Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.

Size: px
Start display at page:

Download "Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency."

Transcription

1 Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or four nuclei (multinucleated) across 120 HMDP mouse strains. P = 1.1 x See Supplementary Table 1 for a full list of strains and values. (be) Left ventricular anterior wall thickness (mm) (b), stroke volume (μl) (c), left ventricular systolic volume (μl) (d), and left ventricular diastolic volume (μl) (e) at baseline, 3 days and 1 month after injury. Strain A (n = 5), SWR (n = 8), C57Bl/6 (n = 4), and SJL (n = 7). *P < 0.05; #P < 0.01; ##P < Complete statistics for echocardiography parameters can be found in Supplementary Table 3. (f) Example image of trichrome stain at mid-papillary view 1 month after injury. Right panel is a digital cut-out of the left ventricle with the blue scar selected (yellow outline) by the color thresholding in FIJI imaging software. Scale bar represents 1 mm. (g) Orthogonal view of a confocal z-stack showing a cardiac Troponin C (ctnc, green), phospho-histone H3 (phh3, red) cardiomyocyte (white arrowhead). Scale bar represents 20 μm. (h) Quantification of percent of phh3+ CM nuclei in the infarction border zone of the left ventricle for strain A (n = 3) and C57Bl/6 (n = 3) mice. P value is a two-tailed Student t-test. All error bars represent s.e.m.

2 Supplementary Figure 2 Relationships of Tnni3k to mononuclear cardiomyocyte frequency.

3 (a) Dot plot of 120 HMDP strains distributed across three alleles of Tnni3k. Allele 1 is a C at rs resulting in a splice mutation and reduced expression (n = 60 strains). Allele 2 is a T at rs with wild-type expression (n = 56 strains). Allele 3 is T at rs but has a separate polymorphism that results in reduced expression (see main text) (n = 4 strains). (b) Western blot for Tnni3k across 4 strains of the HMDP. C57Bl/6 has allele 2, A has allele 1, and SJL and SWR both have allele 3. (c-f) Ejection fraction (c), stroke volume (d), left ventricular wall thickness (e), and left ventricular volume in diastole and systole (f) measured by echocardiography on Tnni3k knockout (KO, n = 5) and wild-type (WT, n = 5) mice at baseline, 3 days post coronary artery ligation and 28 days post ligation. (g) Confocal image of WGA stain (green) and cardiomyocyte autofluorescence (red). Scale bar represents 50 μm. (h) Quantification of the average cardiomyocyte area at one month post-infarction in WT (n = 6) and KO (n = 7) animals. (i) Quantification of the scar area 1 month after injury represented as a percent of the total left ventricle in WT (n = 6) and KO (n = 7) animals. (j) RT-PCR for mouse Tnni3k, zebrafish tnni3k and zebrafish eef1g in mouse heart and control and Tnni3k transgenic fish. (k) Western blot for Tnni3k in C57Bl/6 mice across developmental ages. Error bars are s.e.m.

4 Supplementary Table Strains of the Hybrid Mouse Diversity Panel. # on Strain N Average Biological Replicates Average SEM Fig1A %Mono %Multi SEM 1 AXB24/PgnJ % 0.74% 0.83% 3.06% 3.06% 11.38% 1.46% 2 BXD24b/TyJ % 0.19% 2.68% 2.29% 7.00% 1.04% 3 BXD31/TyJ % 0.54% 3.67% 2.55% 1.81% 8.76% 2.63% 4 SJL/J % 0.50% 3.66% 1.95% 2.70% 21.48% 2.35% 5 BXD29/TyJ % 1.03% 3.82% 1.77% 10.41% 0.21% 6 BXH6/TyJ % 0.34% 2.86% 2.24% 3.44% 18.01% 1.51% 7 C58/J % 0.60% 3.41% 3.51% 1.66% 9.20% 1.88% 8 BXH8/TyJ % 0.68% 3.33% 3.86% 1.60% 16.53% 1.62% 9 BXA24/PgnJ % 0.38% 3.54% 2.79% 5.34% 1.35% 10 BXD85/RwwJ % 0.04% 3.23% 3.13% 6.10% 1.22% 11 BXA26/PgnJ % 0.85% 2.52% 4.21% 2.97% 0.87% 12 BXD34/TyJ % 0.61% 2.47% 3.26% 4.55% 4.40% 0.36% 13 C57BLKS/J % 0.89% 3.72% 1.76% 4.79% 8.15% 0.96% 14 BTBR T+ tf/j % 0.62% 3.13% 2.55% 4.62% 9.29% 1.76% 15 BXD5/TyJ % 1.01% 2.08% 3.13% 5.49% 9.09% 2.61% 16 MRL/MpJ % 1.30% 2.43% 6.21% 2.17% 5.08% 0.15% 17 BXD75/RwwJ % 0.75% 4.71% 1.49% 4.12% 4.56% 8.46% 1.37% 18 BXD16/TyJ % 0.25% 3.33% 4.21% 3.72% 3.45% 0.71% 19 BXD67/RwwJ % 1.03% 5.19% 2.67% 8.33% 0.09% 20 AXB10/PgnJ % 0.21% 4.19% 3.77% 11.20% 0.50% 21 AXB19/PgnJ % 0.85% 3.39% 4.71% 2.25% 6.18% 9.08% 0.42% 22 BXD96/RwwJ % 0.84% 5.70% 2.67% 2.75% 5.51% 7.57% 0.95% 23 BXH10/TyJ % 0.79% 4.92% 2.70% 5.21% 16.75% 0.33% 24 AXB15/PgnJ % 0.23% 4.66% 3.87% 4.39% 4.01% 0.08% 25 BXA7/PgnJ % 1.44% 2.05% 6.08% 2.56% 10.04% 1.57% 26 BXD18/TyJ % 0.31% 5.04% 4.05% 4.15% 8.72% 2.56% 27 BXH22/KccJ % 0.85% 2.87% 5.76% 4.72% 6.37% 0.32% 28 AXB12/PgnJ % 1.12% 3.33% 5.58% 3.23% 0.64% 29 BXD87/RwwJ % 0.43% 4.39% 5.24% 3.76% 16.02% 3.15% 30 BXD65/RwwJ % 0.27% 4.80% 3.95% 4.72% 8.55% 0.47% 31 BXA14/PgnJ % 0.90% 3.61% 5.41% 9.72% 0.59% 32 SM/J % 0.76% 5.51% 3.65% 6.47% 2.67% 33 BXH9/TyJ % 1.04% 5.47% 2.54% 5.81% 8.10% 2.59% 34 BXD55/RwwJ % 0.78% 5.17% 4.12% 6.45% 2.80% 20.57% 3.49% 35 BUB/BnJ % 0.77% 3.57% 4.41% 6.18% 5.91% 0.84% 36 CXB6/ByJ % 1.42% 3.33% 6.17% 19.98% 4.71% 37 BXD51/RwwJ % 0.23% 4.52% 5.31% 4.76% 6.31% 1.32% 38 AXB19a/PgnJ % 0.33% 5.43% 4.29% 5.00% 10.16% 1.35% 39 FVB/NJ % 0.39% 4.64% 6.08% 4.44% 4.52% 9.52% 1.67% 40 BXD32/TyJ % 0.62% 6.28% 4.48% 4.37% 8.06% 1.22% 41 BXD73/RwwJ % 0.64% 4.70% 6.94% 4.81% 3.95% 22.79% 1.85% 42 BXD2/TyJ % 0.73% 4.38% 5.84% 3.45% 1.41% 43 C57Bl/6J % 0.50% 4.65% 4.49% 6.67% 5.03% 20.28% 5.66% 44 AXB23/PgnJ % 0.29% 5.06% 5.65% 12.13% 1.58% 45 C57L/J % 0.77% 4.15% 5.16% 6.78% 7.73% 1.10% 46 BXD60/RwwJ % 2.51% 2.33% 8.47% 6.90% 13.31% 5.33% 47 SEA/GnJ % 0.61% 4.55% 5.26% 6.61% 5.93% 1.63% 48 BXH4/TyJ % 0.52% 5.58% 6.10% 4.00% 6.28% 15.49% 1.27% 49 BXD14/TyJ % 0.41% 5.62% 6.16% 4.76% 8.24% 1.36% 50 BXD40/TyJ % 0.28% 5.91% 5.78% 5.00% 6.38% 1.70% X1/SvJ % 1.12% 6.42% 6.98% 3.37% 6.04% 0.58% 52 CXB8/HiAJ % 1.20% 6.43% 2.83% 5.05% 9.76% 3.88% 14.47% 2.29% 53 BXH19/TyJ % 1.51% 5.05% 8.53% 3.40% 9.98% 0.57% 54 CXB9/HiAJ % 0.08% 5.74% 5.59% 10.36% 0.52% 55 BXD13/TyJ % 0.44% 6.49% 5.56% 5.00% 0.77% 0.49% 56 BXD6/TyJ % 1.87% 2.08% 3.13% 5.49% 11.19% 1.55% 57 CXB12/HiAJ % 0.23% 5.45% 6.23% 5.63% 6.08% 1.92% 58 Balb/cJ % 0.67% 4.80% 5.68% 7.11% 4.89% 0.58% 59 BXD28/TyJ % 0.55% 6.46% 4.89% 6.61% 4.69% 1.04% 60 KK/HlJ % 0.35% 6.78% 6.02% 5.59% 10.08% 2.67%

5 Supplementary Table 1. Continued # on Strain N Average Biological Replicates Average SEM Fig1A %Mono %Multi SEM 61 BXH7/TyJ % 1.36% 7.00% 7.96% 3.48% 4.91% 0.44% 62 CXB13/HiAJ % 0.30% 5.86% 6.46% 20.42% 0.75% 63 LG/J % 0.47% 6.64% 5.70% 10.26% 0.50% 64 AKR/J % 1.25% 4.88% 4.96% 8.68% 17.72% 1.24% 65 BXD61/RwwJ % 0.89% 4.50% 6.64% 7.49% 4.89% 0.29% 66 BXD68/RwwJ % 1.20% 5.09% 7.49% 3.36% 1.05% 67 LP/J % 0.65% 7.06% 5.75% 3.12% 1.30% 68 BXH20/KccJ % 0.81% 7.26% 5.65% 12.90% 1.61% 69 BXD50/RwwJ % 0.67% 7.59% 6.58% 5.26% 5.22% 1.20% 70 BXD20/TyJ % 0.75% 7.92% 7.42% 6.33% 7.45% 3.77% 13.51% 2.59% 71 BXD48/RwwJ % 0.56% 5.78% 8.00% 7.11% 5.65% 17.52% 3.06% 72 BXA2/PgnJ % 0.65% 6.00% 7.29% 18.38% 0.38% 73 BXA13/PgnJ % 0.34% 7.04% 7.20% 6.10% 9.76% 1.30% 74 BXD42/TyJ % 0.87% 5.49% 6.59% 8.47% 8.33% 1.54% 75 DBA/2J % 0.30% 7.54% 7.20% 6.51% 9.31% 1.16% 76 BXD9/TyJ % 0.90% 8.23% 6.43% 5.74% 1.88% 77 BXD100/RwwJ % 0.78% 6.64% 7.00% 9.13% 9.65% 0.89% 78 AXB1/PgnJ % 0.82% 8.81% 8.17% 6.08% 12.79% 2.22% 79 BXD27/TyJ % 0.26% 7.91% 8.28% 7.37% 4.23% 1.13% 80 NZW/LacJ % 1.18% 6.50% 9.39% 5.91% 0.16% 81 MA/MyJ % 1.10% 8.11% 8.68% 7.39% 5.65% 2.93% 82 BXA11/PgnJ % 0.18% 8.00% 8.44% 3.28% 0.26% 83 CBA/J % 0.24% 8.36% 8.66% 7.84% 7.41% 0.83% 84 BXD38/TyJ % 1.43% 10.93% 8.41% 5.98% 9.38% 1.76% 85 AXB2/PgnJ % 1.08% 8.28% 6.29% 10.65% 11.11% 5.90% 5.24% 1.10% 86 BXD1/TyJ % 1.99% 6.98% 12.50% 6.19% 2.91% 0.63% 87 BXD8/TyJ % 0.56% 9.20% 8.08% 4.03% 1.35% 88 BXA4/PgnJ % 1.19% 6.98% 9.52% 11.64% 6.56% 6.58% 2.29% 89 BXD69/RwwJ % 1.27% 11.34% 7.08% 8.30% 4.47% 0.08% 90 BXA12/PgnJ % 1.40% 6.14% 9.75% 7.55% 12.55% 3.87% 0.45% 91 BXD15/TyJ % 0.91% 7.57% 9.41% 10.71% 5.04% 0.72% 92 Nor/LTJ % 0.10% 9.55% 9.34% 9.67% 7.29% 0.60% 93 NOD/LtJ % 2.20% 6.99% 7.69% 13.92% 3.47% 1.45% 94 BXA25/PgnJ % 0.50% 9.15% 9.58% 8.98% 11.16% 12.74% 1.03% 95 CXB1/ByJ % 0.06% 9.78% 9.90% 4.20% 0.14% 96 RIIIS/J % 0.68% 10.84% 10.55% 9.31% 7.56% 11.34% 4.71% 1.52% 97 BXD39/TyJ % 1.14% 9.01% 12.23% 8.62% 2.17% 1.51% 98 AXB4/PgnJ % 0.26% 9.70% 10.23% 6.82% 1.13% 99 PL/J % 0.67% 9.28% 10.93% 6.40% 0.06% 100 AXB8/PgnJ % 1.33% 13.28% 9.91% 8.02% 10.15% 10.97% 13.24% 2.10% 101 BXH14/TyJ % 1.37% 13.00% 8.26% 10.81% 5.17% 0.68% 102 I/LnJ % 0.54% 9.73% 11.44% 11.22% 4.37% 1.80% 103 C3H/HeJ % 1.05% 13.64% 9.49% 8.98% 11.17% 7.22% 0.81% 104 BXD19/TyJ % 1.86% 7.59% 11.62% 13.94% 4.96% 0.96% 105 BXD21/TyJ % 1.39% 8.24% 16.31% 8.19% 12.98% 13.13% 8.53% 4.89% 0.95% 106 BXD11/TyJ % 1.95% 8.82% 10.14% 15.22% 2.88% 0.97% 107 CXB2/ByJ % 1.41% 11.65% 15.09% 8.28% 10.8% 3.64% 0.76% 108 BXD84/RwwJ % 1.54% 9.93% 13.02% 11.51% 0.92% 109 AXB6/PgnJ % 1.81% 11.98% 8.30% 14.54% 4.51% 0.92% 110 CXB11/HiAJ % 1.66% 9.09% 14.79% 11.30% 1.16% 0.20% 111 CE/J % 0.96% 13.23% 10.00% 12.37% 6.81% 0.70% 112 BXA16/PgnJ % 1.12% 13.64% 11.64% 10.51% 7.64% 1.71% 113 BXA8/PgnJ % 0.29% 12.55% 11.97% 4.32% 1.75% 114 AXB13/PgnJ % 3.59% 9.09% 16.28% 4.31% 1.98% 115 BXA1/PgnJ % 1.30% 11.63% 13.29% 17.92% 14.21% 9.34% 11.72% 8.17% 2.08% 116 Balb/cByJ % 1.48% 15.69% 16.88% 10.13% 13.40% 9.15% 1.93% 117 BXD12/TyJ % 2.84% 20.00% 11.16% 11.83% 3.23% 0.72% 118 AXB5/PgnJ % 0.18% 14.58% 14.13% 1.41% 0.58% 119 SWR/J % 1.14% 12.22% 17.54% 15.72% 16.33% 4.33% 1.42% 120 A/J % 1.98% 15.87% 12.92% 25.21% 13.93% 13.82% 9.38% 22.43% 22.22% 8.20% 1.43%

6 Supplementary Table 2. Statistics for Figure 1F. Ejection Fraction across 4 strains. ANOVA - Repeated Measures: P-value (interstrain): P = 0.11 P-value (intrastrain*day): P < INTERSTRAIN VARIATION: ANOVA - Baseline P = 0.94 ANOVA - 3 day P = 0.50 ANOVA - 28 day P = Bonferonni P-value Significant Bonferonni P-value Significant Bonferonni P-value Significant A vs SWR A vs SWR A vs SWR A vs C A vs C A vs C A vs SJL A vs SJL A vs SJL SWR vs C SWR vs C SWR vs C SWR vs SJL SWR vs SJL SWR vs SJL C57 vs SJL C57 vs SJL C57 vs SJL INTRASTRAIN VARIATION INTERSTRAIN VARIATION (low vs high strains) Paired T-tests (intrastrain: EF day 3 to day 28) T-Test (combined low strains vs combined high strains) Strain P-value Significant Time point P-value Significant A Baseline SWR trending 3 day C57Bl/ day SJL High strains combined Low strains combined 8.70E-04 Supplementary Table 3. Statistics for Figures S1B-E. Additional parameters of echocardiography across strains at 28 days post infarction. Figure S1B. LV Anterior Wall (28 day) Figure S1C. Stroke Volume (28 day) ANOVA - 28 day P = 3E-05 ANOVA - 28 day P = Bonferonni Correction P-value Significant Bonferonni Correction P-value Significant A vs SWR A vs SWR A vs C57Bl/ A vs C57Bl/ A vs SJL A vs SJL SWR vs C57Bl/ SWR vs C57Bl/ SWR vs SJL 1.1E-04 SWR vs SJL C57Bl/6 vs SJL C57Bl/6 vs SJL Figure S1D. LV Volume (systole, 28 day) Figure S1E. LV Volume (diastole, 28 day) ANOVA - 28 day P = 9E-04 ANOVA - 28 day P = 2E-04 Bonferonni Correction P-value Significant Bonferonni Correction P-value Significant A vs SWR A vs SWR A vs C57Bl/ A vs C57Bl/ A vs SJL A vs SJL SWR vs C57Bl/ SWR vs C57Bl/6 1.8E-04 SWR vs SJL SWR vs SJL C57Bl/6 vs SJL C57Bl/6 vs SJL 0.483

7 Full Western blot images corresponding to Figure 3C. Cropped off 3 A/J samples (irrelevant), #1969 (misloaded or degraded), and last two samples (unrelated experiment)

8 mou se mou heart cmlc se heart cmlc 2-GFP 2 cmlc -Tnni3k # 2-T 1 H2O nni3k #1 Full Western blot images corresponding to Figure S2B. 2 samples cropped after SWR (unrelated experiment) zebrafish - Tnni3k mtnni3k (primer set 2) mou se mou heart cmlc se heart cmlc 2-GFP 2 cmlc -Tnni3k # 2-T 1 H2O nni3k #1 mou se mou heart cmlc se heart cmlc 2-GFP 2 cmlc -Tnni3k # 2-T 1 H2O nni3k #1 mtnni3k (primer set 1) zebrafish - eef1g Full RT-PCR gel images corresponding to Figure S2J. Full Western blot images corresponding to Figure S2K. Anti-Tnni3k blot on left. Anti-Gapdh blot on right.

Chow KD CR HFD. Fed Fast Refed

Chow KD CR HFD. Fed Fast Refed Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)

E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g) Myociyte cross-sectional Relative mrna levels Relative levels Relative mrna levels Supplementary Figures and Legends a 8 6 4 2 Ezh2 E1.5 E18.5 P2 1w 83w b Ezh2 p16 amhc b-actin P2 43w kd 37 86 16 wt mouse

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in

More information

Supplementary Figure 1. c Human

Supplementary Figure 1. c Human Supplementary Figure 1 a b c Human Mouse d Gapdh Amino acid sequence and baseline expression of MYDGF N-terminal signal peptides (S-scores) and signal peptide cleavage sites (C-scores) of (a) human MYDGF

More information

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and

More information

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

(a-r) Whole mount X-gal staining on a developmental time-course of hearts from

(a-r) Whole mount X-gal staining on a developmental time-course of hearts from 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda

More information

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Supporting Information. Calculation of the relative contributions of myocyte proliferation, stem cell. Supporting Information Fig 1 (page 9)

Supporting Information. Calculation of the relative contributions of myocyte proliferation, stem cell. Supporting Information Fig 1 (page 9) Supporting Information Table of contents Calculation of the relative contributions of myocyte proliferation, stem cell differentiation and cardioprotection (page 2) Supporting Information Fig 1 (page 9)

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Supplementary Information

Supplementary Information Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

BNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine

BNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine Kanazawa, et al. Supplementary figure legends Supplementary Figure 1 DS rats had congestive heart failure. (A) DR and DS rat hearts. (B) QRT-PCR analysis of BNP mrna expression in DR and DS rat left ventricles

More information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplementary material page 1/10

Supplementary material page 1/10 Supplementary Figure 1. Metoprolol administration during ongoing AMI reduces MVO in STEMI patients (a, b) Complete representative CMR exams (short-axis covering the entire left ventricle (LV) from base

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Serum cytokine levels in control and tumor-bearing male and female mice at day 15.

Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*

More information

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse

More information

Supplementary figures

Supplementary figures Supplementary figures Supplementary Figure 1. B cells stimulated with pokeweed mitogen display normal mitotic figures but not cells infected with B95-8. The figures show cells stimulated with pokeweed

More information

Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and

Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Edn1-knockout (Edn1-KO) (c, d) hearts. The boxed areas

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Genetic influence on immune phenotype revealed strain-specific variations in peripheral blood lineages

Genetic influence on immune phenotype revealed strain-specific variations in peripheral blood lineages Physiol Genomics 34: 304 314, 2008. First published June 10, 2008; doi:10.1152/physiolgenomics.00185.2007. Genetic influence on immune phenotype revealed strain-specific variations in peripheral blood

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were

Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

WHICH C57BL/6 SUBSTRAIN WAS USED FOR THE BACKGROUND STRAIN OF YOUR MOUSE?

WHICH C57BL/6 SUBSTRAIN WAS USED FOR THE BACKGROUND STRAIN OF YOUR MOUSE? Вестник ВОГиС, 2009, Том 13, 3 523 WHICH C57BL/6 SUBSTRAIN WAS USED FOR THE BACKGROUND STRAIN OF YOUR MOUSE? K. Mekada, A. Yoshiki RIKEN BioResource Center, Tsukuba, Ibaraki, Japan, e-mail: yoshiki@brc.riken.jp

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary Figure 1

Supplementary Figure 1 Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure

Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure Coralie Poizat, Ph.D. Director, Cardiovascular Research Program KFSHRC-Riyadh Saudi Heart Failure Working Group Jeddah, 5 December 2015 Cardiovascular

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547 Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific

More information

Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke

Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke SUPPLEMENTARY INFORMATION doi:10.1038/nature09511 Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke Pre Post 7-days Systolic Diastolic BPM Systolic Diastolic BPM Systolic

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling

More information

Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease

Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

B lymphocytes trigger monocyte mobilization and impair heart function after acute myocardial infarction

B lymphocytes trigger monocyte mobilization and impair heart function after acute myocardial infarction Supplementary Figures to 3 B lymphocytes trigger monocyte moilization and impair heart function after acute myocardial infarction Yasmine Zouggari, Hafid Ait-Oufella, Philippe Bonnin, Taassome Simon, Andrew

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold

More information

Fetal gene upregulation by 1-wk TAC is significantly increased in mice lacking RGS2.

Fetal gene upregulation by 1-wk TAC is significantly increased in mice lacking RGS2. 3562-RG-1 Supplementary Figure 1 Fetal gene upregulation by 1-wk is significantly increased in mice lacking RGS2. ANP(Nppa) /BNP(Nppb) A-type and B-type natriuretic peptide; β-mhc (Myh7) beta myosin heavy

More information

doi: /nature14508 Rappsilber et al.

doi: /nature14508 Rappsilber et al. SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Specimen. Humeral Head. Femoral Head. Objective. Femoral Condyle (medial) Supplementary Figure 1

Specimen. Humeral Head. Femoral Head. Objective. Femoral Condyle (medial) Supplementary Figure 1 A B Specimen Humeral Head 2 1 µm 76 µm Femoral Head Objective Femoral Condyle (medial) Supplementary Figure 1 A Femoral Head Global Cell Density Superficial Cell Density Cell Number at 1 µm Nuclei /.1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

International Graduate Research Programme in Cardiovascular Science

International Graduate Research Programme in Cardiovascular Science 1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.

More information

Supplementary Material

Supplementary Material Supplementary Material Induction of myocardial infarction Mice were anesthetized by intraperitoneal injection of pentobarbital (7 mg/kg). In the supine position, endotracheal intubation was performed.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Velocity Vector Imaging as a new approach for cardiac magnetic resonance: Comparison with echocardiography

Velocity Vector Imaging as a new approach for cardiac magnetic resonance: Comparison with echocardiography Velocity Vector Imaging as a new approach for cardiac magnetic resonance: Comparison with echocardiography Toshinari Onishi 1, Samir K. Saha 2, Daniel Ludwig 1, Erik B. Schelbert 1, David Schwartzman 1,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish

Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast

More information

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary

More information