GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin"

Transcription

1 Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq Supplemental Fig. 1. Loss of reduces autophagy activity. (a) PC3 cells were treated with antisense OGX11 or scrambled antisense (ScrB) followed with 1 μm MG132or1μM AZD5363 treatments for 6 hrs with or without CQ. Whole protein lysates were collected for western blot against and. (b) Heart tissues from mice treated as in figure 2f were collected to prepare whole protein lysates. and GFP protein levels were analyzed using western blots. The lower bands from GFP blots represent GFPII protein.

2 Supplementary Fig. 2 a CQ CCCPCQ CQ CCCP I II siscr PC3 cells si si siscr % of cells with more than puncta CQ CCCPCQ siscr si b CQ CCCP I II vector LNCaP cells vector CQ CCCPCQ % of cells with more than puncta CQ CCCPCQ vector Supplemental Fig. 2. modulates mitophagy. (a) PC3 cells transfected with si or ctrl siscr were treated with mitophagy inducer carbonyl cyanide mchlorophenylhydrazone (CCCP) with or without CQ for 6 hrs. Autophagy activity was analyzed using western blot and puncta assay. Scale bar: 5 μm. (b) LNCaP cells overexpressing or vector alone were treated with CCCP for 24 hours with or without CQ. Autophagy activity wasmeasuredas(a). Scale bar: 5 μm. For all panels, p<.5 (Student s twotailed ttest of three experiments). Error bars: s.e.m of at least three experiments.

3 Supplementary Fig. 3 a CQ StarvationCQ MG132CQ CQ StarvationCQ MG132CQ b c Prebleach Bleach t=5s Recovery t=s Recovery mobile factor Ref. protein Htt si siscr vector PC3 cells LNCaP cells Prebleach Bleach t=5s Recovery t=s Recovery intensity, % Nonbleached Time (s) bleached Time (s) intensity, % d Clu Htt Ref. CHX MG CQ actin Relative level of mrna Htt intensity, % Time (s) Ref. prot. intensity, % Time (s) Ctrl CQ MG CHX CHX CQ CHX MG

4 Supplementary Fig. 3 Supplemental Fig. 3. colocalizes and moves together with II. (a) PC3 cells (left panel) treated with si or siscr were transfected with GFP plasmid followed by starvation CQ or MG132 CQ for 6 hrs. LNCaP cells overexpressing or vector alone (right panel) were treated for 24 hrs. GFP puncta were analyzed under confocal microscopy. Scale bar: 5 μm. (b) PC3 cells were transfected with GFP and RFP followed by starvation for 2 hrs. Cells were then examined under microscope and the live images were taken every 5 seconds for 3 minutes. (c) PC3 cells transfected with GFPtagged proteins were starved for 2 hrs and then applied for FRAP assay. The fluorescence of GFP proteins was shown, and the mobile factors were calculated with the software ZEN21 from Carl Zeiss from at least 5 cells for each samples. The red box represented the bleached region. GFPtagged mutated huntingtin (Htt) and a reference GFPtagged protein were included as control. p<.1 (Student s twotailed ttest of three experiments). Error bars: s.e.m of at least three experiments. Scale bar: 5 μm. (d) PC3 cells were treated with 1 μm MG132 (MG) or 1 μm CQ with or without cycloheximide (CHX) for 6 hrs. Protein lysates were collected for analysis on. In the right panel, mrna was prepared for the quantitativepcr assay on. p<.5 (Student s twotailed ttest of three experiments). Error bars: s.e.m of at least three experiments.

5 Supplementary Fig. 4 Wild type Y235A/L238A Y341A/L344A W35A/L353A F366A/V369A Y383A/V386A, DsRed LAMP1, green DAPI, blue Supplemental Fig. 4. LIR mutant does not bind to LAMP1. PC3 cells were transfected with DsRed labeledwild type or mutant followed by 4 hrs treatment with 1 μm MG132 with CQ. LAMP1 immunofluorescence staining (green) was performed. Images were scanned using LSM78 confocal microscope. Scale bar: 5 μm.

6 Supplementary Fig. 5 a MG132 cparp actin 1 Fold induction of CPARP 8 ctrl MG b % of pre G1 population ctrl MG132 siscr si siscr si CPARP I II ctrl MG132 1 c % of pre G1 population siscr FBS SF siclu siscr si CPARP I II FBS Serum free 1 % of pre G1 population siscr FBS siatg3 SF siscr siatg3 Atg3 CPARP I II FBS Serum free 1 d Tumor Volume (mm 3 ) ScrB paclitaxel Taxol ScrBTaxol paclitaxel OGX11Taxol paclitaxel e Percent survival ScrB ScrBpaclitaxel paclitaxel 5 OGX11 paclitaxel Weeks after treatment Survival days f I II culin ScrB ScrB paclitaxel ScrBpaclitaxel OGX11paclitaxel paclitaxel ScrB paclitaxel Relative levels of II OGX11 paclitaxel g Relative body weight ScrB ScrBTaxol paclitaxel Taxol paclitaxel OGX 11Taxol paclitaxel week

7 Supplementary Fig. 5 Supplemental Fig. 5. mediates cytoprotection in an autophagydependent manner and inhibition sensitizes autophagyinducing treatments. (a) LNCaP cells expressing wild type or mutants were treated with MG132 for 24 hours. Whole protein lysates were collected to check protein levels of and cleavedparp (CPARP). Levels of CPARP were quantified and fold of induction compared to ctrl were shown in the right panel. p<.5 (Student s twotailed ttest of three experiments). Error bars: s.e.m of at least three experiments. (b) PC3 cells transfected with si or siscr were treated with MG132 for 24 hours. Cell death was investigated using FACS to analyze the preg1 population on the left panel. p<.1 (Student s twotailed ttest of three experiments). Autophagy level and cell death status were examined using western blot against and cleaved PARP (right panel). (c) In the left panel, was knocked down in PC3 cells followed by serum starvation (serum free) treatment. Autophagy activation and cell death were investigated as (b). In the right panel, PC3 cells were treated with siatg3 or siscr followed by serum starvation. Autophagy activation and cell death were investigated as in the left panel. p<.1 (Student s twotailed ttest of three experiments). (d) When PC3 xenografts reached 1mm 3,micewere treated with ScrB, paclitaxel, ScrBpaclitaxel, or OGX11paclitaxel for 12 weeks. Tumor volumes were measured weekly and calculated by length x width x depth x p<.5 (Student s twotailed ttest). (e) Kaplan Meier survival curves of mice treated as in (d), n=1. p=.1, logrank test. (f) Western blot analysis on and II from tumor protein lysates. II protein levels were quantified after balanced with culin. p<.5 (Student s twotailed ttest). (g) Body weights of mice treated in (d) were measured weekly and were presented as relative body weight as compared to the first week s measurement. No significant differences cross groups were detected.

8 Supplementary Fig. 6 Fig. 1a culin culin ctrl MG132 rapamycin AZD5363 CSS 35 MG Supplemental Fig. 6. Original immunoblot data. The numbers besides the black arrows show the molecular weight ().

9 Supplementary Fig. 6 Fig. 2a starve rapamycin MG132 AZD5363 Supplemental Fig. 6. Original immunoblot data. Continued.

10 Supplementary Fig. 6 Fig. 3a MG132 CSS culin rapamycin AZD culin Supplemental Fig. 6. Original immunoblot data. Continued.

11 Supplementary Fig. 6 Fig. 4e, CTRL, MG132 LAMP1, CTRL LAMP1, MG132, CTRL, MG132 Supplemental Fig. 6. Original immunoblot data. Continued.

12 Supplementary Fig. 6 Fig. 5b Atg3 actin Fig. 5c&d IP: Atg3 IB: Atg3 IP: Atg3 IB: GFP IP: Atg3 IB: IP: Atg3 IB: Supplemental Fig. 6. Original immunoblot data. Continued.

13 Supplementary Fig. 6 Fig. 6c GFP 25 Actin Supplemental Fig. 6. Original immunoblot data. Continued.

14 Supplementary Table 1. Primers used for subcloning of wild type and mutants wild type forward 5'tttaagcttatgatgaagactctgct3' backward 5'tggatccttctcctcccggtgctt3' Y235A/L238A forward 5'gcccttctctccggccgagcccgcgaacttccacgcc3' Backward 5'ggcgtggaagttcgcgggctcggccggagagaagggc3' Y341A/L344A forward 5'gctgagaggttgaccaggaaagccaacgaggcgctaaagtcctaccag3' Backward W35A/L353A forward Backward 5'ctggtaggactttagcgcctcgttggctttcctggtcaacctctcagc3' 5'ctgctaaagtcctaccaggcgaagatggccaacacctcctccttgct3' 5'agcaaggaggaggtgttggccatcttcgcctggtaggactttagcag3' F366A/V369A forward 5'gctgaacgagcaggctaactgggcgtcccggctggca3' Backward 5'tgccagccgggacgcccagttagcctgctcgttcagc3' Y383A/V386A forward 5'cgaagaccagtacgctctgcgggccaccacggtggct3' backward 5'agccaccgtggtggcccgcagagcgtactggtcttcg3'

15 Supplementary methods Livecell imaging. GFP and RFP plasmids were cotransfected into PC3 cells cultured on a glassbase culture dish and maintained in phenolred free DMEM containing 1% fetal calf serum. 24 hours later, cells were starved with HBSS/Hepes for 2 hours and then being imaged with LSM78 microscope under 63X 1. oil PlanApochromat DIC M27 Zeiss objective at 4.8X digital zoom. Live images were taken every 5 seconds and the movie shown here is a 9 seconds film. Fluorescence recovery after photobleaching (FRAP). PC3 cells cultured on a glassbase culture dish were transfected with GFPtagged proteins. Imaging were captured every.2 seconds using a 63X 1. oil PlanApochromat DIC M27 Zeiss objective at 1X digital zoom. After 1 cycles, the red frame region was photobleached with 1% laser power for repetitively scanning for times. After that, images were collected every.2 seconds during the recovery phase for a total of seconds. The fluorescence of a nonbleached region was also captured from the same field for reference purpose. The mobile factor was calculated by comparing the fluorescence intensity of the bleached region to the nonbleached region by the software ZEN21 from Zeiss (Thornwood, NY). In vivo tumor growth and Kaplan Meier Survival Analysis. PC3 cells (6 million) were inoculated s.c. in the flank of 6 to 8weekold male athymic nude mice (Harlan Sprague Dawley, Inc.) via a 27gauge needle under isoflurane anesthesia. When PC3 tumors reached 1 mm 3, mice were randomly selected for treatments of scramble (ScrB), paclitaxel, ScrBpaclitaxel, or OGX11paclitaxel. Paclitaxel (.5mg/kg) was injected i.p. to mice three times a week for every

16 two weeks; and OGX11 or ScrB ( mg/kg) was injected i.p. once daily for 7 days and then three times per week thereafter. Tumor volume measurements were performed weekly and calculated by the formula length x width x depth x Data points were expressed as average tumor volume ± s.e.m. All animal procedures were performed according to the guidelines of the Canadian Council on Animal Care and with appropriate institutional certification. The Kaplan Meier survival curve with logrank analysis was performed using GraphPad Prism (version 4. for Windows, GraphPad Software, San Diego California USA).

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

MELANOMA CANCER TEST

MELANOMA CANCER TEST MELANOMA CANCER TEST Efficacy Evaluation of Antitumor Activity of Alka Vita - Alkahydroxy in the LOX-GFP Human Melanoma Model Final Report by: Anti-Cancer Lab San Diego California March 4, 2005 Efficacy

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Lu et al., http://www.jcb.org/cgi/content/full/jcb.201012063/dc1 Figure S1. Kinetics of nuclear envelope assembly, recruitment of Nup133

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome

Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome Paola Scaffidi & Tom Misteli Hutchinson-Gilford progeria syndrome (HGPS) is a childhood premature

More information

Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma

Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma The Harvard community has made this article openly available. Please share

More information

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in

More information

Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity. Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai,

Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity. Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai, Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity independently of the LKB1 AMPK pathway Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai, Wen-Pin Su, Helen

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Figure 1: Lgr5 expression in liver was induced by CCL4 and decreased after liver recovery. Mice were treated with single dose of CCL4

Supplementary Figure 1: Lgr5 expression in liver was induced by CCL4 and decreased after liver recovery. Mice were treated with single dose of CCL4 Supplementary Figure 1: Lgr5 expression in liver was induced by CCL4 and decreased after liver recovery. Mice were treated with single dose of CCL4 or control oil, the livers were collected at various

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Correction notice Termination of autophagy and reformation of lysosomes regulated by mtor Li Yu, Christina K. McPhee, Lixin Zheng, Gonzalo A. Mardones, Yueguang Rong, Junya Peng, NaMi, Ying Zhao, Zhihua

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

Supplementary Information

Supplementary Information Supplementary Information Recruitment of Mesenchymal Stem Cells Into Prostate Tumours Promotes Metastasis Younghun Jung 1, Jin Koo Kim 1, Yusuke Shiozawa 1, Jingcheng Wang 1, Anjali Mishra 1, Jeena Joseph

More information

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii

Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii María Lázaro-Díez, Itziar Chapartegui-González, Santiago Redondo-Salvo, Chike Leigh, David Merino, David San Segundo, Jesús

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Inhibition of the autophagic flux by salinomycin in breast cancer stem-like/progenitor cells interferes with their maintenance

Inhibition of the autophagic flux by salinomycin in breast cancer stem-like/progenitor cells interferes with their maintenance Autophagy ISSN: 1554-8627 (Print) 1554-8635 (Online) Journal homepage: http://www.tandfonline.com/loi/kaup20 Inhibition of the autophagic flux by salinomycin in breast cancer stem-like/progenitor cells

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

Kristiina Kanerva, Riikka-Liisa Uronen, Tomas Blom, Shiqian Li, Robert Bittman, Pekka Lappalainen, Johan Peränen, Graça Raposo, and Elina Ikonen

Kristiina Kanerva, Riikka-Liisa Uronen, Tomas Blom, Shiqian Li, Robert Bittman, Pekka Lappalainen, Johan Peränen, Graça Raposo, and Elina Ikonen Developmental Cell, Volume 27 Supplemental Information LDL Cholesterol Recycles to the Plasma Membrane via a Rab8a-Myosin5b-Actin- Dependent Membrane Transport Route Kristiina Kanerva, Riikka-Liisa Uronen,

More information

Tumor-secreted mir-214 induces regulatory T cells: a major link between immune evasion and tumor growth

Tumor-secreted mir-214 induces regulatory T cells: a major link between immune evasion and tumor growth ORIGINAL ARTICLE Cell Research (2014) 24:1164-1180. 2014 IBCB, SIBS, CAS All rights reserved 1001-0602/14 www.nature.com/cr npg Tumor-secreted mir-214 induces regulatory T cells: a major link between immune

More information

CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and

CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and SUPPLEMENTAL FIGURES FIGURE S1. Detection of MCs. A, Schematic representation of T cells stimulated on anti- CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and microclusters.

More information

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina

More information

Supporting Information

Supporting Information Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected

More information

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Amin Feizpour Reinhard Lab Department of Chemistry and the Photonics Center, Boston University, Boston, MA May 2014

More information

gliomas. Fetal brain expected who each low-

gliomas. Fetal brain expected who each low- Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

The role of the scaffolding protein Tks5 in EGF signaling

The role of the scaffolding protein Tks5 in EGF signaling The role of the scaffolding protein Tks5 in EGF signaling PhD Thesis Anna Fekete Doctoral School in Biology Head of the School: Dr. Anna Erdei Structural Biochemistry Doctoral Program Head of the Program:

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells

Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Research article Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Paul T. Brinkkoetter, 1 Paul Olivier, 2 Jimmy S. Wu, 1 Scott Henderson, 1 Ronald D. Krofft,

More information

Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells

Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells Wang et al. BMC Cancer 2014, 14:37 RESEARCH ARTICLE Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells Harris Wang 1, The Vo 1, Ali Hajar

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/305/ra106/dc1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway

More information

Many G protein-coupled receptors (GPCRs) 2 are rapidly endocytosed after agonist binding, but the pathway of postendocytic

Many G protein-coupled receptors (GPCRs) 2 are rapidly endocytosed after agonist binding, but the pathway of postendocytic THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 40, pp. 29646 29657, October 5, 2007 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Hepatocyte Growth

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Nucleocytoplasmic Shuttling of Bovine Herpesvirus 1 UL47 Protein in Infected Cells

Nucleocytoplasmic Shuttling of Bovine Herpesvirus 1 UL47 Protein in Infected Cells JOURNAL OF VIROLOGY, Jan. 2006, p. 1059 1063 Vol. 80, No. 2 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.2.1059 1063.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Nucleocytoplasmic

More information

Supplemental Information. Melanopsin-Encoded Response Properties. of Intrinsically Photosensitive. Retinal Ganglion Cells

Supplemental Information. Melanopsin-Encoded Response Properties. of Intrinsically Photosensitive. Retinal Ganglion Cells Neuron, Volume 90 Supplemental Information Melanopsin-Encoded Response Properties of Intrinsically Photosensitive Retinal Ganglion Cells Ludovic S. Mure, Megumi Hatori, Quansheng Zhu, James Demas, Irene

More information

El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Involvement of urinary bladder Connexin43 and the circadian clock in the coordination of diurnal micturition rhythm Hiromitsu Negoro, 1,2 Akihiro Kanematsu, 1,3 Masao Doi,

More information

EMBO. A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mtor and TFEB EMBO. open

EMBO. A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mtor and TFEB EMBO. open (2012), 1 14 Some Rights Reserved 0261-4189/12 www.embojournal.org A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mtor and TFEB THE EMBO JOURNAL EMBO open Carmine Settembre

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy Jonathan Zirin 1 *, Joppe Nieuwenhuis 1, Norbert Perrimon 1,2 * 1 Department of Genetics, Harvard Medical School, Boston,

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

WT Xid (h) poly(da:dt) Alum. Poly(dA:dT) 0.05

WT Xid (h) poly(da:dt) Alum. Poly(dA:dT) 0.05 IL1 (ng/ml) (1 x 1 3 cells) DMSO LFMA13 R46 IL1 (ng/ml) Control shrna TNFa (ng/ml) Alum Nigericin ATP IL1 (ng/ml) IL1 (ng/ml) IL1 (ng/ml) a c f 3 2 1 1 8 6 4 2 Sup 1 8 6 4 DMSO Alum/DMSO Alum/LFMA13 ***

More information

Inhibition of IRAK1/4 sensitizes T cell acute lymphoblastic leukemia to chemotherapies

Inhibition of IRAK1/4 sensitizes T cell acute lymphoblastic leukemia to chemotherapies Inhibition of IRAK1/4 sensitizes T cell acute lymphoblastic leukemia to chemotherapies Zhaoyang Li, 1 Kenisha Younger, 2 Ronald Gartenhaus, 2,3 Ann Mary Joseph, 2 Fang Hu, 2 Maria R. Baer, 2,3 Patrick

More information

Self-inflicted DNA double-strand breaks sustain tumorigenicity and stemness of cancer cells

Self-inflicted DNA double-strand breaks sustain tumorigenicity and stemness of cancer cells ORIGINAL ARTICLE Cell Research (2017) 27:764-783. www.nature.com/cr Self-inflicted DNA double-strand breaks sustain tumorigenicity and stemness of cancer cells Xinjian Liu 1, Fang Li 1, Qian Huang 2, Zhengxiang

More information

without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.

without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/. Sakatani et al. 1 Supporting Online Material Materials and methods Mice and genotyping: H19 mutant mice with C57BL/6J background carrying a deletion in the structural H19 gene (3 kb) and 10 kb of 5 flanking

More information