was applied. Passive and active tensions were assessed using an FT03 Grass transducer system coupled to Polyview software (Grass-Astro-Med, Inc., West Warwick, RI) (18). Measurement of myofilament Ca 21 sensitivity was performed as previously reported (18). Briefly, bronchial rings were mounted in organ baths and incubated in low free Ca 21 relaxing solution containing (mm): 87 KCl, 5.1 MgCl 2, 5.2 NaATP, 10 creatine phosphate, 2 EGTA, and 30 PIPES, brought to ph 7.1 with KOH, at 228C, followed by treatment with 50 mm b-escin to permeabilize surface membrane in the relaxing solution for 35 minutes at 228C. Ca 21 stores were depleted by addition of 10 mm A Tension developed by permeabilized bronchial rings was measured in activating solutions, containing 5 mm EGTA, 1 mm calmodulin, and precalibrated amounts of CaCl 2 to yield the desired free Ca 21 concentration, expressed as pca 52log [Ca 21 ] (18). Data Analysis and Statistics Results are expressed as means 6 SEM; n indicates the number of experiments. Statistical analyses were performed using a Student t test or a one-way ANOVA. Differences were considered statistically significant when P, Data curve fittings were performed using Sigma Plot 10.0 (SPSS-Science, Chicago, IL) to determine EC 50 values. RESULTS CPI-17 Silencing in Reversible Permeabilized Human Bronchi After isolation of human bronchi from lung samples, control reversible permeabilization and transfections were performed using Rhodamine-tagged sirna to evaluate location and transfection efficiency (21). Optical and spectro-fluoro microscopy were performed to compare fluorescence levels in conjunction with DAPI-stained nuclear chromatin (Figure 1A, left panel). After reversible permeabilization, isolated bronchi maintained a typical phenotype as described previously for cerebral arteries (20). To optimize transfections, isolated bronchi were transfected with either X-Treme Gene (X-TG) or X-TG 1 nonsilencing fluorescent RNA duplexes. Fluorescence was mainly localized in the epithelial and bronchial smooth muscle layers (Figure 1, middle and right panels). RT-PCR experiments were then performed to assess the effects of a specific sirna designed against human CPI-17 transcripts using specific sense and antisense primers, on distinct bronchial preparations (21). After separation of RT-PCR reaction products on agarose gels, image analysis revealed a 91% reduction in CPI-17 transcript levels in reversible permeabilized bronchi transfected with X-TG 1 sirna complexes compared with corresponding control or X-TG treated tissues (Figure 1B). Controls performed with GAPDH primers demonstrated a steady-state expression level of this housekeeping gene transcript among the different preparations (Figure 1B). Western blot analysis performed on bronchi homogenates revealed a significant decrease in CPI-17 protein expression in transfected CPI-17 sirna-x-tg bronchi, compared with control or X-TG treated bronchi (Figure 1C). b-actin antibodies revealed no staining differences between the various tissue samples. Quantification of relative detection levels confirmed the lower expression level of total CPI-17 protein after specific sirna transfection (Figure 1D). CPI-17 Silencing Reduces Airway Responsiveness In a previous report, we had shown that TNF-a pretreatment (10 ng/ml) induced an overreactivity to contractile agonist while reducing the relaxing properties to b 2 -agonist in short-term cultured human bronchi (17). Herein, the mechanical properties of untreated (RP control) and TNF-a treated bronchi transfected (or not) with hcpi-17 sirna, challenged with methacholine (MCh), were investigated. Figure 2A illustrates cumulative concentration response curves (CCRC) to MCh, from reversible permeabilized bronchi in control (untreated) and in TNFa treated explants. In both cases, the reactivity and sensitivity to MCh were significantly reduced in hcpi-17 sirna transfected bronchi. While TNF-a consistently induced a hyperresponsiveness to MCh with an apparent EC 50 value of 0.32 mm,

3 640 AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL Figure 1. CPI-17 silencing using reversible permeabilized human bronchi coupled to sirna XtremeGene complexes. (A) Fluorescence microscopy of thin cryosections (10 mm) was performed on reversible permeabilized bronchi transfected with nonsilencing Rhodaminetagged RNA. Isolated human bronchi exhibited typical phenotype, with fluorescence localized in the epithelial and airway smooth muscle layers. Scale bar mm. (B) RT-PCR analysis performed on control (lane 1), reversible permeabilized (lane 2), and reversible permeabilized 1 hcpi-17 sirna transfected bronchi (lane 3). Note that detection of CPI-17 fragments was only reduced upon sirna transfection. Primers against human CPI-17 and GAPDH sequences were used as defined in MATERIALS AND METHODS. This result is representative of seven similar experiments. (C) Western blot analysis performed in three distinct homogenates were stained using specific antibodies against CPI-17 of 22 kd and b-actin (42 kd). Note the reduced staining of CPI-17 bands in the reversible permeabilized 1 sirna-transfected bronchi (third lane). b-actin staining was constant in all three homogenates. (D) Quantitative analysis of various CPI-17/bactin density ratios. Significant differences were observed between reversible permeabilized samples and reversible permeabilized 1 sirna-transfected bronchi. Results are representative of six similar experiments (* P, 0.05). transfection with hcpi-17 sirna X-TG complexes significantly reduced this TNF-a induced reactivity (Figure 2A, open triangles). The apparent EC 50 value (1 mm) for MCh in hcpi-17 sirna X-TG transfected TNF-a treated bronchi was shifted toward control values (1 mm), with a significant decrease in maximum tension. The relaxing properties to isoproterenol (a b 2 -agonist) were also determined for the same experimental conditions. A slight but significant difference was observed in the relaxing responses recorded from untreated bronchi transfected with hcpi-17 sirna when compared with RP control tissue responses. Moreover, TNF-a treated bronchi transfected with hcpi-17 sirna X-TG complexes revealed that the relaxing responses to the b 2 -agonist were increased when compared with TNF-a treated bronchi (Figure 2B, open triangles/open circles). Together, these results show that CPI-17 silencing in untreated and TNF-a treated bronchi reduces the reactivity of human bronchial smooth muscle to MCh and increases the relaxing response of the explants to b 2 -agonist. CPI-17 Silencing Reduces TNF-a Induced Calcium Hypersensitivity Comparative analyses were performed on b-escin permeabilized preparations to assess the effect of CPI-17 silencing on Ca 21 sensitivity of control and TNF-a pretreated bronchi. Figure 3A shows that CCRC to free Ca 21 concentrations on cultured (control) and reverse-permeabilized rings (RP) in the presence of the transfectant (X-TG) were superimposed, while in the hcpi- 17 sirna X-TG transfected bronchi the Ca 21 sensitivity was reduced, with a shift in EC 50 values toward higher Ca 21 concentrations: 1.96 mm comparedwith0.38mm in the controls (Figure 3A). Figure 3B shows typical superimposed recordings induced by cumulative free [Ca 21 ]incrementsonb-escin permeabilized bronchial rings in control, TNF-a treated bronchi, and TNF-a

4 Rapid Communication 641 treated bronchi transfected with hcpi-17 sirna duplexes. Transfected TNF-a treated bronchi displayed a marked inhibitory effect on Ca 21 -dependent tension developed by TNF-a treated bronchi only. CCRC to free Ca 21 concentrations on b-escin permeabilized bronchial rings obtained from either TNF-a treated bronchi, TNF-a 1100 nm 14,15-EET treated tissues, or transfected TNF-a treated bronchi in the absence or presence of 100 nm 14,15-EET are shown in Figure 3C. Data analysis demonstrates that TNF-a treated bronchi transfected with hcpi-17 sirna duplexes yielded a significant rightward shift in CCRC and apparent EC 50 value toward higher Ca 21 concentrations, thus attesting to a reduced Ca 21 sensitivity compared with the control response developed upon TNF-a treated only (Figure 3C, solid circles). In a previous report we have demonstrated that an eicosanoid such as 14,15-EET fully inhibits the CPI-17 related Ca 21 sensitivity in human bronchial smooth muscle (15). In the present work, we show that in 14,15-EET treated bronchi (even in the hcpi-17 sirna transfected tissues), Ca 21 response curves were both further shifted toward the left, with no differences observed between these two conditions (which is not surprising, since 14,15- EET abolished the CPI-17 dependent responses) (17). CPI-17 Silencing Reduces the Level of MYPT1 Phosphorylation in TNF-a Treated Bronchi Figure 2. CPI-17 silencing reverses the effects of TNF-a treatments by pharmacologic challenges in human bronchi. (A) Cumulative concentration response curves (CCRC) to MCh generated from reversible permeabilized (RP) untreated (control), RP 1 sirnatransfected bronchi, and RP 1 TNF-a treated bronchi, as well as in RP 1 TNF-a treatedandsirna-transfected tissue. (B) Quantitative analysis of the relaxing responses induced by cumulative concentrations of isoproterenol in RP (control), RP 1 CPI-17 sirnatransfected bronchi, RP 1 TNF-a treated bronchi, and RP 1 TNF-a treated and CPI-17 sirna-transfected bronchi. Each point represents the mean 6 SEM, with n5 16for each experimental condition (* P, 0.05). The regulatory status of the CPI-17 protein was assessed in the current bronchial inflammatory model by evaluating the phosphorylated form of MYPT1 (P-MYPT1) and MLC (MCL-P) in untransfected and hcpi-17 sirna transfected bronchi explants. Reverse-permeabilized and sirna-transfected explants were cultured in the absence (control) or presence of either TNF-a alone or TNF-a 1100 nm 14,15-EET. Western blot analysis of homogenates derived from these preparations revealed that CPI- 17 was present in all tested fractions; although TNF-a treatment increased the density of the 22-kD protein band corresponding to total CPI-17, it also increased the phosphorylation level of 17-, 36-, and 140-kD protein bands, corresponding to P-CPI-17, P-MLC, and P-MYPT1, respectively (Figure 4A). In contrast, phosphorylated MYPT1 and MLC were significantly reduced in tissues transfected with hcpi-17 sirna duplexes compared with control bronchi and TNF-a treated explants. Moreover, the MYPT1 and MLC phosphorylated forms were reduced upon 14,15-EET treatment (Figure 4A, third lane) and essentially normalized when compared with non-treated controls (Figure 4A, first lane). As can be seen, b-actin immunostaining was relatively constant from one condition to the other (Figure 4A). Quantitative analysis of identical immunoblot membrane areas were then normalized as a function of total b-actin staining in the corresponding fractions. Figure 4B shows that TNF-a treated bronchi transfected with either hcpi-17 sirna or treated with 100 nm 14,15-EET largely reduced P-MYPT1/b-actin density ratio, when compared with that of TNF-a treated bronchi (Figure 4B). Moreover, no difference was observed between sirna transfected and TNF-a 1EET treated bronchial explants. Nervertheless, silencing CPI-17 in RP preparations induced a lower MYPT1/b-actin ratio when compared with the ratio in control (RP) tissues. DISCUSSION Figure 3. CPI-17 silencing reduces TNF-a-induced Ca 21 hypersensitivity. (A) CCRC to free [Ca 21 ] obtained from b-escin permeabilized bronchial rings in control conditions, after RP and transfectant addition, as well as RP and CPI-17 sirna-transfected bronchi (n 5 18). (B)Representative superimposed recordings illustrating the tension induced by cumulative increases in [Ca 21 ]on b-escin permeabilized control (light gray line)andtnf- a treated bronchi, either in the absence (black line) or presence of hcpi-17 sirna transfection (dark gray line). (C) CCRC to free [Ca 21 ] obtained from various experimental conditions in (1) TNF-a treated bronchi for 48 hours (solid circles); (2) TNF-a treated bronchi in the presence of 100 nm 14,15-EET added every 12 hours, for 48 hours (open squares); (3) TNF-a treated bronchi and hcpi-17 sirna transfected (open triangles); or (4) TNF-a treated bronchi and hcpi-17 sirna transfected in the presence of EET (solid triangles), n All preparations tested for Ca 21 sensitivity were permeabilized with b-escin, as previously described (15). This is the first study demonstrating the validity of a mixed transfection strategy involving reversible permeabilization and

5 642 AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL concomitant transfection with hcpi-17 sirna X-TG complexes to facilitate in vitro sirna transfection of human lung tissues. This valuable approach to study the role of CPI-17 in a hyperresponsive model of human bronchi, treated (or not) with TNF-a, also provides an elegant strategy for investigating the key role of specific gene transcripts on functional and electrophysiologic properties in these tissues, for which no specific antagonists are yet available. The data reported herein also demonstrate that reductions in CPI-17 mrna transcript and in protein expression can be achieved by the use of specific hcpi-17 sirna X-TG complexes in bronchial explants. Moreover, we demonstrate that silencing hcpi-17 decreases the pharmacologic reactivity and Ca 21 sensitivity of airway smooth muscles in control and proinflammatory conditions. CPI-17 Silencing Decreases Reactivity in Untreated and TNF-a Treated Bronchi Bronchial inflammation plays a key role in the pathogenesis of asthma and COPD (15). Pharmacologic evidence has also pointed toward an important role of TNF-a in AHR (16). CPI-17 has been reported to be a PKC-dependent regulatory protein and, in its phosphorylated form (P-CPI-17), displays an inhibitory effect on MLCP, which in turn maintains ASM tone (7). Previous studies have shown that TNF-a treatment of rat and mouse airways induce an increased reactivity of smooth muscle cells to various agonists (12, 14). Moreover, we have recently reported that TNF-a (10 ng/ml) treatment induces a hyperreactivity to several pharmacologic agonists in shortterm cultured human bronchi (17). In contrast, concentrationdependent isoproterenol relaxations were reduced in TNF-a stimulated bronchi, much like in airways of patients with asthma(1, 16). The present study shows that transfection with hcpi-17 sirna in reversible permeabilized and TNF-a treated bronchi significantly reduced the reactivity of bronchial smooth muscle to muscarinic agonist subjected to the same resting tone (0.8 g). It has been suggested that, in rat airways, the enhanced activation of CPI-17 was responsible for the amplified agonistinduced contraction of airway smooth muscle (17, 22). In contrast, the relaxing responses herein to b 2 -agonist in TNFa treated bronchi transfected with hcpi-17 sirna duplexes were increased compared with control responses in TNF-a treated bronchi alone. Moreover, PKC activation has previously been reported to contribute to the reduced b-adrenergic relaxing responses in ASM (23 25). Despite the fact that other proteins might be involved in the regulation of CPI-17 phosphorylation, our current data strongly suggest that the CPI-17 pathway may be an important signaling mechanism that impairs the relaxation to b-adrenergic agonists in this hyperresponsive model of human bronchi. Since many mediators and neurotransmitters in allergic airway inflammation can activate PKC, and other regulatory proteins, CPI-17 could represent the missing link in explaining the reduced bronchodilator response in patients with severe asthma, due to negative regulation of MLCP activity (1, 25). This issue would be consistent with MYPT1 and MLC phosphorylation levels, as observed upon CPI-17 inactivation by either 14,15-EET treatments (17) or CPI-17 silencing (Figure 4A). CPI-17 Silencing Decreases Ca 21 Sensitivity in Normal and Hyperresponsive Bronchi Several studies have suggested that Ca 21 sensitizing mechanisms could be primed under pathophysiologic conditions by various cytokines and lipid mediators (12, 14, 26). Based on evidence provided in the literature and despite the fact that the involvement of alternative mechanisms cannot be ruled out, CPI-17 is a likely Figure 4. CPI-17 silencing reduces MYPT1 phosphorylation in TNF-a treated bronchi and EET treatment. (A) Protein fractions derived from tissue homogenates were stained using specific antibodies against CPI- 17, P-CPI-17, P-MYPT1, P-MLC and b-actin. Note the very low staining level of the phosphorylated forms of CPI-17 and MYPT1 bands in TNFa treated and hcpi-17 sirna transfected preparations, while positive staining was consistently detected in control conditions (lane 1) and TNF-a treated tissues (lane 2). (B) Quantitative analysis of various P-MYPT1/b-actin density ratios. Significant differences were observed between hcpi-17 sirna transfected bronchi and EET-treated explants versus TNF-a treated tissues alone. Results are representative of six similar experiments (*P, 0.05). candidate in modulating myofilament Ca 21 sensitivity (7, 22). We had already shown that 14,15-EET decreases Ca 21 sensitivity through reduction of CPI-17 expression level in TNF-a treated human bronchi (17). In the present study, hcpi-17 sirna transfection decreased the Ca 21 sensitivity triggered in TNF-a treated bronchi. Moreover, Western blot analysis performed on homogenates derived from TNF-a treated bronchi transfected with hcpi-17 sirna demonstrated a decrease in MYPT1 and MLC phosphorylation levels. These results were further supported by a decrease in CPI-17 transcript levels in preparations treated with

6 Rapid Communication 643 TNF-a and EET (17). In a previous report, Sakai and coworkers (22) demonstrated an increase in the expression and activation of CPI-17 in hyperresponsive ASM from rodents, which in turn may be responsible for enhanced ACh-induced Ca 21 sensitization of bronchial contraction associated with AHR. In summary, the current study provides new evidence that reversible permeabilization is a feasible approach for transfecting specific sirna X-TG complexes and ultimately studying the role of key regulatory proteins such as CPI-17 in hyperresponsive human bronchi. Taken together, our results are consistent with previously published data (17); moreover, they ascertain the molecular role of CPI-17 in normal and airway hyperresponsiveness developed by human bronchi in vitro. Such a role could be of key relevance in elucidating the intracellular and molecular mechanisms responsible for the hyperresponsiveness observed in respiratory pathologies involving cytokine release and inflammation, such asthma (16) and COPD. Moreover, the comparison of results obtained with CPI-17 silencing and 14,15-EET treatments in hyperresponsive human bronchi could further justify the potential use of such eicosanoids as new and prospective relaxing and antiinflammatory pharmacologic agents. Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript. Acknowledgments: The authors thank Ms. C. Verreault for technical assistance, as well as Dr. Marcio M. Gomes and the members of the pathology laboratory for their technical support. They also thank Mr. Pierre Pothier for critical review of the manuscript. References 1. Amrani Y, Tliba O, Deshpande DA, Walseth TF, Kannan MS, Panettieri RA. Bronchial hyperresponsiveness: insights into new signaling molecules. Curr Opin Pharmacol 2004;4: Boushey HA, Holtzman MJ, Sheller JR, Nadel JA. Bronchial hyperreactivity. Am Rev Respir Dis 1980;121: Mitzner W, Brown RH. Potential mechanism of hyperresponsive airways. Am J Respir Crit Care Med 2000;161: Hargreave FE, Dolovich J, O Byrne PM, Ramsdale EH, Daniel EE. The origin of airway hyperresponsiveness. J Allergy Clin Immunol 1986; 78: Janssen LJ. Calcium handling in airway smooth muscle: mechanisms and therapeutic implications. Can Respir J 1998;5: Somlyo AP, Somlyo AV. Signal transduction by G-protein, rho-kinase and protein phosphatase to smooth muscle and non-muscle myosin II. J Physiol 2000;522: Somlyo AP, Somlyo AV. Ca21 sensitivity of smooth muscle and nonmuscle myosin II: modulated by G proteins, kinases, and myosin phosphatase. Physiol Rev 2003;83: Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B, Feng J, Nakano T, Okawa K, et al. Regulation of myosin phosphatase by Rho and Rho-associated kinase. Science 1996; 273: Shirazi A, Iizuka K, Fadden P, Mosse C, Somlyo AP, Somlyo AV, Haystead TA. Purification and characterization of the mammalian myosin light chain phosphatase holoenzyme: the differential effects of the holoenzyme and its subunits on smooth muscle. J Biol Chem 1994; 269: Takata Y, Nishimura Y, Maeda H, Yokoyama M. Phospholipase A2 augments contraction and intracellular calcium mobilization through thromboxane A2 in bovine tracheal smooth muscle. Eur Respir J 1999;14: Billington CK, Penn RB. Signaling and regulation of G protein-coupled receptors in airway smooth muscle. Respir Res 2003;4: Hunter I, Cobban HJ, Vandenabeele P, MacEwan DJ, Nixon GF. TNFa-induced activation of RhoA in airway smooth muscle cells: role in the Ca 21 sensitization of myosin light chain20 phosphorylation. Mol Pharmacol 2003;63: Chiba Y, Misawa M. The role of RhoA-mediated Ca 21 sensitization of bronchial smooth muscle contraction in airway hyperresponsiveness. J Smooth Muscle Res 2004;40: Sakai H, Otogoto S, Chiba Y, Abe K, Misawa M. Involvement of p42/44 MAPK and RhoA protein in augmentation of ACh-induced bronchial smooth muscle contraction by TNF-alpha in rats. J Appl Physiol 2004;97: Léguillette R, Lauzon AM. Molecular mechanics of smooth muscle contractile proteins in airway hyperresponsiveness and asthma. Proc Am Thorac Soc 2008;5: Brightling C, Berry M, Amrani Y. Targeting TNF-alpha: a novel therapeutic approach for asthma. J Allergy Clin Immunol 2008;121: Morin C, Sirois M, Echave V, Gomes MM, Rousseau E. EET displays anti-inflammatory effects in TNF-alpha stimulated human bronchi: putative role of CPI-17. Am J Respir Cell Mol Biol 2008;38: Morin C, Sirois M, Echave V, Gomes MM, Rousseau E. EET relaxing effects involve BKCa channel activation and CPI-17 dephosphorylation in human bronchi. Am J Respir Cell Mol Biol 2007;36: Lesh RE, Somlyo AP, Owens GK, Somlyo AV. Reversible permeabilization. A novel technique for the intracellular introduction of antisense oligodeoxynucleotides into intact smooth muscle. Circ Res 1995;77: Earley S, Waldron BJ, Brayden JE. Critical role for transient receptor potential channel TRPM4 in myogenic constriction of cerebral arteries. Circ Res 2004;95: Godin N, Rousseau E. TRPC6 silencing in primary airway smooth muscle cells inhibits protein expression without affecting OAGinduced calcium entry. Mol Cell Biochem 2007;296: Sakai H, Chiba Y, Hirano T, Misawa M. Possible involvement of CPI-17 in augmented bronchial smooth muscle contraction in antigeninduced airway hyper-responsive rats. Mol Pharmacol 2005;68: Boterman M, Elzinga CR, Wagemakers D, Eppens PB, Zaagsma J, Meurs H. Potentiation of beta-adrenoceptor function in bovine tracheal smooth muscle by inhibition of protein kinase C. Eur J Pharmacol 2005;516: Boterman M, Smits SR, Meurs H, Zaagsma J. Protein kinase C potentiates homologous desensitization of the beta2-adrenoceptor in bovine tracheal smooth muscle. Eur J Pharmacol 2006;529: Oostendorp J, Obels PP, Terpstra AR, Nelemans SA, Zaagsma J. Modulation of beta2- and beta3-adrenoceptor-mediated relaxation of rat oesophagus smooth muscle by protein kinase C. Eur J Pharmacol 2004;495: Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, Morishita T, Tamakawa H, Yamagami K, Inui J, Maekawa M, et al. Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 1997;389: