Figure S1. In vitro drug combinations Growth inhibition assays performed on BE(2)-C neuroblastoma cell line using Alamar Blue after 72 h incubation

Supplementary Figures

Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial

III. Results and Discussion

III. Results and Discussion 1. Histological findings in the coronary artery Twenty-four swine had surgical treatments performed in two of the coronary arteries, LAD as well as either the LCX or RCA. A

Akt targeting as a strategy to boost chemotherapy efficacy in non-small cell lung cancer through metabolism suppression.

Akt targeting as a strategy to boost chemotherapy efficacy in non-small cell lung cancer through metabolism suppression. Marion Le Grand 1,2, Raphael Berges 1, Eddy Pasquier 1,3, Marie-Pierre Montero 1,

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Supplementary Figure 1 Representative images of an in vitro comparison of several AAV serotypes regarding egfp expression in cochlear explants of CBA/CaJ mice. (A-F): Results after incubation at equal

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

* * * * Supplementary Figure 1. DS Lv CK HSA CK HSA. CK Col-3. CK Col-3. See overleaf for figure legend. Cancer cells

Supplementary Figure 1 Cancer cells Desmoplastic stroma Hepatocytes Pre-existing sinusoidal blood vessel New blood vessel a Normal liver b Desmoplastic HGP c Pushing HGP d Replacement HGP e f g h i DS

SUPPLEMENTARY INFORMATION

DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

Supplementary Figure 1

Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition

SUPPLEMENTARY LEGENDS...

TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients

SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.

Phenotype Determines Nanoparticle Uptake by Human

Phenotype Determines Nanoparticle Uptake by Human Macrophages from Liver and Blood Sonya A. MacParland a,b,, Kim M. Tsoi c,d,, Ben Ouyang c, Xue-Zhong Ma a, Justin Manuel a, Ali Fawaz b, Mario A. Ostrowski

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

Supporting Information

Supporting Information Vaira et al. 10.1073/pnas.0907676107 0h 24h 48h PTEN pathway Expression 0h 24h 48h Time MAP Kinase Signaling Pathway Expression 0h 24h 48h Time Collagen Expression Fig. S1. Differential

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855

Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,

Chronic variable stress activates hematopoietic stem cells

SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

Supplementary Figure 1.

Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

Supplementary Information and Figure legends

Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

islets scored 1 week month months

Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

Fig. S1. High K+ increases intracellular calcium level.

Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

Parvathi Haridas 1,2, Jacqui A McGovern 1, D L Sean McElwain 1,2, Matthew J Simpson 1,2. Brisbane, Australia. Corresponding Author:

Supplemental Information Quantitative comparison of the spreading and invasion of radial growth phase and metastatic melanoma cells in a three-dimensional human skin equivalent model Parvathi Haridas 1,2,

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

Supplementary Figures

Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer

CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate

Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is

Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is not co-expressed in DCLK1-positive tuft cells. Scale

CANCER THERAPEUTICS: A NOVEL APPROACH

CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

LPS LPS P6 - + Supplementary Fig. 1.

P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male

University of Ulsan College of Medicine, Seoul 05505, Republic of Korea.

Nanoparticle-Assisted Transcutaneous Delivery of a Signal Transducer and Activator of Transcription 3-Inhibiting Peptide Ameliorates Psoriasis-like Skin Inflammation Jin Yong Kim 1,5, Jinhyo Ahn 3,4, Jinjoo

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF

SUPPLEMENTARY INFORMATION

Haematopoietic stem cell release is regulated by circadian oscillations Simón Méndez-Ferrer *, Daniel Lucas *, Michela Battista * and Paul S. Frenette * Mount Sinai School of Medicine, *Departments of

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

Expanded View Figures

PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3

Nature Protocols: doi: /nprot Supplementary Figure 1

Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy

Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation

Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

Supplementary Material

Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2018 Supplementary Material 1 Supplemental Figures Supplemental Figure S1. Mechanical properties

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles

Pathologic Stage. Lymph node Stage

ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel p53 RB Myc Cell Line Mutation A Mutation A Amplification B COR-L103 C p.y234c p.d584e L-Myc NCI-H526 p.s33_splice None N-Myc NCI-H1048

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature

Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)

Figure 1.1 PHITS geometry for PTB irradiations with: broad beam, upper panel; mono energetic beams, lower panel. Pictures of the setups and of the

Figure 1.1 PHITS geometry for PTB irradiations with: broad beam, upper panel; mono energetic beams, lower panel. Pictures of the setups and of the PMMA ring holder with 7 containers are also shown. Relative

Unit 1 Outline Science Practices. Part 1 - The Scientific Method. Screencasts found at: sciencepeek.com. 1. List the steps of the scientific method.

Screencasts found at: sciencepeek.com Part 1 - The Scientific Method 1. List the steps of the scientific method. 2. What is an observation? Give an example. Quantitative or Qualitative Data? 35 grams?

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

JCB. Supplemental material. Gu et al.,

Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the

Figure S1. B % of Phosphorylation 32H. 32ss

Figure S1 8H 32ss 32H 32Hc % of Phosphorylation 3 32H 2 1 32ss 1 2 3 4 Extract (μg) C % of Phosphorylation 18 12 6-32H 32Hc 8H 32ss Dbait Figure S1. List of the Dbait molecules and activation of DN-PK

Supplementary Figure 1.

Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

Supplementary Figure 1

CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

Pearson r = P (one-tailed) = n = 9

8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

Supplementary Information. A vital role for IL-2 trans-presentation in DC-mediated T cell activation in humans as revealed by daclizumab therapy

Supplementary Information A vital role for IL-2 trans-presentation in DC-mediated T cell activation in humans as revealed by daclizumab therapy Simone C. Wuest 1, Jehad Edwan 1, Jayne F. Martin 1, Sungpil

6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells

6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e

Supplementary material for the manuscript

Supplementary material for the manuscript Title: CD200-positive cancer associated fibroblasts augment the sensitivity of Epidermal Growth Factor Receptor mutation-positive lung adenocarcinomas to EGFR

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.

T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8

Reward prediction based on stimulus categorization in. primate lateral prefrontal cortex

Reward prediction based on stimulus categorization in primate lateral prefrontal cortex Xiaochuan Pan, Kosuke Sawa, Ichiro Tsuda, Minoro Tsukada, Masamichi Sakagami Supplementary Information This PDF file

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

SUPPLEMENTARY RESULTS

SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification