Highly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe
|
|
- Beverley Short
- 5 years ago
- Views:
Transcription
1 Supporting Information Highly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe Shengnan He, Long Qu, Zhifa Shen, Ying Tan, Meiyun Zeng, Feng Liu *, and Yuyang Jiang ǁ *, Yingfu Li Department of Chemistry, Tsinghua University, Beijing, , China The Ministry-Province Jointly Constructed Base for State Key Lab- Shenzhen Key Laboratory of Chemical Biology, the Graduate School at Shenzhen, Tsinghua University, Shenzhen, Guangdong, , China Department of Biochemistry and Biomedical Sciences, McMaster University, 1280 Main St. W, Hamilton, ON L8S 4K1, Canada Shenzhen Kivita Innovative Drug Discovery Institute, Shenzhen, Guangdong, China ǁ Department of Pharmacology and Pharmaceutical Sciences, School of Medicine, Tsinghua University, Beijing, , China. address: S-1
2 Scheme S1. SELEX Scheme. The initial DNA library was ligated to the phosphorylated substrate. After incubating with MDA-MB-231 lysate, the catalytically active molecules will cleave the RNA linkage. These molecules will be purified from the uncleaved DNA by 10% dpage. PCR1 was performed to amplify the purified DNA. This is followed by PCR2 using a primer containing an nonamplifiable tag to assist the purification of the desirable DNA strand for the next round of selection. S-2
3 Scheme S2. Recognition of breast tumor target with the RNA-cleaving fluorogenic probe. Conceptual design of the fluorescent probe which can be activate by the target in MDA-MB-231 cell lysate to generate a robust fluorescent signal. S-3
4 Figure S1. Time-dependence reaction of R28 pool incubated with MDA-MB-231 cell lysate. Each sample contained 50 µg/ml protein and 100 nm R28 pool. Clv% = cleavage efficiency; Unclv = uncleaved probe; Clv = cleaved probe. S-4
5 Figure S2. Specificity test of RFD candidates to various breast cell lines. From the top to the bottom are AAI1-1, AAI1-4, AAI2-1, AAI2-4, AAI2-5, AAI2-6 and AAI2-9. Each reaction mixture was analyzed by 10% dpage, followed by fluorimaging. Clv% = cleavage efficiency; NC = negative control. Unclv = uncleaved probe. Clv = cleaved probe. S-5
6 Figure S3. Specificity test of RFD candidates to different cell lines. From the top to the bottom are AAI1-1, AAI1-4, AAI2-1, AAI2-4, AAI2-5, AAI2-6 and AAI2-9. Each reaction mixture was analyzed by 10% dpage, followed by fluorimaging. Clv% = cleavage efficiency; NC = negative control; Unclv = uncleaved probe; Clv = cleaved probe. S-6
7 Figure S4. Western blot of each clinical specimens by detection of β-actin. S-7
8 Figure S5. A 96-well microplate assay of AAI2-5 with clinical specimens. Each sample contained 50 nm probe and 100 µg/ml protein. Incubation time was 30 min. Dark, grey and unfilled circles stand for malignant breast tumor, benign breast tumor, and paracarcinoma or inflammatory tissue, respectively. No. = number of clinical specimens. S-8
9 Figure S6. Cleavage reaction of AAI2-5 with (A) Her-2, ER, PR human recombinant proteins, and (B) serum from breast tumor patients. NC is negative control and MD is MDA-MB-231 cells medium. S-9
10 Figure S7. Flow cytometry assay for the binding of the FAM-labeled sequence AAI2-5-82F (AAI2-5) and R0-82F (R0) with MDA-MB-231 cells (target cells) and MCF-10A cells (control cells). NC = negative control, which was cells incubated with AAI2-5-82F without treatment with fixation/permeabilization reagent. The concentration of the sequences was 100 nm. S-10
11 Figure S8. Fluorescence anisotropy of AAI2-5 incubated with protein above 50 kda from different cell lines. The concentration of probe was 5 nm, and the protein concentration was from 0 to 1300 µg/ml. The measurements were performed in triplicate. The K d values of AAI2-5 for MDA-MB-231 and MCF-10A were determined from a fit of equation mentioned in Experimental Section to these data as ± 8.4 µg/ml, ± µg/ml, respectively. The K d value of AAI2-5 for HEB cannot be determined by this method. S-11
12 Table S1. [Probe] 1/2 value of each probe. Name Selected N40 sequence Repeat times [Probe] 1/2 value AAI1-1 GGGAACGTGTGCTCGGCTATTGATTGGACTTTAGCGTTGG ± 5.1 AAI1-2 CGTAGGCGAAGGTCCGTGTGGGAATCCTTAGCGAGACAAGG ± 8.5 AAI1-3 CATAAATGGTCAGGTGACGTGTACGAAACCTTAGCGTATGG ± 87.8 AAI1-4 GGTCCTGAGAGATACTTTAGCGGTTAGGATACACGAGTGGG ± 3.1 AAI2-1 CAACGAGGGAGCCCTTGGAGAAGTTTAGCGTAGTGGTCGTG ± 2.1 AAI2-3 CACTACGACAGGATTCTGAGTATCGAGTACCTTAGCGTTGC ± 11.4 AAI2-4 GGGTAGTAGTCGAGAGAAGTTTAGCGTAGGCTCGCCGGGTC ± 3.0 AAI2-5 GGAACGGTTAGATCTGATACCTTAGCGAAGGTGTGGTTGGC ± 3.3 AAI2-6 GGATCTGTATCGTGGGAGAATTTTAGCGTCCGAAGCCTGGC ± 5.7 AAI2-7 GTACGGACTCTGAACGATAAGCTTAGCGATCCCGGAAGTGGC ± AAI2-8 GGACGATTGAGAAGTTTAGCGATCAGAAGATGTTGCCGTAGC ± 38.7 AAI2-9 GTGATGTGCTGGCGTATACTTTAGCGTGGATGAGGTCGTGG ± 5.4 AAI2-10 GCCCAAACTTGGAGGGGGGCAATGAGAATCCTTAGCGTGTG ± 11.9 AAI2-11 GGAGACGTGATAGAACTTTAGCGATAAGTAATTTGGATGTGC ± 21.8 AAI2-12 GGGGTACGTTTGATTGACAATCCTTAGCGATATCTGAGTGTG ± 23.3 S-12
13 Table S2 Cleavage efficiency of AAI2-5 and clinical specimens characterization. No. Clv% Source Type Immunohistochemistry cancer breast invasive ductual carcinoma ER (+/-), PR (+), Her-2 (+/-), CK5/6 (-), Ki-67 (+) 7% cancer breast invasive ductual carcinoma ER (++), PR (+++), Her-2 (+/++), Ki-67 (+) 40%-50% cancer breast invasive ductual carcinoma ER (+/-), PR (+/-), Ki-67 30% paracarcinoma breast invasive ductual carcinoma ER (++), PR (-), Her-2 (+++), CK5/6 (+), Ki-67 (+) 30%-40% paracarcinoma breast invasive ductual carcinoma ER (+), PR (+), Her-2 (-) cancer breast invasive ductual carcinoma;grade II ER (-), PR (-), Her-2 (+++), Ki % cancer breast invasive ductual carcinoma;grade II ER (+) 20%, PR (-), Her-2 (++),, P53 (+), Ki-67 (+) 20% cancer intracystic papillary carcinoma ER (+) 90%, PR (+) 70%, Her-2 (-), Ki-67 (+) 5% paracarcinoma breast invasive ductual carcinoma ER (++), PR (+), Her-2 (+), Ki-67 (+) 15% tumor breast fibroadenoma lymph breast invasive ductual carcinoma;grade II ER (+++), PR (++), Her-2 (+/++) tumor intraductal papilloma granulomatous lobular mastitis cancer breast invasive ductual carcinoma;grade II ER (-), PR(-), Her-2 (+++), Ki-67 15%, cancer breast invasive ductual carcinoma;grade II ER (+/++), PR (-), Her-2 (+++), Ki-67 5% granulomatous lobular mastitis cancer breast invasive ductual carcinoma;grade II ER (+), PR (-), Her-2 (+++), Ki-67 9%, cancer breast invasive ductual carcinoma;grade II ER (++) 60%, PR (++) 70%, Her-2 (+++), P53 (-), Ki-67< 10% (+) cancer breast invasive ductual carcinoma;grade III ER (-), PR (-), Her-2 (+++), P53 (-), Ki-67 (+) 30% tumor phyllodes tumor tumor breast fibroadenoma paracarcinoma breast invasive ductual carcinoma;grade II ER (+++), PR (++), Her-2 (+/++) paracarcinoma breast invasive ductual carcinoma;grade II ER (-), PR (-), Her-2 (+++), Ki % cancer breast invasive ductual carcinoma;grade II ER (+++), PR (+++), Her-2 (-), Ki-67 5% tumor breast fibroadenoma paracarcinoma breast invasive ductual carcinoma ER (++), PR (-), Her-2 (++/+++), Ki-67 67% paracarcinoma breast invasive ductual carcinoma ER (+/-), PR (+), Her-2 (+/-), CK5/6 (-), Ki-67 (+) 7% tumor breast fibroadenoma tumor breast fibroadenoma cancer breast invasive ductual carcinoma;grade III ER (+) 90%, PR (-), Her-2 (-), P53(+), ki-67 (+) 40% granulomatous lobular mastitis tumor phyllode tumor cancer breast invasive ductual carcinoma;grade II ER (+) 70%, PR (-), Her-2 (+/-), Ki-67 (+) 20%, P53 (+) cancer infiltrative breast cancer with neuroendocrine differentiation ER (+) 60%, PR (-), Her-2 (-), Ki-67 (+) 10%, P53 (-), NSE (+), syn (+) fibroadenosis paracarcinoma breast invasive ductual carcinoma ER (++), PR (++), Her-2 (++), Ki-67 (+) 20% tumor breast fibroadenoma cancer breast invasive ductual carcinoma;grade II ER (-), PR (-), Her-2 (+++), Ki % tumor breast fibroadenoma paracarcinoma breast invasive ductual carcinoma ER (-), PR (-), Her-2 (+++), CK5/6 (+), Ki-67 35% cancer breast invasive ductual carcinoma;grade II-III ER (-), PR (-), Her-2 (+), Ki-67 (+) 50% tumor intraductal papilloma cancer breast invasive ductual carcinoma; ER (+) 50%, PR (+) 30%, Her-2 (++), Ki-67 (+) 60%, P53(+) breast invasive ductual carcinoma;grade II ER (-), PR (-), Her-2 (+++), P53 (-), Ki-67 (+) 20% tumor phyllodes tumor paracarcinoma breast invasive ductual carcinoma;grade II ER (+), PR (-), Her-2 (+++), Ki-67 9% cancer breast invasive ductual carcinoma;grade II ER (++) 70%, PR (-), Her-2 (-), Ki-67 (+) 20%, P53 (-) sclerosing adenosis cancer breast invasive ductual carcinoma;grade III ER (+) 70%, PR (+) 2%, Her-2 (++), Ki-67 (+) 40%, P53 (+) cancer intracystic papillary carcinoma ER (+) 80%, PR (+), 30%, Her-2 (-), Ki-67 (+) 20% granulomatous lobular mastitis cancer breast invasive ductual carcinoma;grade III ER (-), PR (-), Her-2 (+++), P53 (+), Ki-67 (+) 20% tumor breast fibroadenoma tumor adenosis with breast fibroadenoma S-13
Breast pathology. 2nd Department of Pathology Semmelweis University
Breast pathology 2nd Department of Pathology Semmelweis University Breast pathology - Summary - Benign lesions - Acute mastitis - Plasma cell mastitis / duct ectasia - Fat necrosis - Fibrocystic change/
More informationLesion Imaging Characteristics Mass, Favoring Benign Circumscribed Margins Intramammary Lymph Node
Lesion Imaging Characteristics Mass, Favoring Benign Circumscribed Margins Intramammary Lymph Node Oil Cyst Mass, Intermediate Concern Microlobulated Margins Obscured Margins Mass, Favoring Malignant Indistinct
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationConstruction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
More informationSupplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
More informationJoint Department of Biomedical Engineering
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for
More informationBreast Pathology. Breast Development
Breast Pathology Lecturer: Hanina Hibshoosh, M.D. Reading: Kumar, Cotran, Robbins, Basic Pathology, 6th Edition, pages 623-635 Breast Development 5th week - thickening of the epidermis - milk line 5th
More informationJpn J Med Ultrasonics Vol 32 No
Jpn J Med Ultrasonics Vol 32 No 6 2005 589 590 Jpn J Med Ultrasonics Vol 32 No 6 2005 Jpn J Med Ultrasonics Vol 32 No 6 2005 591 Terminology and Diagnostic Criteria Committee of The Japan Society of Ultrasonics
More informationProliferative Epithelial lesions of the Breast. Sami Shousha, MD, FRCPath Charing Cross Hospital & Imperial College, London
Proliferative Epithelial lesions of the Breast Sami Shousha, MD, FRCPath Charing Cross Hospital & Imperial College, London Amman, November2013 Proliferative Epithelial Lesions of the Breast Usual type
More informationCURRICULUM FOR THE BREAST PATHOLOGY ROTATION UNIVERSITY OF FLORIDA DEPARTMENT OF PATHOLOGY
CURRICULUM FOR THE BREAST PATHOLOGY ROTATION UNIVERSITY OF FLORIDA DEPARTMENT OF PATHOLOGY JULY, 2003 The following is a conceptual curriculum and set of guidelines for Pathology Residents on the Breast
More informationThe role of the cytologist in breast cancer screening
The role of the cytologist in breast cancer screening I.Seili-Bekafigo, MD, PhD Clinical cytologist KBC Rijeka Croatian Society for Clinical Cytology Fine needle aspiration (FNA, FNAB, FNAC) Fine needle
More informationLayered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue
Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
More informationVim 3 antibodyuse of Vimentin 3 for the. diagnosis and differentiation of benign and malignant renal carcinoma
Vim 3 antibodyuse of Vimentin 3 for the diagnosis and differentiation of benign and malignant renal carcinoma Prof. Dr. Jochen Fries, Dr. Melanie von Brandenstein Facts about kidney cancer ca. 338,000
More informationPitfalls and Limitations of Breast MRI. Susan Orel Roth, MD Professor of Radiology University of Pennsylvania
Pitfalls and Limitations of Breast MRI Susan Orel Roth, MD Professor of Radiology University of Pennsylvania Objectives Review the etiologies of false negative breast MRI examinations Discuss the limitations
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationDiseases of the breast (1 of 2)
Diseases of the breast (1 of 2) Introduction A histology introduction Normal ducts and lobules of the breast are lined by two layers of cells a layer of luminal cells overlying a second layer of myoepithelial
More informationTOTALS 30. Preliminary analysis of NNDEQA 004 (May 2013 TSL workshops) 1) 70 year old female with focal irregularity in the right breast.
-- Preliminary analysis of NNDEQA 00 (May 0 TSL workshops) ) 70 year old female with focal irregularity in the right breast. Fat necrosis (with organising thrombus/foreign body granuloma/surgical site
More informationLYMPHATIC DRAINAGE AXILLARY (MOSTLY) INTERNAL MAMMARY SUPRACLAVICULAR
BREAST LYMPHATIC DRAINAGE AXILLARY (MOSTLY) INTERNAL MAMMARY SUPRACLAVICULAR HISTOLOGY LOBE: (10 in whole breast) LOBULE: (many per lobe) ACINUS/I, aka ALVEOLUS/I: (many per lobule) DUCT(S): INTRA- or
More information(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationHistopathological Spectrum of Neoplastic and Non-neoplastic Breast Lesions: A Two Years Study
Original Article Print ISSN: 2321-6379 Online ISSN: 2321-595X DOI: 10.17354/ijss/2017/69 Histopathological Spectrum of Neoplastic and Non-neoplastic Breast Lesions: A Two Years Study Moolamalla Manasa
More informationSupporting Information For
Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li
More informationIBCM 2, April 2009, Sarajevo, Bosnia and Herzegovina
Preoperative diagnosis and treatment planning in breast cancer The pathologist s perspective L. Mazzucchelli Istituto Cantonale di Patologia Locarno, Switzerland IBCM 2, 23-25 April 2009, Sarajevo, Bosnia
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationGuidance on the management of B3 lesions
Guidance on the management of B3 lesions Lesion diagnosed on 14g or vacuumassisted biopsy (VAB) Risk of upgrade Recommended investigation Suggested approach for follow-up if no malignancy on VAE awaiting
More informationSupporting Information
Supporting Information Natural small molecule FMHM inhibits lipopolysaccharide-induced inflammatory response by promoting TRAF6 degradation via K48-linked polyubiquitination Ke-Wu Zeng 1, Li-Xi Liao 1,
More informationYour Guide to the Breast Cancer Pathology. Report. Key Questions. Here are important questions to be sure you understand, with your doctor s help:
Your Guide to the Breast Cancer Pathology Report Key Questions Here are important questions to be sure you understand, with your doctor s help: Your Guide to the Breast Cancer Pathology Report 1. Is this
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationACRIN 6666 Therapeutic Surgery Form
S1 ACRIN 6666 Therapeutic Surgery Form 6666 Instructions: Complete a separate S1 form for each separate area of each breast excised with the intent to treat a cancer (e.g. each lumpectomy or mastectomy).
More informationHISTOMORPHOLOGICAL SPECTRUM OF BREAST LESIONS
HISTOMORPHOLOGICAL SPECTRUM OF BREAST LESIONS Kiran H. S, Jayaprakash Shetty, Chandrika Rao Assistant Professor, Department of Pathology, Yenepoya Medical College, Mangalore. Professor, Department of Pathology,
More informationNew: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
More informationBile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results
Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,
More informationContents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ
Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5
More informationPapillary Lesions of the Breast A Practical Approach to Diagnosis. (Arch Pathol Lab Med. 2016;140: ; doi: /arpa.
Papillary Lesions of the Breast A Practical Approach to Diagnosis (Arch Pathol Lab Med. 2016;140:1052 1059; doi: 10.5858/arpa.2016-0219-RA) Papillary lesions of the breast Span the spectrum of benign,
More informationTo determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationTreatment options for the precancerous Atypical Breast lesions. Prof. YOUNG-JIN SUH The Catholic University of Korea
Treatment options for the precancerous Atypical Breast lesions Prof. YOUNG-JIN SUH The Catholic University of Korea Not so benign lesions? Imaging abnormalities(10% recall) lead to diagnostic evaluation,
More informationA712(19)- Test slide, Breast cancer tissues with corresponding normal tissues
A712(19)- Test slide, Breast cancer tissues with corresponding normal tissues (formalin fixed) For research use only Specifications: No. of cases: 12 Tissue type: Breast cancer tissues with corresponding
More informationBreast cancer tissue array with progressive changes, 48 cases, 96 samples (1.5mm), set 1
ab178111 Breast cancer tissue array with progressive, 48 cases, 96 samples (1.5mm), set 1 nstructions for Use Designed for HC or SH based protein or RNA tissue profiling in evolution and progression of
More informationCell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-
Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationBenign Breast Disease and Breast Cancer Risk
Benign Breast Disease and Breast Cancer Risk Jean F. Simpson, M.D. Vanderbilt University Nashville, Tennessee December 1, 2011 Nashville Nashville Lebanon 1 Cedars of Lebanon State Park The American University
More informationRNA preparation from extracted paraffin cores:
Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationCaspase-3 Assay Cat. No. 8228, 100 tests. Introduction
Introduction Caspase-3 Assay Cat. No. 8228, 100 tests Caspase-3 is a member of caspases that plays a key role in mediating apoptosis, or programmed cell death. Upon activation, it cleaves a variety of
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationImmunohistochemical studies (ER & Ki-67) in Proliferative breast lesions adjacent to malignancy
IOSR Journal of Dental and Medical Sciences (IOSR-JDMS) e-issn: 2279-0853, p-issn: 2279-0861.Volume 13, Issue 3 Ver. IV. (Mar. 2014), PP 84-89 Immunohistochemical studies (ER & Ki-67) in Proliferative
More informationFinal analysis of NNDEQA 004 (May 2013 TSL workshops) 1) 70 year old female with focal irregularity in the right breast.
Final analysis of NNDEQA 00 (May 0 TSL workshops) ) 70 year old female with focal irregularity in the right breast. CONSUL TANTS Fat necrosis (with organising thrombus/foreign body granuloma/surgical site
More informationApplications of IHC. Determination of the primary site in metastatic tumors of unknown origin
Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification
More informationMechanical Stress-Dependent Autophagy Components Release via Extracellular
Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,
More informationAMSER Case of the Month: November 2018
AMSER Case of the Month: November 2018 42 year old with right breast mass Rina Kiyota Petek Lake Erie College of Osteopathic Medicine, OMS-III Kossivi Dantey, MD Bibianna Klepchick, MD Matthew Hartman,
More informationExpression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma
Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma H.B. Liu, Y. Zhu, Q.C. Yang, Y. Shen, X.J. Zhang and H. Chen Department of Pathology First People s Hospital
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationAmoyDx TM BRAF V600E Mutation Detection Kit
AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Purification and biochemical properties of SDS-stable low molecular weight alkaline serine protease from Citrullus Colocynthis Muhammad Bashir Khan, 1,3 Hidayatullah khan, 2 Muhammad
More informationPROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA AND IMPORTANT MIMICKERS PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA
PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA AND IMPORTANT MIMICKERS PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA 1 A good H & E helps! ADENOCARCINOMA DIAGNOSTIC CRITERIA Relatively uniform proliferation
More informationAspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
More informationLeukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ
More informationSupporting Information. Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base
Supporting Information Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base Feng Wang, a Haijun Yang, b Hua Fu, b,c * and Zhichao Pei a * a College
More informationSupporting Information. Light-enhanced hypoxia-response of conjugated polymer nanocarrier. for successive synergistic photodynamic and chemo-therapy
Supporting Information Light-enhanced hypoxia-response of conjugated polymer nanocarrier for successive synergistic photodynamic and chemo-therapy Xiaolong Zhang a,d, Ming Wu a,d, Jiong Li a,c,d, Shanyou
More informationCancer cells in vitro
Supplementary Figure S1 Cancer cells in vitro Pretreatment with Control IgG (18h) Pretreatment with anti-u-par (18h) Acid Wash/Pretreatment with Control IgG (18h) Acid Wash/Pretreatment with anti-u-par
More informationYu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p62/traf6 signaling
Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p/traf signaling Jian-shu Lou,,LuYan, Cathy W. C. Bi,, Gallant K.L. Chan,Qi-YunWu,
More informationGross appearance of nodular hyperplasia in material obtained from suprapubic prostatectomy. Note the multinodular appearance and the admixture of
Tiền liệt tuyến Tiền liệt tuyến Gross appearance of nodular hyperplasia in material obtained from suprapubic prostatectomy. Note the multinodular appearance and the admixture of solid and microcystic areas.
More informationFigure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor
Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationMRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
More informationCirculation 30 E1 Dr S. Mathe, Wishaw
Circulation 30 E1 Dr S. Mathe, Wishaw F, 79 R5 mammographic abnormality. Wide local excision. Metaplastic ductal carcinoma of breast with high grade DCIS P53 Cytokeratin Cytokeratin E1 83 responses
More informationPresentation Tips. Dr. Derrick Brazill Biological Sciences Hunter College. (in collaboration with SciMON)
Presentation Tips Dr. Derrick Brazill Biological Sciences Hunter College (in collaboration with SciMON) Telling a Story Presentation should tell a story Must have a beginning Must have a middle Must have
More informationIndex. C Calcifications fat necrosis 1, 61 fat necrosis 4, 69 nipple/peri-areolar involvement 1, 165
A ADH. See Atypical ductal hyperplasia (ADH) American College of Radiology (ACR), BI-RADS background parenchymal enhancement, 8, 9, 81, 82 fibroglandular tissue guidelines, 6 American Joint Committee on
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationThe study of phospholipids in single cells using an integrated microfluidic device
Supporting Information: The study of phospholipids in single cells using an integrated microfluidic device combined with matrix-assisted laser desorption/ionization mass spectrometry Weiyi Xie,, Dan Gao,
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationKnockdown of Malic Enzyme 2 Suppresses Lung Tumor Growth, Induces Differentiation and Impacts PI3K/AKT Signaling
SUPPLEMENTARY INFORMATION Knockdown of Malic Enzyme 2 Suppresses Lung Tumor Growth, Induces Differentiation and Impacts PI3K/AKT Signaling Jian-Guo Ren 1, Pankaj Seth 1, Clary B. Clish 2, Pawel K. Lorkiewicz
More informationUltrasound of the Breast BASICS FOR THE ORDERING CLINICIAN
Ultrasound of the Breast BASICS FOR THE ORDERING CLINICIAN Breast Ultrasound Anatomy Skin Breast Parenchyma Pectoralis Fascia Pectoralis Breast Ultrasound Anatomy Indications for Breast Ultrasound Palpable
More informationLow levels of serum mir-99a is a predictor of poor prognosis in breast cancer
Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,
More informationSOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE
SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE 45 CLINICAL CASES SERIAL DILUTION MULTIPLE PROTEIN CONCENTRATION QUANTITATIVE ASSAY PRODUCT NUMBER: PM1-001-N SOMAPLEX REVERSE
More informationBreast tissue diagnosis by Raman spectroscopy
Breast tissue diagnosis by Raman spectroscopy B. Brożek-Płuska*, J.Surmacki*, J. Jabłońska**, R. Kordek**, H. Abramczyk* *Laboratory of Laser Molecular Spectroscopy, Institute of Applied Radiation Cemistry,
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationRadiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant
Radiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant Poster No.: C-1161 Congress: ECR 2013 Type: Educational Exhibit Authors: J. Kwak,
More informationRadiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant
Radiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant Poster No.: C-1161 Congress: ECR 2013 Type: Educational Exhibit Authors: J. Kwak,
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationAdvances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationFIBROEPITHELIAL LESIONS
DEFINITIONS FIBROEPITHELIAL LESIONS Suzanne Moore FIBROADENOMA- A discrete benign tumour showing evidence of connective tissue and epithelial proliferation- WHO Fibrous stromal element of these tumours
More informationhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 7 28 7 630 ~ 636 NTera-2 ** ** * 410081 COX-2 NTera-2 MTT NTera-2 NTera-2 Hoechest 33258
More informationAMPK Phosphorylation Assay Kit
AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationBREAST PATHOLOGY MCQS
BREAST PATHOLOGY MCQS 1) :The most important factor in breast enlargement during pregnancy is A. stromal edema B. secretion of chorionic gonadotropin C. glandular hyperplasia D. proliferation of stroma
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informationEpithelial Columnar Breast Lesions: Histopathology and Molecular Markers
29th Annual International Conference Advances in the Application of Monoclonal Antibodies in Clinical Oncology and Symposium on Cancer Stem Cells 25 th -27t h June, 2012, Mykonos, Greece Epithelial Columnar
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationTrehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway
Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,
More information