DLK1: A Novel Target for Immunotherapeutic Remodeling of the Tumor Blood Vasculature

Transcription

1 originl rtile DLK1: A Novel Trget for Immunotherpeuti Remodeling of the Tumor Blood Vsulture Nin Chi Sins 1, Jennifer L Tylor 2, Kellsye PL Fin 1, Leonrd J Applemn 3,4, Jodi K Mrnhie 4,5, Donn Beer Stolz 6 nd Wlter J Storkus 1,2,4 1 Deprtment of Immunology, University of Pittsurgh Shool of Mediine, Pittsurgh, Pennsylvni, USA; 2 Deprtment of Dermtology, University of Pittsurgh Shool of Mediine, Pittsurgh, Pennsylvni, USA; 3 Deprtment of Mediine, University of Pittsurgh Shool of Mediine, Pittsurgh, Pennsylvni, USA; 4 University of Pittsurgh Cner Institute, Pittsurgh, Pennsylvni, USA; 5 Deprtment of Urology, University of Pittsurgh Shool of Mediine, Pittsurgh, Pennsylvni, USA; 6 Deprtment of Cell Biology nd Physiology, University of Pittsurgh Shool of Mediine, Pittsurgh, Pennsylvni, USA Tumor lood vessels re frequently ineffiient in their design nd funtion, leding to high interstitil fluid pressure, hypoxi, nd idosis in the tumor miroenvironment (TME), rendering tumors refrtory to the delivery of hemotherpeuti gents nd immune effetor ells. Here we identified the NOTCH ntgonist delt-like 1 homologue (DLK1) s vsulr periyte-ssoited ntigen expressed in renl ell rinoms (RCC), ut not in norml kidney tissues in mie nd humns. Vintion of mie ering estlished RCC ginst DLK1 led to immune-medited elimintion of DLK1 + periytes nd to lood vessel normliztion (i.e., deresed vsulr permeility nd intrtumorl hypoxi) in the TME, in ssoition with tumor growth suppression. After therpeuti vintion, tumors displyed inresed prevlene of tivted VCAM1 + CD31 + vsulr endothelil ells (VECs) nd CXCL1, type-1 T ell reruiting hemokine, in onert with inresed levels of type-1 CD8 + tumor-infiltrting lymphoytes (TIL). Vintion ginst DLK1 lso yielded (i) drmti redutions in Jrid1B +, CD133 +, nd CD44 + (hypoxi-responsive) stroml ell popultions, (ii) enhned tumor ell poptosis, nd (iii) inresed NOTCH signling in the TME. Codministrtion of γ-seretse inhiitor (N-[N-(3,5- Difluorophenetyl-L-lnyl)]-(S)-phenylglyine t-utyl ester (DAPT)) tht interferes with nonil NOTCH signling resulted in the prtil loss of therpeuti enefits ssoited with lentivirus enoding full-length murine (lvdlk1)-sed vintion. Reeived 18 Deemer 212; epted 22 My 213; dvne online pulition 3 July 213. doi:1.138/mt INTRODUCTION The vsulture of solid tumors is struturlly nd funtionlly norml, eing omposed of n irregulr network of lood vessels hrterized y errnt overge of endothelil tues nd y loosely tthed nd lrgely immture popultion of murl ells (i.e., smooth musle ells nd periytes). 1,2 In ontrst to mture periyte-vsulr endothelil ell (VEC) ollortion found in norml tissues tht orhestrtes lood vessel integrity/stility, 3 in tumors, this intertion is dernged leding to high-degree of vsulr permeility, high interstitil fluid pressure, hypoxi, nd idosis. 1,4 Renl ell rinom (RCC) is highly vsulrized nd generlly onsidered to represent n immunogeni form of ner. 5 7 Current tretment options medite only trnsient effiy in minority of RCC ptients, with frequent development of progressive disese tht is refrtory to onventionl hemo-/rdiotherpy Vines trgeting tumor-ssoited ntigens hve lso thus fr demonstrted only modest urtive vlue. 12 The limited perfusion of tumor lood vessels likely ontriutes to the muted enefits of these tretment pprohes y preventing the effiient delivery of hemotherpeuti gents nd ntitumor T ells into the tumor miroenvironment (TME). 13,14 As onsequene, the development of novel therpies tht n normlize the tumor vsulture (y oordintely improving lood vessel perfusion, reduing tumor hypoxi, nd llowing for improved nd sustined delivery of ntiner gents into the TME) remins high priority To hieve the gol of tumor vsulr normliztion vi immuniztion, we nd others hve reently dvoted the use of vine formultions ple of promoting speifi type-1 CD8 + T ell (k T1) reognition of tumor-ssoited vsulr ell (i.e., periytes nd VEC) ntigens, inluding delt-like 1 homologue (DLK1). 14 DLK1, k predipoyte ftor-1 (Pref-1), is trnsmemrne memer of the EGF-like fmily of proteins, whih inludes NOTCH reeptors nd their lignds The extrellulr domin of DLK1 ontins six EGF-like repets nd tumor nerosis ftor-α onverting enzyme levge site, ut it lks the delt/ serrte/lag-2 domin found in nonil NOTCH lignds. 2 As onsequene, while DLK1 inds NOTCH1, it fils to promote NOTCH tivtion, nd indeed oth the memrne-ound nd tumor nerosis ftor-α onverting enzyme-leved extrellulr domin forms of DLK1 serve s funtionl inhiitors of NOTCH signling DLK1 hs een reported to inhiit rod rnge Correspondene: Wlter J Storkus, Deprtment of Dermtology nd Immunology, University of Pittsurgh Shool of Mediine, W141.2 Biomedil Sienes Tower, 2 Lothrop Street, Pittsurgh, Pennsylvni 15213, USA. E-mil: storkuswj@upm.edu vol. 21 no. 1, ot. 213

2 Therpeuti Tumor Vsulr Normliztion of NOTCH-dependent differentition pthwys inluding norml dipogenesis, musulr nd neuronl differentition, one differentition, nd hemtopoiesis. 2 In the ner setting, the funtionl impt of DLK1 modultion nnot e intuitively ssumed, sine NOTCH tivtion hs een reported to either promote or suppress tumor development/progression sed on the lne of its ontextul influenes on the myrid of ell popultions loted within the evolving TME In this report, we investigted the therpeuti impt of tive vintion ginst DLK1 in murine model of RCC (i.e., RENCA tumor ells trnsplnted suutneously (s..) into syngeni BALB/ mie), where the DLK1 ntigen is preferentilly expressed y lood vessel-ssoited periytes in the progressively growing TME. We show tht DLK1 peptide- or gene-sed vines re oth immunogeni nd therpeuti ginst estlished RCC, with tretment enefits linked to CD8 + T ell-medited normliztion of tumor-ssoited lood vessels (sed on riteri estlished y Jin et l. (i.e., redution in lood vessel numers nd extent of roriztion, loss of hypoxi, nd redued vsulr permeility)). 16,17 Responder tumors were highly infiltrted y CD8 + tumor-infiltrting lymphoytes (TIL) tht lolized within the perivsulr (periyte-enrihed) spe. Residul periytes lked expression of DLK1 nd were tightly pproximted to CD31 + VEC. Consistent with the vine-indued, immune-medited erdition of tumor-ssoited DLK1 protein expression, inresed NOTCH signling ws evidened within the therpeuti TME. These results re onsistent with the ility of DLK1-sed vines to promote therpeuti CD8 + T elldependent vsulr normliztion in the RCC miroenvironment, supporting the linil trnsltion of suh pprohes in the setting of RCC nd other forms of solid ner. RESULTS RCC-ssoited periytes differentilly express the DLK1 ntigen In previous report, 14 we identified severl melnom-ssoited vsulr ntigens, inluding DLK1, whih my represent promising therpeuti vine trgets. Before ssessing the therpeuti potentil of DLK1 peptide- nd gene-sed vines in the setting of RCC, we first investigted the pttern of DLK1 expression in the TME nd tumor uninvolved kidneys of BALB/ mie hroring estlished syngeni RENCA (n RCC line estlished from spontneously rising renl denorinom of BALB/ origin) 22 tumors. After enzymti digestion of tissues, tumor- nd kidneyderived periytes nd VEC were isolted vi flow sorting from single-ell suspensions (Figure 1) nd their extrted mrna (long with mrna from the ultured RENCA ell line) ws nlyzed y rel-time PCR for DLK1 (nd housekeeping ontrol HPRT1) trnsript ontent (Figure 1). We oserved tht periytes sorted from RCC tumors were uniquely enrihed for DLK1 trnsripts SSC 256K 192K 128K 64K 14.7 DAPI Reltive DLK1 mrna expression K 128K FSC 192K 256K 64K 128K FSC 192K 256K VEC Periyte VEC Periyte RENCA SSC 256K 192K 128K 64K CD Periyte VEC CD31 NG2 DLK1 Kidney Tumor 1 3 CD CD Figure 1 DLK1 is differentilly expressed y RENCA tumor-ssoited periytes. The spontneously rising renl ortil denorinom RENCA (1 6 tumor ells) ws injeted s.. into femle BALB/ mie nd llowed to progress for 21 dys fter whih nimls were euthnized nd tumors nd norml kidneys hrvested. () Tissues were proessed into single-ell suspensions nd sorted y flow ytometry sed on forwrd versus side stter profiles, DAPI exlusion (to rejet ded ells), CD45 neg phenotype (i.e., non-leukoyti), nd then seletively into CD146 + CD34 neg periytes nd CD146 + CD34 + VEC popultions sed on pulished ssignments of these ell linege-restrited phenotypes. 48,49 () mrna ws then isolted from flow-sorted periytes nd VEC, nd nlyzed for DLK1 trnsript expression y rel-time PCR. Reltive mrna expression ws normlized to housekeeping HPRT1 mrna expression. () Dy 21 RENCA tumor tissue setions were nlyzed for expression of CD31 (lue), NG2 (green), nd DLK1 (red) y immunofluoresene mirosopy. Metmorph quntittion (Mterils nd Methods) ws performed on 1 high power field (HPF) of the fluoresent imges, with 28.1 ± 4.4% of tumor-ssoited NG2 + periytes oexpressing the DLK1 mrker. The nlysis lso reveled tht the mjority (i.e., 58.9 ± 7.6%) of DLK1 + ells oexpressed the NG2 mrker within the TME. All dt re representtive of three independent experiments performed. DAPI, 4,6-dimidino-2-phenylindole; FSC, forwrd stter; SSC, side stter; TME, tumor miroenvironment; VEC, vsulr endothelil ell. Moleulr Therpy vol. 21 no. 1 ot

3 Therpeuti Tumor Vsulr Normliztion (Figure 1) when ompred with norml kidney vsulr ells or RENCA tumor ells, suggesting tht DLK1 my represent generl tumor periyte-ssoited ntigen. Immunofluoresene mirosopy performed on dy 21 RENCA tumor setions onfirmed tht DLK1 protein ws oexpressed y NG2 + ( generl mrker of periytes in oth norml nd tumor tissue) 23 periytes tht were losely pproximted to CD31 + VEC in situ (Figure 1). Tretment of RENCA tumor-ering mie with DLK1 peptide-sed vine is therpeuti nd ssoited with speifi type-1 CD8 + T ell (T1) tivtion nd reruitment into the TME We hve previously demonstrted tht vine formultions omposed of interleukin-12 (IL-12) gene-modified dendriti ells (DCs) (i.e., DC.IL12) pulsed with mjor histoomptiility omplex lss I-presented peptides promote roust CD4 + T helper ell-independent priming of ntigen-speifi CD8 + T ells in vivo. 14,24 Using this pproh, we nlyzed the impt of treting BALB/ mie ering estlished s.. RENCA tumors with DLK1 peptide ( pooled equimolr mixture of the DLK , DLK , nd DLK peptides)-sed vine. As depited in Figure 2, mie treted with the DLK1 peptide-sed vine, ut not ontrol vine (i.e., DC.IL12, no peptide) or phosphte-uffered sline (PBS), exhiited signifint redution in the growth of RENCA tumors (Figure 2; P <.5 (nlysis of vrine) on dys >13). On dy 21 (i.e., 7 dys fter the ooster immuniztion), CD8 + splenoytes were isolted nd nlyzed for seretion of interferon-γ (IFN-γ) in response to stimultion with speifi DLK1 peptides presented y syngeni DC in vitro. We noted elevted levels of IFN-γ seretion from CD8 + T ells isolted from mie treted with the DC.IL12 + DLK1 peptide vine (versus mie treted with DC.IL12 only or PBS) fter stimultion with individul DLK1 peptides, inditing tht the vine indued poly-speifi, nti-dlk1 CD8 + T ell responses in vivo (Figure 2). Sine therpeuti type-1 CD8 + T ells preferentilly express VLA-4 + CXCR3 + phenotype, 25,26 we next determined whether speifi vintion resulted in the ltered expression of VLA-4 nd CXCR3 lignds, VCAM-1 nd CXCL1, respetively in the TME. A oordinte immunofluoresene mirosopy nlysis of the TME fter DLK1 peptide-sed vintion versus ontrol tretment reveled fewer CD31 + tumor lood vessels (Figure 2), nd these vessels ontined VEC enrihed in the tivted VCAM1 + phenotype (Figure 2d). We lso oserved tht these sme tumors ontined elevted levels of CXCL1/IP-1 hemokine protein expression versus ontrol tumors (Figure 2), suggesting tht the RENCA size (mm 2 ) PBS DC.IL12 DC.IL12/DLK1 P <.5 P < Dys post-tumor inoultion 2 IFN-γ (pg/ml) DLK 158 DLK 161 DLK 259 PBS DC.IL12 DC.IL12 + DLK1 d CD31 CXCL1 DAPI Integrted fluoresene ( 1 7 ) CXCL1 CD31 CD31 VCAM1 DAPI PBS DC.IL12 DC.IL12 + DLK1 %CD31 + VCAM1 + VEC PBS DC.IL12 DC.IL12 + DLK1 Figure 2 DC/DLK1 peptide-sed vines re oth immunogeni nd therpeuti in the murine RENCA model of RCC. BALB/ mie were inoulted with RENCA tumor ells s.. on the right flnk on dy. () After rndomizing for similr men tumor size per tretment ohort (n = 5), mie were injeted s.. on their left flnk on dys 7 nd 14 (post-tumor inoultion) with PBS, 1 6 DC.IL12 or 1 6 DC.IL12 pre-pulsed with equimolr mix (1 μmol/l eh) of the three syntheti DLK1 peptides. Tumor growth (men ± SD) ws then monitored over time. () On dy 21 post-tumor inoultion, spleni CD8 + T ells were isolted from eh ohort nd o-ultured with syngeni DC pre-pulsed with individul DLK1 peptides for 24 hours, t whih time, IFN-γ ELISA were performed on the hrvested ell-free superntnts. (,d) Dy 21 tumors were fixed, setioned nd nlyzed y immunofluoresene mirosopy; CD31 (green in,d), CXCL1 (red in ), VCAM1 (red in d). The perentge of VCAM1 o-loliztion with CD31 is depited s yellow signl in d nd ws quntitted using Metmorph softwre s desried in Mterils nd Methods. Histogrms to the right of imges reflet men fluoresene intensity quntittion of the indited mrkers (±SD) from three independent fields per slide s desried in Mterils nd Methods. Dt re representtive of three independent experiments performed. P <.5 versus ontrol tretments (nlysis of vrine). DC, dendriti ell; IFN, interferon; PBS, phosphte-uffered sline; RCC, renl ell rinom vol. 21 no. 1 ot. 213

4 Therpeuti Tumor Vsulr Normliztion DLK1-sed vintion indues proinflmmtory TME tht is ompetent to reruit type-1 T effetor ells. Vintion with reominnt lentivirus enoding murine DLK1 DNA is therpeuti in the RENCA model of RCC Clinil trils implementing syntheti tumor peptide-sed vines hve needed to restrit ptient rul to those individuls expressing relevnt humn leukoyte ntigen lss I (peptidepresenting) llotypes. To develop more universl immuniztion pltform, we next engineered geneti vine tht would theoretilly llow for virlly trnsdued host ntigen-presenting ells to ross-prime more omprehensive nti-dlk1 T effetor ell repertoire. Given the reported superiority of lentivirl-sed vines to promote prolonged ntigen-speifi CD8+ T ell responses fter single dministrtion in vivo,27 we first onstruted reominnt lentivirus enoding full-length murine DLK1 (lvdlk1) nd negtive ontrol virus (lvneg; Supplementry Figure S1). CD31 DLK1 DAPI 2 TU 4 TU 4 TU Dys post-tumor inoultion Integrted 6 fluoresene ( 1 ) 1 CD31 CXCL1 DAPI RENCA size (mm2) 2 TU DLK1 integrted 6 fluoresene ( 1 ) To ssess the therpeuti effiy of speifi geneti vintion ginst the full-length DLK1 ntigen, BALB/ mie ering estlished dy 7 RENCA tumors reeived single intrderml injetion of lvdlk1 or ontrol lvneg t site distl to tumor (i.e., ontrlterl). Animls treted with lvdlk1 exhiited signifint redutions in tumor growth ompred with nimls treted with lvneg (Figure 3). As ws the se for DLK1 peptide-sed vines, immunofluoresene mirosopy nlysis of tumor setions supported deresed vsulrity nd loss of (DLK1+) vsulr periytes (Figure 3), nd inresed presene of the CXCR3 lignd hemokine, CXCL1, nd VCAM1+CD31+ VEC in the TME of mie treted with lvdlk1 versus lvneg (Figure 3,d). Enhned expression of CXCL1 nd VCAM1 in the TME ws ssoited with greter numers of CD8+ TIL in mie reeiving LvDLK1-sed vines (Figure 3e). These findings suggest tht immune trgeting of DLK1 vi single dministrtion of lvdlk1 n effetively limit tumor growth nd indue proinflmmtory TME promoting the improved reruitment of TIL. 5 CXCL1 CD %CD31+ VCAM1+ VEC CD31 VCAM1 DAPI d e CD8 integrted fluoresene ( 15) CD8 NG2 DAPI Figure 3 Reominnt lvdlk1-sed vines re therpeuti nd promote type-1 polrized TME. ( d) BALB/ mie were inoulted s.. with RENCA tumor ells in the right flnk on dy. () After ohort (n = 5) rndomiztion for similr men tumor size on dy 1 post-tumor inoultion, mie were treted i.d. in the left flnk with 4 or 2 trnsdution units (TU) of lvdlk1 or ontrol virus, lvneg. Tumor size ws then monitored longitudinlly. ( e) On dy 27 post-tumor inoultion, mie were euthnized, with hrvested tumors fixed, setioned nd nlyzed y immunofluoresene mirosopy for expression of () CD31 (green) nd DLK1 (red) with white rrows inditing DLK1+ ells, () CXCL1, (d) o-loliztion of VCAM1 with CD31, nd (e) CD8+ TIL (green) nd NG (red). Histogrms to the right of imges reflet men fluoresene intensity quntittion of the indited mrkers (±SD) from three independent fields per slide s desried in Mterils nd Methods. Dt re representtive of three independent experiments performed. P <.5 versus ontrol tretments (nlysis of vrine). i.d., intrderml. Moleulr Therpy vol. 21 no. 1 ot

5 Therpeuti Tumor Vsulr Normliztion Vintion with lvdlk1 normlizes the RENCA vsulture It hs een suggested tht the tumor-ssoited vsulture of mie defiient in immture periytes ppers norml with miniml roriztion nd redued vsulr permeility,18 supporting therpeuti strtegies to seletively redue or erdite immture vsulr periytes within tumor sites. Given the ility of our lvdlk1-sed geneti vine to redue the ontent of DLK1+ (immture) periytes in the tumor strom, we sought further evidene supporting therpeuti vsulr remodeling s onsequene of tretment with this modlity. We noted tht RENCA tumors hrvested from mie treted with lvdlk1 ppered nemi when ompred to ontrol tumors (Figure 4), sujetive index tht ws susequently onfirmed sed on n nlysis of hemogloin ontent in tumor lystes (Figure 4). When we nlyzed tumors for expression of NG2 using immunofluoresene mirosopy, we oserved tht nimls vinted with lvdlk1 exhiited tumors with signifint redutions in numers of NG2+ periytes in their TME versus tumors from nimls vinted with lvneg (Figure 4,d). Residul tumor periytes in lvdlk1-treted nimls were tightly pproximted to CD31+ VEC, unlike the rndomly distriuted pttern of periytes Therpeuti vintion with lvdlk1 results in inresed ellulr poptosis in the treted TME Given the pprent trimming of vsulr rnhes in the RENCA TME, nd redution in vsulr permeility fter vintion 6 μg H/1 mg wet tissue deteted in the strom of tumors isolted from ontrol mie. To investigte hnges in tumor vsulr permeility, vinted nimls reeived intrvenous injetions of two fluoresently leled proes, tomto letin-fitc to ind/mrk the vsulr endothelium nd smll 2 nm (red) FluoSpheres to determine vessel lekiness into tissue. When ompred with ontrols, the tumor lood vessels in mie vinted with lvdlk1 displyed simple tuulr rhiteture devoid of extensive rnhing (Figure 5). Furthermore, while the perivsulr strom of tumors in ontrol nimls ws littered with the red FluoSpheres, these proes were virtully undeteted in tumors hrvested from lvdlk1-vinted mie, onsistent with diminished vsulr permeility in the TME of these ltter nimls (Figure 5). These dt suggest tht immuniztion ginst DLK1 llows for the immunotherpeuti normliztion (i.e., redution in lood vessel numers nd roriztion, redued vsulr permeility) of tumor lood vessels in vivo e 1.5 NG2 integrted fluoresene ( 17) CD31 NG2 DAPI (6 μm) 1..5 f 35 Perentge of NG2 o-lolizing with CD31 CD31 NG2 DAPI (3 μm) d Figure 4 Reominnt lvdlk1-sed vines promote normliztion of the tumor vsulture. Mie ering dy 1 RENCA tumors were treted with 2 TU of lvdlk1 or lvneg s outlined in Figure 3. On dy 27 post-tumor inoultion, mie were euthnized nd the () tumors were reseted nd evluted mrosopilly nd () for hemogloin ontent. In nd d, tumor setions were nlyzed y immunofluoresene mirosopy for expression of CD31 (green) nd NG2 (red). In e, 6 μm setions were imged y wide field mirosopy, while in d, 3 μm setions were imged y onfol mirosopy to generte 3D reonstrutions. For e, men dt ± SD of three independent fields per slide in is reported for eh group from one representtive experiment of three performed. (f) The perentge of NG2 fluoresene signl overlpping CD31 fluoresene signl ws lulted using Metmorph softwre s desried in Mterils nd Methods, nd is reported s men ± SD of three independent fields per slide. P <.5 for lvdlk1 versus lvneg (t-test) vol. 21 no. 1 ot. 213

6 Therpeuti Tumor Vsulr Normliztion 5 Tomto letin FluoSpheres Extrvsulr signl (red)/ vsulr surfe (green) (%) CD31 TUNEL DAPI TUNEL integrted fluoresene ( 1 7 ) Figure 5 Reominnt lvdlk1-sed vintion redues tumor vsulr permeility resulting in the development of poptoti ded zones in the TME. In repeted experiments s outlined in Figure 3, () treted mie reeived intrvenous injetions of tomto letin-fitc to lel vsulr endothelium (green) nd 2 nm FluorSpheres to ssess vsulr permeility (red) on dy 24 post-tumor inoultion. Whole tumor tissue ws then imged immeditely y onfol mirosopy t depth of 17 μm. P <.5 for lvdlk1 versus lvneg (t-test). () On the sme dy, unleled mie were euthnized, with tumors reseted, fixed, setioned, nd nlyzed for expression of CD31 (green) nd poptoti nuler stining with TUNEL regent (red). Histogrms to the right of imges reflet men fluoresene intensity quntittion of the indited mrkers (±SD) from three independent fields per slide s desried in Mterils nd Methods. Dt re representtive of three independent experiments performed. P <.5 for lvdlk1 versus lvneg (t-test). with lvdlk1 (ut not lvneg), we hypothesized tht plsm nutrients required for sustining tumor ell viility would e limited to regions djent to the remining normlized lood vessel network. TUNEL nlyses reveled tht indeed, the level of ellulr poptosis in the TME of lvdlk1-treted mie ws sustntilly inresed when ompred with tumors isolted from ontrol treted nimls (Figure 5). Furthermore, virtully ll poptoti events (i.e., ded zones ) in RENCA tumors isolted from lvdlk1-vinted mie were loted in tissue regions >~6 μm wy from residul CD31 + lood vessels in plnr tissue imging nlyses (Figure 5). Therpeuti vintion with lvdlk1 results in redued hypoxi nd lower inidene of ell popultions expressing hypoxi-responsive mrkers in the TME Hypoxi frequently ours in solid ners s onsequene of ineffiient perfusion of oxygen into tumors y errnt lood vessels, 16,28 resulting in redued reruitment nd funtion of TIL, inresed prevlene of immunosuppressive ells/modultors, dysregulted ngiogenesis, nd the umultion of stem-like ell popultions (i.e., ner stem ells/tumor inititing ells, ells undergoing epithelil-to-mesenhyml trnsition) in the TME. 29,3 To investigte hnges in hypoxi within tumors fter vintion with lvdlk1 versus lvneg, we injeted mie intrperitonelly (i.p.) with pimonidzole ( hypoxi mrker tht undergoes redutive tivtion nd then onjugtes to thiolontining proteins speifilly in hypoxi ells, llowing for immunohistohemil detetion of tissue regions exhiiting low (<1.3%) O 2 tension). 31 Using this imging tehnology, we found tht tumors isolted from mie reeiving lvdlk1 vines hd very low hypoxi index when ompred to tumors ulled from ontrol nimls (Figure 6). Given this lrge redution in TME hypoxi postvintion with lvdlk1, we next investigted tretment impt on expression of hypoxi-responsive gene produts ssoited with immture vsulr stroml ells (i.e., RGS5 14 ) nd/ or stem-like ell popultions (i.e., Jrid1B k histone demethylse lysine demethylse 5; CD133, CD44) Immunofluoresene mirosopy nlysis of dy 27 tumor setions reveled tht the expression of these mrkers ws oordintely redued in RENCA tumors fter host vintion with lvdlk1 (Figure 6 f). When tken together, these dt indite tht vintion with lvdlk1 results in the reovery of normoxi in the TME in ssoition with the onditionl ltertion in the phenotype (nd presumly funtion) of rnge of stroml ell supopultions in vivo. Loss of DLK1 expression in the TME fter therpeuti vintion with lvdlk1 leds to inresed looregionl tivtion of NOTCH Sine lvdlk1-sed vintion leds to loss of DLK1 expression in the TME (Figure 3) nd DLK1 represents funtionl inhiitor of NOTCH signling, 2 we hypothesized tht this therpeuti vine would promote enhned nonil NOTCH signling in therpeuti RENCA TME. As shown in Figure 7,, RENCA tumors isolted from lvdlk1-treted (ut not ontrol) mie ontined ells strongly expressing ytoplsmi/nuler Hes1 protein, NOTCH Moleulr Therpy vol. 21 no. 1 ot

7 Therpeuti Tumor Vsulr Normliztion f.75 RGS5 RGS Jrid1 Integrted signl fluoresene ( 17) Jrid1 2. d CD P = CD133.5 P = e CD CD44 Integrted HRP signl ( 17) P =.51. Figure 6 Reominnt lvdlk1-sed vines promote normoxi in the TME in ssoition with the loss of ells ering stem ell-like phenotypes. Mie ering dy 1 RENCA tumors were treted with 2 TU of lvdlk1 or lvneg s outlined in Figure 3. () On dy 21, mie were injeted intrperitonelly with the hypoxi proe pimonidzole hydrohloride nd euthnized, with tumors reseted, setioned, nd nlyzed y HRP immunohistohemistry. ( e) Dy 21 tumor-ering mie tht did not reeive pimonidzole hydrohloride were euthnized, with tumors hrvested, fixed, setioned nd nlyzed y immunofluoresene mirosopy for expression of () CD31 nd RGS5, () Jrid1, (d) CD133, nd (e) CD44. (f) Histogrms to the right of pnel e imges reflet men fluoresene intensity quntittion of the indited mrkers (±SD) from three independent fields per slide s desried in Mterils nd Methods. Dt re representtive of three independent experiments performed. P <.5 for lvdlk1 versus lvneg (t-test). TME, tumor miroenvironment; TU, trnsdution unit. trnsriptionl trget required for the tumor suppressor tion of tivted NOTCH.19,35 Hes1+ ells inluded oth CD31+VEC nd non-vec stroml ell popultions in the TME (Figure 7). Corollry gene rry nlyses lso supported the enhned trnsription of numerous NOTCH trget genes (inluding the nonil NOTCH lignds (DLL1, DDL3, DLL4, nd Jg1/2) nd the NOTCH1-4 reeptors, mong others), ut not ontrol β2-mirogloulin, in lvdlk1versus lvneg-treted tumors (Figure 7). Therpeuti enefits ssoited with lvdlk1-sed geneti vintion re prtilly dependent on nonil NOTCH signling To determine the importne of nonil NOTCH signling on the ntitumor effiy of geneti vintion ginst DLK1, we 1964 immunized BALB/ mie ering estlished s.. RENCA tumors with lvneg or lvdlk1 s desried in Figure 3, with ohorts of lvdlk1-vinted nimls injeted i.p. with the γ-seretse inhiitor DAPT (N-[N-(3,5-Difluorophenetyl-L-lnyl)]-(S)phenylglyine t-utyl ester; whih inhiits the genertion of the NOTCH intrellulr domin required for downstrem NOTCH signling events, ref. 36) or vehile ontrol DMSO. As shown in Figure 7d, dministrtion of DAPT prtilly suppressed the ntitumor tion of lvdlk1-sed therpeuti vintion. DISCUSSION The mjor finding in this report is tht DLK1 is tumor periyte-ssoited ntigen tht n e immunologilly trgeted vi speifi peptide- or gene-sed vintion in vivo, leding to vol. 21 no. 1 ot. 213

8 Therpeuti Tumor Vsulr Normliztion CD31 Hes1 DAPI Fold trnsript hnge (LvDLK1/) Integrted Hes1 fluoresene ( 1 5 ) Adm1 Adm17 Axin1 Cne1 Cdkn1 Ctnn1 DII1 DII3 DII4 Dtx1 Fos1 Fzd2 Fzd3 Fzd4 Fzd5 Fzd7 Gli1 Hes1 Hes5 Hey1 Hey Gene produt 1 VAC DD 5 1 D 15 DD D 2 25 Dys post-tumor inoultion RENCA size (mm 2 ) DAPT Heyl Id1 Jg1 Jg2 Lfng Mml1 Mmp7 Nstn Nfk1 Noth1 Noth2 Noth3 Noth4 Num Psen1 Psen2 Psenen Rpjl Shh Wisp1 Wnt11 Bet2m d Figure 7 Tretment with lvdlk1 vines results in NOTCH tivtion in the TME, whih is prtilly responsile for the ntitumor effetiveness of this tretment strtegy. () Tumor setions were isolted s desried in Figure 3 nd evluted y fluoresene mirosopy using speifi ntiodies ginst CD31 (green) nd Hes1 (red). DAPI ounterstining ws used to imge ell nulei (lue). White rrows in imge insets indite Hes1 + CD31 + VEC. () Men fluoresene intensity quntittion of Hes1 protein expression (±SD) from three independent fields per slide is reported s desried in Mterils nd Methods. Dt re representtive those otined in three independent experiments performed. P <.5 (t-test). () mrna trnsripts of NOTCH trget genes were nlyzed using n reverse trnsription-pcr gene rry. The rtio of trnsript levels for given gene produt mong totl tumor mrna isolted from lvdlk1- versus lvneg-treted mie is reported. Negtive ontrol trnsript = β 2 -mirogloulin (et 2-m). (d) Estlished dy 8 s.. RENCA tumors were treted with 2 TU of lvneg or lvdlk1 (i.e., VAC) s desried in the Figure 3 legend nd Mterils nd Methods. DAPT (in DMSO; depited s smll gry ovls leled D on the x-xis) or vehile ontrol DMSO ws then provided s indited for three onseutive dys/week/yle for two yles eginning on dy 12 post-tumor inoultion. Tumor size ws then monitored longitudinlly. P <.5 for lvdlk1 + DAPT tretment versus lvdlk1 tretment; lso P <.5 for the lvdlk1 + DAPT nd lvdlk1 tretments versus lvneg ontrol tretment on dys 15 post-tumor inoultion (nlysis of vrine). DAPI, 4,6-dimidino-2-phenylindole; TME, tumor miroenvironment; TU, trnsdution unit; VAC, vintion. the effetive normliztion of the vsulture in the TME nd drsti redution in solid tumor (i.e., RENCA) growth in vivo. Effetive therpeuti vintion resulted in the tivtion of type-1 (IFN-γ produing) DLK1-speifi CD8 + T ells in the periphery nd the improved reruitment of CD8 + T ells into/round residul lood vessels in the TME. Therpeutilly normlized lood vessels in RENCA tumors exhiit simplified onduit design with tightly pproximted (luminl) NG2 + DLK1 neg RGS5 neg mture periyte popultions tht pper improved in their struturl integrity sed on redution in vsulr permeility. RENCA tumors in DLK1-vinted mie eme normoxi nd displyed drmti inrese in the rte of poptoti deth in regions of the tumor tht were further wy from residul lood vessels. The reltionship etween loss of hypoxi nd promotion of tumor ell poptosis in the therpeuti TME my not e intuitively ovious. We hypothesize tht onsistent with the prdigm of Jin, 17 therpeuti vsulr normliztion results in the oordinte loss of vsulr permeility nd hypoxi in the TME. In turn, loss of hypoxi (nd hypoxi-responsive genes suh s HIF-1α) hs een ssoited with enhned rtes of tumor ell poptosis 37 nd redued expression of rod rnge of tumor growth nd survivl/ntipoptoti gene produts. 38 As suh, under normoxi onditions post-therpy (s in the se of lvdlk1-sed vintion), tumor ells most removed from lood vessels my e rendered most suseptile to undergo poptosis sed on limited ess to pro-survivl/growth ftor grdients emnting from normlized lood vsulture. Overll, our findings support model in whih speifi immune effetor T ells my serve s regultors of the ngiogeni swith y monitoring nd ontrolling the sttus of DLK1 + periytes within the TME. Vintion ginst DLK1 lso indued proinflmmtory TME sed on the quisition of tivted VCAM1 + VEC nd onomitnt prodution of the CXCR3 lignd hemokine CXCL1, responsile for reruiting type 1 TIL. We hypothesize tht n initil wve of DLK1-retive type-1 TIL results in perivsulr seretion of IFN-γ nd tumor nerosis ftor-α in the TME, leding to looregionl upregultion of IFN-γ/tumor nerosis ftor-α responsive gene produts suh s VCAM-1 nd CXCL1. 39 Suh ltertions in the TME would then e expeted to foster improved uptke of tumor deris (i.e., poptoti odies) y reruited/tivted ntigen-presenting ells nd the orollry reitertive ross-priming of n expnded, protetive T ell repertoire retive ginst oth tumor- nd tumor vsulr-ssoited ntigens 14 tht my e direted into the proinflmmtory TME. Moleulr Therpy vol. 21 no. 1 ot

9 Therpeuti Tumor Vsulr Normliztion Interestingly, reent report y Reis et l. 39 suggests tht the onditionl tivtion of the Wnt/β-tenin/NOTCH signling pthwy n led to vsulr normliztion, s indited y redued vsulr density nd improved murl ell tthment, in intrrnil murine gliom models. Our dt support suh prdigm, with speifi vintion resulting in removl of DLK1 expression (nd NOTCH ntgonism) 2 in the TME. Suh immune pressure improved NOTCH signling sed on drmti inrese in the intrtumorl expression of Hes1 protein nd the trnsriptionl tivtion of multiple NOTCH trget genes. The trnsriptionl profiling lso supports differentilly inresed expression of Frzd2, Frzd4, Frzd7, nd β-tenin (Ctnn1) in RENCA tumors hrvested from lvdlk1-vinted mie supporting the otivtion of nonil Wnt/β-tenin signling 4 in the therpeuti TME, onsistent with the model proposed y Reis et l. 39 As suh, our dt suggest tht vintion ginst DLK1 (s n integrl trnsmemrne protein or vi its shed extrellulr domin) 41 my derepress nonil NOTCH/Wnt/β-tenin signling in endothelil ells (nd other stroml ell popultions) within the TME, therey promoting vsulr quiesene/ normliztion. 2,39,42 Vintion ginst DLK1 my lso improve type-1 funtionlity of tumor-ssoited mrophges nd DC (i.e., enhned IL-12p7 nd CXCL1 prodution) nd T ells. 43 Indeed, we oserved tht the funtionl ntgonism of NOTCH signling in vivo (sed on dministrtion of the γ-seretse inhiitor DAPT) prtilly lted the ntitumor enefits ssoited with lvdlk1-sed therpeuti vintion, suggesting supporting role for nonil NOTCH signling in tretment outome. Future studies will investigte the potentil role of Wnt/ β-tenin signling in therpeuti enefit ssoited with DLK1- sed vines y pplying speifi inhiitors of these pthwys in our therpeuti model. The TME of progressively growing, ontrol RENCA tumors ws enrihed in ells expressing mrkers known to ontin HRE in their promoter regions, suh s CD44, CD133, nd Jrid1B, tht hve een previously linked to ell popultions with stemlike hrteristis. 29,3 Notly, the normlized TME fter therpeuti vintion with lvdlk1 ws normoxi nd lrgely devoid of ells expressing these hypoxi-responsive ntigens. Although the most simplisti reson for this hnge reflets the trnsriptionl silening of these gene produts in the TME of lvdk1-vinted nimls, it is lso oneivle tht the therpeuti TME is poor in reruiting ells ering these phenotypi mrkers, nd/or tht the vine evoked orollry ross-priming 14,24 of ytotoxi CD8 + T ell responses ple of erditing CD44 +, CD133 +, nd Jrid1B + trget ells in effetively treted RENCA tumors. With regrd to the ltter senrio, we urrently pln to longitudinlly evlute the retivity of the evolving therpeuti CD8 + T ell repertoire ginst peptide epitopes derived from the CD44, CD133, nd Jrid1B (s well s lternte stem ell -ssoited/ hypoxi-responsive mrkers suh s ALDH1, Ot4, nd Nnog) 34 ntigens in RENCA-ering mie treted with DLK1 peptide/ gene-sed vines. The ntingiogeni tion medited y the DLK1 vineindued CD8 + T ell repertoire would e ntiipted to differ, nd likely omplement, tht of lterntive phrmologil ntingiogeni tretment modlities suh s ntivsulr endothelil growth ftor ntiodies (i.e., evizum) nd smll moleule tyrosine kinse inhiitors. 11,44,45 In most ses, tumors treted with these gents rpidly eome drug-refrtory due to their doption of ompenstory growth/progression pthwys. As suh, DLK1-sed vines ould represent logil seond-line pproh in the mny ses of developed resistne to evizum, sunitini or similr ntingiogeni drugs. DLK1-sed vines my lso represent effetive o-first line therpeuti gents, sine the speifi tivtion, reruitment nd funtion of nti-dlk1 T effetor ells in the TME would e ntiipted to e improved y the odministrtion of ntingiogeni tyrosine kinse inhiitor tht redue suppressor ell popultions (most notly in RCC ptients) nd tivte proinflmmtory TME in vivo. 26,46,47 Bsed on these expettions, we pln to evlute the omprtive therpeuti effiy of omined sunitini + lvdlk1 vintion tretment in our existing s.. RENCA model, s well s, in n orthotopi RCC model using RENCA.lu (RENCA ells trnsdued with luiferse DNA) to llow for vitl ioluminesene monitoring of tumor growth nd metstsis. Although we hve not oserved signs of off-trget utoimmune pthology s onsequene of DLK1-trgeted vintion (i.e., inhiition of utneous wound heling, 14 tissue vsulitis; dt not shown) to dte, these new models will provide us with dditionl opportunities to investigte potentil omintion tretment-ssoited toxiities in future. Consistent with our findings in the RENCA model, periytes from freshly isolted humn RCC (ut not ptient-mthed norml djent kidney tissue) lso differentilly (over)express the DLK1 ntigen in situ (Supplementry Figure S2). When oupled with the knowledge tht nti-dlk1 CD8 + T ell responses n e developed from humn ner ptients fter in vitro sensitiztion, 24 we elieve tht DLK1-sed vines (s single gents or in omintion pprohes) represent ttrtive ndidtes for linil trnsltion in the setting of RCC nd lternte well-vsulrized forms of solid ner. MATERIALS AND METHODS Mie. Femle 6 8 weeks old BALB/ mie (The Jkson Lortory, Br Hror, ME) were mintined in pthogen-free niml fility, with ll niml work performed in ordne with n Institutionl Animl Cre nd Use Committee-pproved protool. Tumor ells. The mouse RCC line RENCA derived from spontneous renl ortil denorinom in BALB/Cr mie (CRL-2947; Amerin Type Culture Colletion, Mnsss, VA) 22 ws ultured s previously reported. 15 Stroml ell isoltion. Humn RCC tumor nd djent (ptient-mthed) norml kidney speimens were otined with written-onsent under n Institutionl Review Bord-pproved protool. Murine RCC tumors nd tumor uninvolved kidneys were hrvested 21 dys fter s.. injetion of 1 6 RENCA ells into syngeni BALB/ reipient nimls. Tissues were disseted/mined, then enzymtilly digested, with periytes nd VEC isolted y flow sorting s previously desried, 14 with one modifition. Speifilly, murine ells were leled with nti-mouse CD34-FITC (ebiosiene, Sn Diego, CA), nti-mouse CD146-PE (BD-Biosienes, Sn Diego, CA), nd nti-mouse CD45-APC (BD-Biosienes) efore flow sorting into periyte (CD146 + CD34 neg CD45 neg ) nd VEC (CD146 + CD34 + CD45 neg ) popultions. 48,49 In ll ses, ells were >95% pure for the stted phenotype vol. 21 no. 1 ot. 213

10 Therpeuti Tumor Vsulr Normliztion Rel-time PCR. Messenger RNA ws isolted from periytes nd VEC using the RNesy Plus Miro kit (Qigen, Vleni, CA) ording to the mnufturer s instrutions. DNA ws then generted using High Cpity RNA-to-DNA kit (Applied Biosystems, Crlsd, CA) nd rel-time PCR performed using Fst SYBR Green Mster Mix (Applied Biosystems) with primer pirs for humn or mouse HPRT1 (Qigen), humn DLK1 (Applied Biosystems) or mouse DLK1 (forwrd primer: TGTGACCCCCAGTATGGATT, reverse primer: CCAGGGG CAGTTACACACTT). Retions were performed in duplite in 96-well retion plte on StepOnePlus rel-time PCR thermoyler (Applied Biosystems) using yling onditions of 95 C for 2 minutes, then 35 yles of 95 C for 3 minutes nd 6 C for 3 minutes. In vitro genertion of one mrrow-derived DC nd DC.IL12. DC were generted in 5-dy ril-4 + rgm-csf supplemented ultures from one mrrow preursors isolted from the tiis/femurs of BALB/ mie infeted with reominnt denovirus enoding mouse IL-12p7 (yielding DC.IL12), s previously desried. 24 Syntheti peptides. The H-2 d lss I-presented DLK (CPPGFSGNF; presented y H-2L d ), DLK (GFSGNFCEI; presented y H-2K d ), DLK (TILGVLTSLVVL; ontining overlpping DLK nd DLK sequenes presented y H-2K d ) peptide were synthesized s previously desried. 14 Reominnt lentivirl vetor prodution. Genes enoding mdlk1 nd the reverse sequene of mrgs5 (s negtive ontrol) were loned into the plenti6/v5 D-TOPO vetor downstrem of the ytomeglovirus promoter using the Lentivirl Diretionl TOPO Expression Kit (Invitrogen, Grnd Islnd, NY). To determine insert presene in the plsmid, expression of the V5 tg ws deteted y immunofluoresene using n nti-v5 FITC ntiody (Invitrogen) nd y western lot using n nti-v5 HRP ntiody (Invitrogen). In the initil prodution of the lentiviruses, 293FT ells (Invitrogen) were trnsfeted with plsmid DNA plenti-dlk1 (or plenti-neg) using VirPower Pkging Mix (Invitrogen) omined with Lipofetmine 2 (Invitrogen) ording to the mnufturer s instrutions. After 48 hours, lentivirus ws olleted nd onentrted using Fst-Trp Virus Purifition nd Conentrtion kit (Millipore, Billeri, MA). Lentivirl (lvdlk1 nd lvneg) titers, reported in trnsdution units, were determined y quntitting lstiidin (Invitrogen)-resistne in HT-18 ells (kindly provided y Dr Chunyue Wu, University of Pittsurgh, Pittsurgh, PA) ording to the mnufturer s instrutions. Expnded lentivirl prodution ws performed y the University of Pittsurgh Cner Institute Lentivirl Vetor Core Fility. Lentivirus qulity ws ssessed y infeting HT-18 ells for 24 hours nd monitoring ells for oordinte V5 protein expression (western lot) nd ell-surfe expression of DLK1 (flow ytometry using n nti-dlk1-pe onjugted ntiody; Adipogen, Sn Diego, CA). Animl therpy experiments. BALB/ mie reeived s.. injetion of 1 6 RENCA tumor ells (right flnk) on dy. Six dys lter, the nimls were rndomized into ohorts of five mie with omprle men tumor sizes. On dys 7 nd 14 fter tumor implnttion, mie were treted with 1 μl s.. injetions (left flnk) of PBS, 1 6 DC.IL12 or 1 6 DC.IL12 tht hd een pre-pulsed for 2 hours t 37 C with n equimolr (1 μmol/l) mixture of the DLK , DLK , nd DLK peptides. For lentivirus vintion experiments, rndomized BALB/ mie ering estlished (dy 1; right flnk) s.. RENCA tumors reeived single left flnk intrderml injetion of lvdlk1 or negtive ontrol lvneg t dose of or trnsdution units in totl volume of 5 μl PBS. For ll niml experiments, tumor size ws ssessed every 3 4 dys nd reorded in mm 2, s determined y the produt of orthogonl mesurements tken using vernier lipers. Dt re reported s men tumor re ± SD. To determine the impt of nonil NOTCH signling on vine effiy, tumor-ering nimls vinted with lvdlk1 or lvneg were injeted i.p. with the γ-seretse inhiitor DAPT (1 mg/kg/dy in 5 μl DMSO (Sigm-Aldrih, St Louis, MO) on three onseutive dys (followed y 4 dys without injetions) per week shedule, for 2 weeks eginning on dy 12 post-tumor inoultion) or vehile ontrol (DMSO). Evlution of speifi CD8 + T ell responses in vitro. Spleens were hrvested from three mie per group 7 dys fter the seond DC injetion. Splenoytes were then stimulted in vitro for 5 dys with syngeni DC pulsed with n equimolr (1 μmol/l) mix of the three DLK1 peptides pplied in the vine. Responder CD8 + T ells were then isolted using mgneti ed ell sorting (Miltenyi Biote, Auurn, CA) nd o-ultured with syngeni DC pulsed with individul DLK1 peptides for 72 hours, 37 C nd 5% CO 2, t whih time ell-free superntnts were nlyzed for mifn-γ ontent using ytokine-speifi ELISA (BD-Biosienes). Fluoresent imging of tumors. Tumor tissue smples were prepred nd setioned s previously reported. 15 Six miron tissue setions were nlyzed for expression of CD31 (BD-Biosienes), VCAM1 (R&D Systems, Minnepolis, MN), CXCL1 (R&D Systems), NG2 (Millipore), DLK1 (Snt Cruz Biotehnology, Snt Cruz, CA), RGS5, Jrid1 (ll from Am, Cmridge, MA), CD133 (BD-Biosienes), CD44 (Am), nd Hes1 (Millipore) y immunofluoresene mirosopy, with wide field imges olleted with fixed illumintion onditions using ooled CCD mer (Olympus Mgnfire; Olympus, Center Vlley, PA). Using Metmorph softwre (Moleulr Devies, Downingtown, PA), imges were thresholded to delinete signl ove kground nd individul strutures mesured s the integrtion of pixel numer (totl numer of positive pixels in the struture ove kground) multiplied y the rightness of eh pixel in gry sles. This produt provides the integrted pixel intensity of positive strutures nd is reported s the men integrted fluoresene intensity ± SD. For the nlysis of tivted VEC in the TME, ellulr identity ws first defined using o-loliztion of speifi mrkers (ells stining for oth CD31 nd VCAM-1) using imge overly nd mnul ounting. We found this method ws essentil to ensure ury in ell identifition in tissue with omplex morphologies. To perform the quntifition imges were overlid with Metmorph softwre nd o-lolized strutures tht ould e defined s ells were ounted. For nlysis of ellulr poptosis, tissue setions were leled using TUNEL kit (Rohe, Indinpolis, IN) s per the mnufturer s instrutions, followed y inution with seondry nti-streptvidin Cy3 ntiody (Jkson Immunoreserh, West Grove, PA). Some setions were nlyzed y onfol mirosopy to generte 3 μm 3D reonstrutions of imges. For the vsulr permeility imging, nimls reeived retro-oritl intrvenous injetions of FITC-leled tomto letin (Sigm-Aldrih) nd red 2 nm FluoSpheres (Invitrogen), followed y rdi perfusion of PBS nd 4% prformldehyde. Tumors were then immeditely reseted nd imged y onfol mirosopy to generte 17 μm 3D reonstrutions. In ll depited tissue imges, white ruler insets indite 5 μm (low mgnifition imges) or 1 μm (high mgnifition imges). Hemogloin quntittion. The mount of hemogloin ontined in tissues ws quntitted using the Drkin method 5 nd reported s μg hemogloin per mg wet weight of tissue. Mesurement of tumor hypoxi using pimonidzole. BALB/ mie ering estlished (treted or untreted) dy 21 s.. RENCA tumors were injeted i.p. with 6 mg/kg pimonidzole hydrohloride (Hypoxyproe; HPI, Burlington, MA) 3 minutes efore euthnsi nd tumor hrvest nd 6 μm tissue setions prepred nd nlyzed y immunohistohemistry s previously reported. 15 RNA purifition nd reverse trnsription-pcr rry. Totl RNA ws isolted from ulk single-ell suspensions of dy 21 tumors hrvested from lvneg- or lvdlk1-treted mie using Trizol regents (Invitrogen). Totl RNA ws further purified using the RNesy Plus Mini Kit (Qigen) inluding the gdna Elimintor spin olumn. The purity nd quntity of Moleulr Therpy vol. 21 no. 1 ot

11 Therpeuti Tumor Vsulr Normliztion the totl RNA ws ssessed using Nnodrop ND-1 (CelBio SpA, Miln, Itly). Totl RNA (1 μg) ws reversed trnsried into DNA using the RT2 First Strnd Kit (Qigen) nd the DNA dded to RT2 SYBR Green ROX qpcr Mstermix (Qigen) nd used for quntittive PCR using the RT2 Profiler PCR Arry (96-well) for Mouse Noth Signling Pthwy (Qigen) ll ording to the mnufturer s instrutions. Retions were performed on StepOnePlusTM Rel-Time PCR thermoyler (Applied Biosystems) using the reommended yling onditions. All mrna expression levels were normlized to the expression of GAPDH. Sttistil nlysis. Comprisons etween groups were performed using two-tiled Student s t-test or one-wy nlysis of vrine with Tukey s post-ho nlysis, s indited. All dt were nlyzed using SigmStt softwre, version 3.5 (Systt Softwre, Chigo, IL). Differenes etween groups with P vlue <.5 were onsidered signifint. SUPPLEMENTARY MATERIAL Figure S1. Prodution of reominnt lvdlk1 nd ontrol lvneg lentiviruses. Figure S2. DLK1 is differentilly (over)expressed y humn RCCssoited periytes. ACKNOWLEDGMENTS The uthors thnk Adrin Lrregin (University of Pittsurgh) for her reful review nd useful disussions provided during the preprtion of this mnusript. This work ws supported y Ntionl Institutes of Helth (NIH) grnts P1 CA19688 nd R1s CA11471, CA14375, nd CA (to W.J.S.). This projet used the UPCI Vetor nd Lentivirl Core Filities supported y the University of Pittsurgh s NIH CCSG wrd P3 CA4794. The uthors delred no onflit of interest. REFERENCES 1. Gerhrdt, H nd Sem, H (28). Periytes: gtekeepers in tumour ell metstsis? J Mol Med 86: Morikw, S, Bluk, P, Kidoh, T, Hskell, A, Jin, RK nd MDonld, DM (22). Anormlities in periytes on lood vessels nd endothelil sprouts in tumors. Am J Pthol 16: Gengel, K, Genové, G, Armulik, A nd Betsholtz, C (29). Endothelil-murl ell signling in vsulr development nd ngiogenesis. Arteriosler Throm Vs Biol 29: Fukumur, D, Dud, DG, Munn, LL nd Jin, RK (21). Tumor mirovsulture nd miroenvironment: novel insights through intrvitl imging in pre-linil models. Miroirultion 17: Finke, JH, Tus, R, Connelly, B, Pontes, E nd Montie, J (1988). Tumor-infiltrting lymphoytes in ptients with renl-ell rinom. Ann N Y Ad Si 532: Muul, LM, Spiess, PJ, Diretor, EP nd Rosenerg, SA (1987). Identifition of speifi ytolyti immune responses ginst utologous tumor in humns ering mlignnt melnom. J Immunol 138: Lokih, J (1997). Spontneous regression of metstti renl ner. Cse report nd literture review. Am J Clin Onol 2: Motzer, RJ nd Bukowski, RM (26). Trgeted therpy for metstti renl ell rinom. J Clin Onol 24: Esudier, B, Roigs, J, Gillessen, S, Hrmenerg, U, Srinivs, S, Mulder, SF et l. (29). Phse II study of sunitini dministered in ontinuous one-dily dosing regimen in ptients with ytokine-refrtory metstti renl ell rinom. J Clin Onol 27: Njjr, YG nd Rini, BI (212). Novel gents in renl rinom: relity hek. Ther Adv Med Onol 4: Helfrih, I, Sheffrhn, I, Brtling, S, Weis, J, von Felert, V, Middleton, M et l. (21). Resistne to ntingiogeni therpy is direted y vsulr phenotype, vessel stiliztion, nd mturtion in mlignnt melnom. J Exp Med 27: Vujnovi, L nd Butterfield, LH (27). Melnom ner vines nd nti-tumor T ell responses. J Cell Biohem 12: Ahmed, F, Steele, JC, Herert, JM, Steven, NM nd Biknell, R (28). Tumor strom s trget in ner. Curr Cner Drug Trgets 8: Zho, X, Bose, A, Komit, H, Tylor, JL, Chi, N, Lowe, DB et l. (212). Vines trgeting tumor lood vessel ntigens promote CD8(+) T ell-dependent tumor erdition or dormny in HLA-A2 trnsgeni mie. J Immunol 188: Komit, H, Zho, X, Tylor, JL, Sprvero, LJ, Amosto, AA, Aler, S et l. (28). CD8+ T-ell responses ginst hemogloin-et prevent solid tumor growth. Cner Res 68: Hung, YH, Lin, YH, Chi, HC, Lio, CH, Lio, CJ, Wu, SM et l. (213). Thyroid hormone regultion of mir-21 enhnes migrtion nd invsion of heptom. Cner Res 73: Jin, RK (25). Normliztion of tumor vsulture: n emerging onept in ntingiogeni therpy. Siene 37: Hmzh, J, Jugold, M, Kiessling, F, Rigy, P, Mnzur, M, Mrti, HH et l. (28). Vsulr normliztion in Rgs5-defiient tumours promotes immune destrution. Nture 453: Rngnthn, P, Wever, KL nd Cpoino, AJ (211). Noth signlling in solid tumours: little it of everything ut not ll the time. Nt Rev Cner 11: Flix, FA, Aronson, DC, Lmers, WH nd Gemers, IC (212). Possile roles of DLK1 in the Noth pthwy during development nd disese. Biohim Biophys At 1822: Begum, A, Kim, Y, Lin, Q nd Yun, Z (212). DLK1, delt-like 1 homolog (Drosophil), regultes tumor ell differentition in vivo. Cner Lett 318: Murphy, GP nd Hrushesky, WJ (1973). A murine renl ell rinom. J Ntl Cner Inst 5: Stllup, WB (22). The NG2 proteoglyn: pst insights nd future prospets. J Neuroytol 31: Zho, X, Bose, A, Komit, H, Tylor, JL, Kwe, M, Chi, N et l. (211). Intrtumorl IL-12 gene therpy results in the rosspriming of T1 ells retive ginst tumorssoited stroml ntigens. Mol Ther 19: Sski, K, Zhu, X, Vsquez, C, Nishimur, F, Dusk, JE, Hung, J et l. (27). Preferentil expression of very lte ntigen-4 on type 1 CTL ells plys ritil role in trffiking into entrl nervous system tumors. Cner Res 67: Bose, A, Tylor, JL, Aler, S, Wtkins, SC, Gri, JA, Rini, BI et l. (211). Sunitini filittes the tivtion nd reruitment of therpeuti nti-tumor immunity in onert with speifi vintion. Int J Cner 129: He, Y, Zhng, J, Donhue, C nd Flo, LD Jr (26). Skin-derived dendriti ells indue potent CD8(+) T ell immunity in reominnt lentivetor-medited geneti immuniztion. Immunity 24: Mtsumoto, S, Ysui, H, Btr, S, Kinoshit, Y, Bernrdo, M, Munsinghe, JP et l. (29). Simultneous imging of tumor oxygention nd mirovsulr permeility using Overhuser enhned MRI. Pro Ntl Ad Si USA 16: Wilson, WR nd Hy, MP (211). Trgeting hypoxi in ner therpy. Nt Rev Cner 11: Crs, SM, Mthews, LA nd Frrr, WL (211). The ner stem ell nihe there goes the neighorhood? Int J Cner 129: Lévesque, JP, Winkler, IG, Hendy, J, Willims, B, Helwni, F, Brier, V et l. (27). Hemtopoieti progenitor ell moiliztion results in hypoxi with inresed hypoxiinduile trnsription ftor-1 lph nd vsulr endothelil growth ftor A in one mrrow. Stem Cells 25: Roesh, A, Fukung-Klis, M, Shmidt, EC, Zierowski, SE, Brfford, PA, Vultur, A et l. (21). A temporrily distint supopultion of slow-yling melnom ells is required for ontinuous tumor growth. Cell 141: Ling, D, M, Y, Liu, J, Trope, CG, Holm, R, Neslnd, JM et l. (212). The hypoxi miroenvironment upgrdes stem-like properties of ovrin ner ells. BMC Cner 12: Mthieu, J, Zhng, Z, Zhou, W, Wng, AJ, Heddleston, JM, Pinn, CM et l. (211). HIF indues humn emryoni stem ell mrkers in ner ells. Cner Res 71: Lory, C, Oh, P nd Aifntis, I (211). Onogeni nd tumor suppressor funtions of Noth in ner: it s NOTCH wht you think. J Exp Med 28: Sh, B, Jyothi Prsnn, S, Chndrsekr, B nd Nndi, D (21). Gene modultion nd immunoregultory roles of interferon gmm. Cytokine 5: Mizuno, T, Ngo, M, Ymd, Y, Nrikiyo, M, Ueno, M, Miygishi, M et l. (26). Smll interfering RNA expression vetor trgeting hypoxi-induile ftor 1 lph inhiits tumor growth in heptoiliry nd pnreti ners. Cner Gene Ther 13: Keith, B, Johnson, RS nd Simon, MC (212). HIF1 nd HIF2: siling rivlry in hypoxi tumour growth nd progression. Nt Rev Cner 12: Reis, M, Czupll, CJ, Ziegler, N, Devrj, K, Zinke, J, Seidel, S et l. (212). Endothelil Wnt/ß-tenin signling inhiits gliom ngiogenesis nd normlizes tumor lood vessels y induing PDGF-B expression. J Exp Med 29: Ueno, K, Hirt, H, Hinod, Y nd Dhiy, R (213). Frizzled homolog proteins, mirornas nd Wnt signling in ner. Int J Cner 132: Wng, Y nd Sul, HS (26). Etodomin shedding of predipoyte ftor 1 (Pref-1) y tumor nerosis ftor lph onverting enzyme (TACE) nd inhiition of dipoyte differentition. Mol Cell Biol 26: Zhng, J, Fukuhr, S, Sko, K, Tkenouhi, T, Kitni, H, Kume, T et l. (211). Angiopoietin-1/Tie2 signl ugments sl Noth signl ontrolling vsulr quiesene y induing delt-like 4 expression through AKT-medited tivtion of et-tenin. J Biol Chem 286: Pérez-Cezs, B, Nrnjo-Gómez, M, Bstos-Amdor, P, Requen-Fernández, G, Pujol-Borrell, R nd Borràs, FE (211). Ligtion of Noth reeptors in humn onventionl nd plsmytoid dendriti ells differentilly regultes ytokine nd hemokine seretion nd modultes Th ell polriztion. J Immunol 186: Rini, BI nd Atkins, MB (29). Resistne to trgeted therpy in renl-ell rinom. Lnet Onol 1: Fivre, S, Demetri, G, Srgent, W nd Rymond, E (27). Moleulr sis for sunitini effiy nd future linil development. Nt Rev Drug Disov 6: Finke, JH, Rini, B, Irelnd, J, Rymn, P, Rihmond, A, Golshyn, A et l. (28). Sunitini reverses type-1 immune suppression nd dereses T-regultory ells in renl ell rinom ptients. Clin Cner Res 14: Ozo-Choy, J, M, G, Ko, J, Wng, GX, Mesek, M, Sung, M et l. (29). The novel role of tyrosine kinse inhiitor in the reversl of immune suppression nd modultion of tumor miroenvironment for immune-sed ner therpies. Cner Res 69: Treviño-Villrrel, JH, Cotnhe, DA, Sepúlved, R, Bortoni, ME, Mnneerg, O, Udgw, T et l. (211). Host-derived periytes nd S-1+ ells predominte in the MART-1- strom frtion of experimentlly indued melnom. J Histohem Cytohem 59: Crisn, M, Corselli, M, Chen, WC nd Péult, B (212). Perivsulr ells for regenertive mediine. J Cell Mol Med 16: Klungsøyr, L nd Stø, KF (1954). Spetrophotometri determintion of hemogloin oxygen sturtion: the method of Drkin & Shmidt s modified for its use in linil routine nlysis. Snd J Clin L Invest 6: vol. 21 no. 1 ot. 213