Supplementary Figure 1

Size: px
Start display at page:

Download "Supplementary Figure 1"

Transcription

1 Supplementary Figure SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression log2 ratio Expression p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2 in breast cancer and normal tissues. () ioinformatic analysis of data retrieved from GENT ( indicating that both SEM4C and PLXN2 mrn levels are upregulated in human breast cancers (n=2635), compared to normal breast (n=91). Each circle represents an individual sample. The Y-axis indicates expression values normalized to target density of 5 as mentioned in GENT. () Graphical representation of the Log2 ratio between Sema4C levels in matched tumor vs. adjacent normal tissue pairs (n=43), from the analysis of expression dataset GSE15852; p<.1. (C) Graphical representation of normalized Sema4C expression levels in immortalized breast cancer cell lines and non-tumoral cell lines, based on bioinformatic analysis of public dataset ( (D) Kaplan-Meier analysis of overall patient survival (OS; follow-up at 12 years) of unselected breast cancer patients (n=142) correlation to Plexin2 (PLXN2) high and low expression subgroups, based on online dataset analysis (by p=. 75.

2 Supplementary Figure 2 mrn levels (fold change) SEM4C mrn levels (fold change) PLEXIN2 114kDa 45kDa Sema4C ctin 24kDa 45kDa Plexin2 ctin C 14kDa Plexin 2 45kDa ctin D Cell growth (bs 595nm) shcontrol Cell growth (bs 595nm) shcontrol shplexin2-1 shplexin Days Days Supplementary Figure 2. Sema4C/Plexin2 signaling blockade in breast cancer cells causes growth arrest. () qrt-pcr analysis of the mrn expression levels of Sema4C and Plexin2 in cells upon silencing by two different shrns. () Immunoblotting analysis of Sema4C and Plexin2 in gene-silenced cells (same as previous panel); actin provided a protein loading control. (C) Immunoblotting analysis revealing the expression of Plexin2 dominant negative construct (2-DN) in transduced cells, with Plexin2- specific antibodies; actin provided a protein loading control. (D) Cell growth curves of cells transduced with two different shrn constructs targeting Sema4C and Plexin2 (same cells described in panels and ). Data are the mean ± SD from three separate experiments; p<.1.

3 Supplementary Figure 3 MD-M 231 Time: Hours 12 Hours 24 Hours 48 Hours Plexin 2-DN shplexin 2 shcontrol Supplementary Figure 3. Sema4C/Plexin2 signaling blockade impairs tumor cell growth Time-lapse microscopy analysis of MD-M-231 cells subjected to Sema4C or Plexin2 silencing, or expressing the Plexin2 dominant negative construct (2-DN). Representative images are snapshots taken every 12-hour intervals. Scale bar: 1 µm. The full movie is separately provided in Supplemental Material.

4 Supplementary Figure 4 shctrl shctrl MD-M 231 Crystal Violet C shctrl CFSE Dye-Green DID Dye-Red Dapi (Nuclei)-lue D CFSE Dye-Green DID Dye-Red Dapi (Nuclei)-lue E Percentage of cells analyzed (%) multinucleated cells Supplementary Figure 4. Sema4C/Plexin2 signaling blockade causes cytokinesis defects. () right field image of MD-M-231 and cells either subjected to Sema4C silencing or controls. () Microscopy images of MD-M-231 described above stained with crystal violet. Scale bars: 1 μm. (C)Immunofluorescence images of mixed population of MD-M-231 cells labelled with either DID dye(far red) or CFSE(Green) and treated them with shrn(control) and analysed by immunofluorescence for fused multinucleated cells(yellow). Nuclei were stained with DPI.(D) Immunofluorescence images of mixed population of MD-M-231 cells labelled with either DID dye(far red) or CFSE(Green) and subjected to Sema4C-silencing and analysed by immunofluorescence for fused multinucleated cells(yellow). Nuclei were stained with DPI. Images from three representative fields are shown.(e) Quantification of percentage of Sema4C silenced cells which are multinucleated and CFSE positive(green) or DID positive(far red), or fused (Yellow); n>5 cells in three independent experiments.scale bar: 1 µm.

5 Supplementary Figure 5 MD-M 231 shctrl shplxn2 Plexin2-DN Invasion Migration Supplementary Figure 5. Sema4C/Plexin2 signaling blockade impairs migration and invasion. Representative images of Transwell assays assessing the migration and matrix invasion of MD-M- 231 cells subjected to Sema4C or Plexin2 silencing, or expressing Plexin2-DN, compared to shctrl cells. Magnification: 1x.

6 Supplementary Figure 6 P21 DPI P53 DPI H1152 DMSO Supplementary Figure 6. Rho-kinase inhibition promotes nuclear accumulation of p21 and p53 tumor suppressor proteins in cells. Representative images of immunofluorescence analysis of p21 and p53 tumor suppressor proteins distribution (in green) in cells treated with Rho-dependent kinase inhibitor H1152 (2μm) or DMSO-vehicle for 5 days. Nuclei are stained with DPI (blue). Scale bar: 1 µm.

7 Supplementary Figure 7 mrn levels (Fold Change) Plxn2 24kDa 45kDa Plexin2 ctin C IP-Erb2 IP-Erb2 185kDa I-P-Erb2 185kDa I-P-Erb2 185kDa I-Erb2 185kDa I-Erb2 24kDa I-Plexin 2 24kDa I-Plexin 2 Supplementary Figure 7. Enhanced Sema4C signaling promotes Erb2 phosphorylation. ()Graphic representation of the fold change in mrn levels of Plexin 2 in cells stably expressing Sema4C-secr, compared to control cells, as determined by qrt PCR analysis and Western blot analysis of Plexin2 expression in cells stably overexpressing Sema4C-secr or Mock; ctin served as protein loading control.() cells were treated with the indicated concentrations of recombinant Sema4C or mock, for 2 minutes and protein lysates were immunopurified with anti-erb2 antibody, followed by immunoblotting to reveal tyrosine phosphorylation and interaction with Plexin 2; total Erb2 staining provided an internal reference.(c) Protein lysates of cells stably expressing Sema4C-secr or Mock were immunopurified with anti-erb2 antibody, followed by immunoblotting to reveal tyrosine phosphorylation and interaction with Plexin 2; total Erb2 staining provided an internal reference.

8 Supplementary Figure 8 MOCK Sema4C-secr MOCK Sema4C-secr Y DMSO E-Cadherin eta-catenin Mock +DMSO Sema4C-secr +DMSO Sema4C-secr +Y Relative Migration (fold change) Sema4C Y Supplementary Figure 8. Phenotypic reversion of Sema4C-overexpressing cells upon inhibition of Rho- or Erb2-signaling. () Representative immunofluorescence images showing the distribution of E-cadherin or eta-catenin (in green) in MCF7 cells overexpressing Sema4C (or mock), treated for 24 hours with Rho-kinase inhibitor (Y , 1μM), or DMSO. Nuclei were stained with DPI. Scale bar: 1 µm. () Transwell assays assessing the migration of cells stably expressing Sema4C (or mock), treated with Rho-kinase inhibitor Y (1μM) or DMSO. Quantification of migration (fold changes) is shown on the right; data are the mean ± SD from three independent experiments; p<.1. Magnification: 1x.

9 Supplementary Figure 9 ER positive patients Supplementary Figure 9. High Sema4C expression is associated with poor relapse-free survival in estrogen receptor positive breast cancer patients. ()Kaplan-Meier analysis of relapse-free survival (OS; follow-up at 12 years) of estrogen receptor positive (ER+) patients (n=1983) correlation to Sema4C high and low expression subgroups, based on online dataset analysis (by p=.74.

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

More information

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Expanded View Figures

Expanded View Figures Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and

More information

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn- Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEENTRY INFORTION DOI: 1.138/ncb2577 Early Telophase Late Telophase B icrotubules within the ICB (percent of total cells in telophase) D G ultinucleate cells (% total) 8 6 4 2 2 15 1 5 T without gaps

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 ZV 50 nm Relative to Protein Levels () C Relative to Protein Levels () 6 4 2 0 10 8 6 4 2 0 Treatment Time (6 h) ZV Concentration (25 µm) ZV Concentration (25 µm) Supplementary Figure

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its

Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its Supplementary Information Dramatic increase in SHP2 binding activity of Helicobacter pylori Western CagA by EPIYA-C duplication: its implications in gastric carcinogenesis Lisa Nagase, Takeru Hayashi,

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Expanded View Figures

Expanded View Figures MO reports PR3 dephosphorylates TZ Xian-o Lv et al xpanded View igures igure V1. PR3 dephosphorylates and inactivates YP/TZ., Overexpression of tight junction proteins Pals1 () or LIN7 () has no effect

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human

Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence. Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna

More information

Supplementary Figures for

Supplementary Figures for mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,

More information

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).

More information

Supplemental Figures

Supplemental Figures Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas; SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10

More information

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Prolonged mitotic arrest induces a caspase-dependent DNA damage SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

Supplementary Material

Supplementary Material Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Hunk is required for HER2/neu-induced mammary tumorigenesis

Hunk is required for HER2/neu-induced mammary tumorigenesis Research article Hunk is required for HER2/neu-induced mammary tumorigenesis Elizabeth S. Yeh, 1 Thomas W. Yang, 1 Jason J. Jung, 1 Heather P. Gardner, 1 Robert D. Cardiff, 2 and Lewis A. Chodosh 1 1 Department

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure

More information

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table. Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:

More information

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to

More information

Supplemental Materials Molecular Biology of the Cell

Supplemental Materials Molecular Biology of the Cell Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).

More information