Highly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe

Size: px
Start display at page:

Download "Highly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe"

Transcription

1 Supporting Information Highly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe Shengnan He, Long Qu, Zhifa Shen, Ying Tan, Meiyun Zeng, Feng Liu *, and Yuyang Jiang ǁ *, Yingfu Li Department of Chemistry, Tsinghua University, Beijing, , China The Ministry-Province Jointly Constructed Base for State Key Lab- Shenzhen Key Laboratory of Chemical Biology, the Graduate School at Shenzhen, Tsinghua University, Shenzhen, Guangdong, , China Department of Biochemistry and Biomedical Sciences, McMaster University, 1280 Main St. W, Hamilton, ON L8S 4K1, Canada Shenzhen Kivita Innovative Drug Discovery Institute, Shenzhen, Guangdong, China ǁ Department of Pharmacology and Pharmaceutical Sciences, School of Medicine, Tsinghua University, Beijing, , China. address: S-1

2 Scheme S1. SELEX Scheme. The initial DNA library was ligated to the phosphorylated substrate. After incubating with MDA-MB-231 lysate, the catalytically active molecules will cleave the RNA linkage. These molecules will be purified from the uncleaved DNA by 10% dpage. PCR1 was performed to amplify the purified DNA. This is followed by PCR2 using a primer containing an nonamplifiable tag to assist the purification of the desirable DNA strand for the next round of selection. S-2

3 Scheme S2. Recognition of breast tumor target with the RNA-cleaving fluorogenic probe. Conceptual design of the fluorescent probe which can be activate by the target in MDA-MB-231 cell lysate to generate a robust fluorescent signal. S-3

4 Figure S1. Time-dependence reaction of R28 pool incubated with MDA-MB-231 cell lysate. Each sample contained 50 µg/ml protein and 100 nm R28 pool. Clv% = cleavage efficiency; Unclv = uncleaved probe; Clv = cleaved probe. S-4

5 Figure S2. Specificity test of RFD candidates to various breast cell lines. From the top to the bottom are AAI1-1, AAI1-4, AAI2-1, AAI2-4, AAI2-5, AAI2-6 and AAI2-9. Each reaction mixture was analyzed by 10% dpage, followed by fluorimaging. Clv% = cleavage efficiency; NC = negative control. Unclv = uncleaved probe. Clv = cleaved probe. S-5

6 Figure S3. Specificity test of RFD candidates to different cell lines. From the top to the bottom are AAI1-1, AAI1-4, AAI2-1, AAI2-4, AAI2-5, AAI2-6 and AAI2-9. Each reaction mixture was analyzed by 10% dpage, followed by fluorimaging. Clv% = cleavage efficiency; NC = negative control; Unclv = uncleaved probe; Clv = cleaved probe. S-6

7 Figure S4. Western blot of each clinical specimens by detection of β-actin. S-7

8 Figure S5. A 96-well microplate assay of AAI2-5 with clinical specimens. Each sample contained 50 nm probe and 100 µg/ml protein. Incubation time was 30 min. Dark, grey and unfilled circles stand for malignant breast tumor, benign breast tumor, and paracarcinoma or inflammatory tissue, respectively. No. = number of clinical specimens. S-8

9 Figure S6. Cleavage reaction of AAI2-5 with (A) Her-2, ER, PR human recombinant proteins, and (B) serum from breast tumor patients. NC is negative control and MD is MDA-MB-231 cells medium. S-9

10 Figure S7. Flow cytometry assay for the binding of the FAM-labeled sequence AAI2-5-82F (AAI2-5) and R0-82F (R0) with MDA-MB-231 cells (target cells) and MCF-10A cells (control cells). NC = negative control, which was cells incubated with AAI2-5-82F without treatment with fixation/permeabilization reagent. The concentration of the sequences was 100 nm. S-10

11 Figure S8. Fluorescence anisotropy of AAI2-5 incubated with protein above 50 kda from different cell lines. The concentration of probe was 5 nm, and the protein concentration was from 0 to 1300 µg/ml. The measurements were performed in triplicate. The K d values of AAI2-5 for MDA-MB-231 and MCF-10A were determined from a fit of equation mentioned in Experimental Section to these data as ± 8.4 µg/ml, ± µg/ml, respectively. The K d value of AAI2-5 for HEB cannot be determined by this method. S-11

12 Table S1. [Probe] 1/2 value of each probe. Name Selected N40 sequence Repeat times [Probe] 1/2 value AAI1-1 GGGAACGTGTGCTCGGCTATTGATTGGACTTTAGCGTTGG ± 5.1 AAI1-2 CGTAGGCGAAGGTCCGTGTGGGAATCCTTAGCGAGACAAGG ± 8.5 AAI1-3 CATAAATGGTCAGGTGACGTGTACGAAACCTTAGCGTATGG ± 87.8 AAI1-4 GGTCCTGAGAGATACTTTAGCGGTTAGGATACACGAGTGGG ± 3.1 AAI2-1 CAACGAGGGAGCCCTTGGAGAAGTTTAGCGTAGTGGTCGTG ± 2.1 AAI2-3 CACTACGACAGGATTCTGAGTATCGAGTACCTTAGCGTTGC ± 11.4 AAI2-4 GGGTAGTAGTCGAGAGAAGTTTAGCGTAGGCTCGCCGGGTC ± 3.0 AAI2-5 GGAACGGTTAGATCTGATACCTTAGCGAAGGTGTGGTTGGC ± 3.3 AAI2-6 GGATCTGTATCGTGGGAGAATTTTAGCGTCCGAAGCCTGGC ± 5.7 AAI2-7 GTACGGACTCTGAACGATAAGCTTAGCGATCCCGGAAGTGGC ± AAI2-8 GGACGATTGAGAAGTTTAGCGATCAGAAGATGTTGCCGTAGC ± 38.7 AAI2-9 GTGATGTGCTGGCGTATACTTTAGCGTGGATGAGGTCGTGG ± 5.4 AAI2-10 GCCCAAACTTGGAGGGGGGCAATGAGAATCCTTAGCGTGTG ± 11.9 AAI2-11 GGAGACGTGATAGAACTTTAGCGATAAGTAATTTGGATGTGC ± 21.8 AAI2-12 GGGGTACGTTTGATTGACAATCCTTAGCGATATCTGAGTGTG ± 23.3 S-12

13 Table S2 Cleavage efficiency of AAI2-5 and clinical specimens characterization. No. Clv% Source Type Immunohistochemistry cancer breast invasive ductual carcinoma ER (+/-), PR (+), Her-2 (+/-), CK5/6 (-), Ki-67 (+) 7% cancer breast invasive ductual carcinoma ER (++), PR (+++), Her-2 (+/++), Ki-67 (+) 40%-50% cancer breast invasive ductual carcinoma ER (+/-), PR (+/-), Ki-67 30% paracarcinoma breast invasive ductual carcinoma ER (++), PR (-), Her-2 (+++), CK5/6 (+), Ki-67 (+) 30%-40% paracarcinoma breast invasive ductual carcinoma ER (+), PR (+), Her-2 (-) cancer breast invasive ductual carcinoma;grade II ER (-), PR (-), Her-2 (+++), Ki % cancer breast invasive ductual carcinoma;grade II ER (+) 20%, PR (-), Her-2 (++),, P53 (+), Ki-67 (+) 20% cancer intracystic papillary carcinoma ER (+) 90%, PR (+) 70%, Her-2 (-), Ki-67 (+) 5% paracarcinoma breast invasive ductual carcinoma ER (++), PR (+), Her-2 (+), Ki-67 (+) 15% tumor breast fibroadenoma lymph breast invasive ductual carcinoma;grade II ER (+++), PR (++), Her-2 (+/++) tumor intraductal papilloma granulomatous lobular mastitis cancer breast invasive ductual carcinoma;grade II ER (-), PR(-), Her-2 (+++), Ki-67 15%, cancer breast invasive ductual carcinoma;grade II ER (+/++), PR (-), Her-2 (+++), Ki-67 5% granulomatous lobular mastitis cancer breast invasive ductual carcinoma;grade II ER (+), PR (-), Her-2 (+++), Ki-67 9%, cancer breast invasive ductual carcinoma;grade II ER (++) 60%, PR (++) 70%, Her-2 (+++), P53 (-), Ki-67< 10% (+) cancer breast invasive ductual carcinoma;grade III ER (-), PR (-), Her-2 (+++), P53 (-), Ki-67 (+) 30% tumor phyllodes tumor tumor breast fibroadenoma paracarcinoma breast invasive ductual carcinoma;grade II ER (+++), PR (++), Her-2 (+/++) paracarcinoma breast invasive ductual carcinoma;grade II ER (-), PR (-), Her-2 (+++), Ki % cancer breast invasive ductual carcinoma;grade II ER (+++), PR (+++), Her-2 (-), Ki-67 5% tumor breast fibroadenoma paracarcinoma breast invasive ductual carcinoma ER (++), PR (-), Her-2 (++/+++), Ki-67 67% paracarcinoma breast invasive ductual carcinoma ER (+/-), PR (+), Her-2 (+/-), CK5/6 (-), Ki-67 (+) 7% tumor breast fibroadenoma tumor breast fibroadenoma cancer breast invasive ductual carcinoma;grade III ER (+) 90%, PR (-), Her-2 (-), P53(+), ki-67 (+) 40% granulomatous lobular mastitis tumor phyllode tumor cancer breast invasive ductual carcinoma;grade II ER (+) 70%, PR (-), Her-2 (+/-), Ki-67 (+) 20%, P53 (+) cancer infiltrative breast cancer with neuroendocrine differentiation ER (+) 60%, PR (-), Her-2 (-), Ki-67 (+) 10%, P53 (-), NSE (+), syn (+) fibroadenosis paracarcinoma breast invasive ductual carcinoma ER (++), PR (++), Her-2 (++), Ki-67 (+) 20% tumor breast fibroadenoma cancer breast invasive ductual carcinoma;grade II ER (-), PR (-), Her-2 (+++), Ki % tumor breast fibroadenoma paracarcinoma breast invasive ductual carcinoma ER (-), PR (-), Her-2 (+++), CK5/6 (+), Ki-67 35% cancer breast invasive ductual carcinoma;grade II-III ER (-), PR (-), Her-2 (+), Ki-67 (+) 50% tumor intraductal papilloma cancer breast invasive ductual carcinoma; ER (+) 50%, PR (+) 30%, Her-2 (++), Ki-67 (+) 60%, P53(+) breast invasive ductual carcinoma;grade II ER (-), PR (-), Her-2 (+++), P53 (-), Ki-67 (+) 20% tumor phyllodes tumor paracarcinoma breast invasive ductual carcinoma;grade II ER (+), PR (-), Her-2 (+++), Ki-67 9% cancer breast invasive ductual carcinoma;grade II ER (++) 70%, PR (-), Her-2 (-), Ki-67 (+) 20%, P53 (-) sclerosing adenosis cancer breast invasive ductual carcinoma;grade III ER (+) 70%, PR (+) 2%, Her-2 (++), Ki-67 (+) 40%, P53 (+) cancer intracystic papillary carcinoma ER (+) 80%, PR (+), 30%, Her-2 (-), Ki-67 (+) 20% granulomatous lobular mastitis cancer breast invasive ductual carcinoma;grade III ER (-), PR (-), Her-2 (+++), P53 (+), Ki-67 (+) 20% tumor breast fibroadenoma tumor adenosis with breast fibroadenoma S-13

Breast pathology. 2nd Department of Pathology Semmelweis University

Breast pathology. 2nd Department of Pathology Semmelweis University Breast pathology 2nd Department of Pathology Semmelweis University Breast pathology - Summary - Benign lesions - Acute mastitis - Plasma cell mastitis / duct ectasia - Fat necrosis - Fibrocystic change/

More information

Lesion Imaging Characteristics Mass, Favoring Benign Circumscribed Margins Intramammary Lymph Node

Lesion Imaging Characteristics Mass, Favoring Benign Circumscribed Margins Intramammary Lymph Node Lesion Imaging Characteristics Mass, Favoring Benign Circumscribed Margins Intramammary Lymph Node Oil Cyst Mass, Intermediate Concern Microlobulated Margins Obscured Margins Mass, Favoring Malignant Indistinct

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

Joint Department of Biomedical Engineering

Joint Department of Biomedical Engineering Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for

More information

Breast Pathology. Breast Development

Breast Pathology. Breast Development Breast Pathology Lecturer: Hanina Hibshoosh, M.D. Reading: Kumar, Cotran, Robbins, Basic Pathology, 6th Edition, pages 623-635 Breast Development 5th week - thickening of the epidermis - milk line 5th

More information

Jpn J Med Ultrasonics Vol 32 No

Jpn J Med Ultrasonics Vol 32 No Jpn J Med Ultrasonics Vol 32 No 6 2005 589 590 Jpn J Med Ultrasonics Vol 32 No 6 2005 Jpn J Med Ultrasonics Vol 32 No 6 2005 591 Terminology and Diagnostic Criteria Committee of The Japan Society of Ultrasonics

More information

Proliferative Epithelial lesions of the Breast. Sami Shousha, MD, FRCPath Charing Cross Hospital & Imperial College, London

Proliferative Epithelial lesions of the Breast. Sami Shousha, MD, FRCPath Charing Cross Hospital & Imperial College, London Proliferative Epithelial lesions of the Breast Sami Shousha, MD, FRCPath Charing Cross Hospital & Imperial College, London Amman, November2013 Proliferative Epithelial Lesions of the Breast Usual type

More information

CURRICULUM FOR THE BREAST PATHOLOGY ROTATION UNIVERSITY OF FLORIDA DEPARTMENT OF PATHOLOGY

CURRICULUM FOR THE BREAST PATHOLOGY ROTATION UNIVERSITY OF FLORIDA DEPARTMENT OF PATHOLOGY CURRICULUM FOR THE BREAST PATHOLOGY ROTATION UNIVERSITY OF FLORIDA DEPARTMENT OF PATHOLOGY JULY, 2003 The following is a conceptual curriculum and set of guidelines for Pathology Residents on the Breast

More information

The role of the cytologist in breast cancer screening

The role of the cytologist in breast cancer screening The role of the cytologist in breast cancer screening I.Seili-Bekafigo, MD, PhD Clinical cytologist KBC Rijeka Croatian Society for Clinical Cytology Fine needle aspiration (FNA, FNAB, FNAC) Fine needle

More information

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplemental Figure 1

Supplemental Figure 1 1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer

More information

Vim 3 antibodyuse of Vimentin 3 for the. diagnosis and differentiation of benign and malignant renal carcinoma

Vim 3 antibodyuse of Vimentin 3 for the. diagnosis and differentiation of benign and malignant renal carcinoma Vim 3 antibodyuse of Vimentin 3 for the diagnosis and differentiation of benign and malignant renal carcinoma Prof. Dr. Jochen Fries, Dr. Melanie von Brandenstein Facts about kidney cancer ca. 338,000

More information

Pitfalls and Limitations of Breast MRI. Susan Orel Roth, MD Professor of Radiology University of Pennsylvania

Pitfalls and Limitations of Breast MRI. Susan Orel Roth, MD Professor of Radiology University of Pennsylvania Pitfalls and Limitations of Breast MRI Susan Orel Roth, MD Professor of Radiology University of Pennsylvania Objectives Review the etiologies of false negative breast MRI examinations Discuss the limitations

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

Diseases of the breast (1 of 2)

Diseases of the breast (1 of 2) Diseases of the breast (1 of 2) Introduction A histology introduction Normal ducts and lobules of the breast are lined by two layers of cells a layer of luminal cells overlying a second layer of myoepithelial

More information

TOTALS 30. Preliminary analysis of NNDEQA 004 (May 2013 TSL workshops) 1) 70 year old female with focal irregularity in the right breast.

TOTALS 30. Preliminary analysis of NNDEQA 004 (May 2013 TSL workshops) 1) 70 year old female with focal irregularity in the right breast. -- Preliminary analysis of NNDEQA 00 (May 0 TSL workshops) ) 70 year old female with focal irregularity in the right breast. Fat necrosis (with organising thrombus/foreign body granuloma/surgical site

More information

LYMPHATIC DRAINAGE AXILLARY (MOSTLY) INTERNAL MAMMARY SUPRACLAVICULAR

LYMPHATIC DRAINAGE AXILLARY (MOSTLY) INTERNAL MAMMARY SUPRACLAVICULAR BREAST LYMPHATIC DRAINAGE AXILLARY (MOSTLY) INTERNAL MAMMARY SUPRACLAVICULAR HISTOLOGY LOBE: (10 in whole breast) LOBULE: (many per lobe) ACINUS/I, aka ALVEOLUS/I: (many per lobule) DUCT(S): INTRA- or

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

Histopathological Spectrum of Neoplastic and Non-neoplastic Breast Lesions: A Two Years Study

Histopathological Spectrum of Neoplastic and Non-neoplastic Breast Lesions: A Two Years Study Original Article Print ISSN: 2321-6379 Online ISSN: 2321-595X DOI: 10.17354/ijss/2017/69 Histopathological Spectrum of Neoplastic and Non-neoplastic Breast Lesions: A Two Years Study Moolamalla Manasa

More information

Supporting Information For

Supporting Information For Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li

More information

IBCM 2, April 2009, Sarajevo, Bosnia and Herzegovina

IBCM 2, April 2009, Sarajevo, Bosnia and Herzegovina Preoperative diagnosis and treatment planning in breast cancer The pathologist s perspective L. Mazzucchelli Istituto Cantonale di Patologia Locarno, Switzerland IBCM 2, 23-25 April 2009, Sarajevo, Bosnia

More information

Expanded View Figures

Expanded View Figures Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Guidance on the management of B3 lesions

Guidance on the management of B3 lesions Guidance on the management of B3 lesions Lesion diagnosed on 14g or vacuumassisted biopsy (VAB) Risk of upgrade Recommended investigation Suggested approach for follow-up if no malignancy on VAE awaiting

More information

Supporting Information

Supporting Information Supporting Information Natural small molecule FMHM inhibits lipopolysaccharide-induced inflammatory response by promoting TRAF6 degradation via K48-linked polyubiquitination Ke-Wu Zeng 1, Li-Xi Liao 1,

More information

Your Guide to the Breast Cancer Pathology. Report. Key Questions. Here are important questions to be sure you understand, with your doctor s help:

Your Guide to the Breast Cancer Pathology. Report. Key Questions. Here are important questions to be sure you understand, with your doctor s help: Your Guide to the Breast Cancer Pathology Report Key Questions Here are important questions to be sure you understand, with your doctor s help: Your Guide to the Breast Cancer Pathology Report 1. Is this

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

ACRIN 6666 Therapeutic Surgery Form

ACRIN 6666 Therapeutic Surgery Form S1 ACRIN 6666 Therapeutic Surgery Form 6666 Instructions: Complete a separate S1 form for each separate area of each breast excised with the intent to treat a cancer (e.g. each lumpectomy or mastectomy).

More information

HISTOMORPHOLOGICAL SPECTRUM OF BREAST LESIONS

HISTOMORPHOLOGICAL SPECTRUM OF BREAST LESIONS HISTOMORPHOLOGICAL SPECTRUM OF BREAST LESIONS Kiran H. S, Jayaprakash Shetty, Chandrika Rao Assistant Professor, Department of Pathology, Yenepoya Medical College, Mangalore. Professor, Department of Pathology,

More information

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix. SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5

More information

Papillary Lesions of the Breast A Practical Approach to Diagnosis. (Arch Pathol Lab Med. 2016;140: ; doi: /arpa.

Papillary Lesions of the Breast A Practical Approach to Diagnosis. (Arch Pathol Lab Med. 2016;140: ; doi: /arpa. Papillary Lesions of the Breast A Practical Approach to Diagnosis (Arch Pathol Lab Med. 2016;140:1052 1059; doi: 10.5858/arpa.2016-0219-RA) Papillary lesions of the breast Span the spectrum of benign,

More information

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80% Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

Treatment options for the precancerous Atypical Breast lesions. Prof. YOUNG-JIN SUH The Catholic University of Korea

Treatment options for the precancerous Atypical Breast lesions. Prof. YOUNG-JIN SUH The Catholic University of Korea Treatment options for the precancerous Atypical Breast lesions Prof. YOUNG-JIN SUH The Catholic University of Korea Not so benign lesions? Imaging abnormalities(10% recall) lead to diagnostic evaluation,

More information

A712(19)- Test slide, Breast cancer tissues with corresponding normal tissues

A712(19)- Test slide, Breast cancer tissues with corresponding normal tissues A712(19)- Test slide, Breast cancer tissues with corresponding normal tissues (formalin fixed) For research use only Specifications: No. of cases: 12 Tissue type: Breast cancer tissues with corresponding

More information

Breast cancer tissue array with progressive changes, 48 cases, 96 samples (1.5mm), set 1

Breast cancer tissue array with progressive changes, 48 cases, 96 samples (1.5mm), set 1 ab178111 Breast cancer tissue array with progressive, 48 cases, 96 samples (1.5mm), set 1 nstructions for Use Designed for HC or SH based protein or RNA tissue profiling in evolution and progression of

More information

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary

More information

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn- Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg

More information

Benign Breast Disease and Breast Cancer Risk

Benign Breast Disease and Breast Cancer Risk Benign Breast Disease and Breast Cancer Risk Jean F. Simpson, M.D. Vanderbilt University Nashville, Tennessee December 1, 2011 Nashville Nashville Lebanon 1 Cedars of Lebanon State Park The American University

More information

RNA preparation from extracted paraffin cores:

RNA preparation from extracted paraffin cores: Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.

More information

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis

More information

Caspase-3 Assay Cat. No. 8228, 100 tests. Introduction

Caspase-3 Assay Cat. No. 8228, 100 tests. Introduction Introduction Caspase-3 Assay Cat. No. 8228, 100 tests Caspase-3 is a member of caspases that plays a key role in mediating apoptosis, or programmed cell death. Upon activation, it cleaves a variety of

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

Immunohistochemical studies (ER & Ki-67) in Proliferative breast lesions adjacent to malignancy

Immunohistochemical studies (ER & Ki-67) in Proliferative breast lesions adjacent to malignancy IOSR Journal of Dental and Medical Sciences (IOSR-JDMS) e-issn: 2279-0853, p-issn: 2279-0861.Volume 13, Issue 3 Ver. IV. (Mar. 2014), PP 84-89 Immunohistochemical studies (ER & Ki-67) in Proliferative

More information

Final analysis of NNDEQA 004 (May 2013 TSL workshops) 1) 70 year old female with focal irregularity in the right breast.

Final analysis of NNDEQA 004 (May 2013 TSL workshops) 1) 70 year old female with focal irregularity in the right breast. Final analysis of NNDEQA 00 (May 0 TSL workshops) ) 70 year old female with focal irregularity in the right breast. CONSUL TANTS Fat necrosis (with organising thrombus/foreign body granuloma/surgical site

More information

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification

More information

Mechanical Stress-Dependent Autophagy Components Release via Extracellular

Mechanical Stress-Dependent Autophagy Components Release via Extracellular Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,

More information

AMSER Case of the Month: November 2018

AMSER Case of the Month: November 2018 AMSER Case of the Month: November 2018 42 year old with right breast mass Rina Kiyota Petek Lake Erie College of Osteopathic Medicine, OMS-III Kossivi Dantey, MD Bibianna Klepchick, MD Matthew Hartman,

More information

Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma

Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma H.B. Liu, Y. Zhu, Q.C. Yang, Y. Shen, X.J. Zhang and H. Chen Department of Pathology First People s Hospital

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

AmoyDx TM BRAF V600E Mutation Detection Kit

AmoyDx TM BRAF V600E Mutation Detection Kit AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Purification and biochemical properties of SDS-stable low molecular weight alkaline serine protease from Citrullus Colocynthis Muhammad Bashir Khan, 1,3 Hidayatullah khan, 2 Muhammad

More information

PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA AND IMPORTANT MIMICKERS PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA

PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA AND IMPORTANT MIMICKERS PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA AND IMPORTANT MIMICKERS PROSTATIC ADENOCARCINOMA: DIAGNOSTIC CRITERIA 1 A good H & E helps! ADENOCARCINOMA DIAGNOSTIC CRITERIA Relatively uniform proliferation

More information

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,

More information

Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit

Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ

More information

Supporting Information. Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base

Supporting Information. Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base Supporting Information Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base Feng Wang, a Haijun Yang, b Hua Fu, b,c * and Zhichao Pei a * a College

More information

Supporting Information. Light-enhanced hypoxia-response of conjugated polymer nanocarrier. for successive synergistic photodynamic and chemo-therapy

Supporting Information. Light-enhanced hypoxia-response of conjugated polymer nanocarrier. for successive synergistic photodynamic and chemo-therapy Supporting Information Light-enhanced hypoxia-response of conjugated polymer nanocarrier for successive synergistic photodynamic and chemo-therapy Xiaolong Zhang a,d, Ming Wu a,d, Jiong Li a,c,d, Shanyou

More information

Cancer cells in vitro

Cancer cells in vitro Supplementary Figure S1 Cancer cells in vitro Pretreatment with Control IgG (18h) Pretreatment with anti-u-par (18h) Acid Wash/Pretreatment with Control IgG (18h) Acid Wash/Pretreatment with anti-u-par

More information

Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p62/traf6 signaling

Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p62/traf6 signaling Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p/traf signaling Jian-shu Lou,,LuYan, Cathy W. C. Bi,, Gallant K.L. Chan,Qi-YunWu,

More information

Gross appearance of nodular hyperplasia in material obtained from suprapubic prostatectomy. Note the multinodular appearance and the admixture of

Gross appearance of nodular hyperplasia in material obtained from suprapubic prostatectomy. Note the multinodular appearance and the admixture of Tiền liệt tuyến Tiền liệt tuyến Gross appearance of nodular hyperplasia in material obtained from suprapubic prostatectomy. Note the multinodular appearance and the admixture of solid and microcystic areas.

More information

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

MRC-Holland MLPA. Description version 18; 09 September 2015

MRC-Holland MLPA. Description version 18; 09 September 2015 SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the

More information

Circulation 30 E1 Dr S. Mathe, Wishaw

Circulation 30 E1 Dr S. Mathe, Wishaw Circulation 30 E1 Dr S. Mathe, Wishaw F, 79 R5 mammographic abnormality. Wide local excision. Metaplastic ductal carcinoma of breast with high grade DCIS P53 Cytokeratin Cytokeratin E1 83 responses

More information

Presentation Tips. Dr. Derrick Brazill Biological Sciences Hunter College. (in collaboration with SciMON)

Presentation Tips. Dr. Derrick Brazill Biological Sciences Hunter College. (in collaboration with SciMON) Presentation Tips Dr. Derrick Brazill Biological Sciences Hunter College (in collaboration with SciMON) Telling a Story Presentation should tell a story Must have a beginning Must have a middle Must have

More information

Index. C Calcifications fat necrosis 1, 61 fat necrosis 4, 69 nipple/peri-areolar involvement 1, 165

Index. C Calcifications fat necrosis 1, 61 fat necrosis 4, 69 nipple/peri-areolar involvement 1, 165 A ADH. See Atypical ductal hyperplasia (ADH) American College of Radiology (ACR), BI-RADS background parenchymal enhancement, 8, 9, 81, 82 fibroglandular tissue guidelines, 6 American Joint Committee on

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

The study of phospholipids in single cells using an integrated microfluidic device

The study of phospholipids in single cells using an integrated microfluidic device Supporting Information: The study of phospholipids in single cells using an integrated microfluidic device combined with matrix-assisted laser desorption/ionization mass spectrometry Weiyi Xie,, Dan Gao,

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Knockdown of Malic Enzyme 2 Suppresses Lung Tumor Growth, Induces Differentiation and Impacts PI3K/AKT Signaling

Knockdown of Malic Enzyme 2 Suppresses Lung Tumor Growth, Induces Differentiation and Impacts PI3K/AKT Signaling SUPPLEMENTARY INFORMATION Knockdown of Malic Enzyme 2 Suppresses Lung Tumor Growth, Induces Differentiation and Impacts PI3K/AKT Signaling Jian-Guo Ren 1, Pankaj Seth 1, Clary B. Clish 2, Pawel K. Lorkiewicz

More information

Ultrasound of the Breast BASICS FOR THE ORDERING CLINICIAN

Ultrasound of the Breast BASICS FOR THE ORDERING CLINICIAN Ultrasound of the Breast BASICS FOR THE ORDERING CLINICIAN Breast Ultrasound Anatomy Skin Breast Parenchyma Pectoralis Fascia Pectoralis Breast Ultrasound Anatomy Indications for Breast Ultrasound Palpable

More information

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,

More information

SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE

SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE 45 CLINICAL CASES SERIAL DILUTION MULTIPLE PROTEIN CONCENTRATION QUANTITATIVE ASSAY PRODUCT NUMBER: PM1-001-N SOMAPLEX REVERSE

More information

Breast tissue diagnosis by Raman spectroscopy

Breast tissue diagnosis by Raman spectroscopy Breast tissue diagnosis by Raman spectroscopy B. Brożek-Płuska*, J.Surmacki*, J. Jabłońska**, R. Kordek**, H. Abramczyk* *Laboratory of Laser Molecular Spectroscopy, Institute of Applied Radiation Cemistry,

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Radiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant

Radiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant Radiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant Poster No.: C-1161 Congress: ECR 2013 Type: Educational Exhibit Authors: J. Kwak,

More information

Radiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant

Radiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant Radiologic and pathologic correlation of non-mass like breast lesions on US and MRI: Benign, high risk, versus malignant Poster No.: C-1161 Congress: ECR 2013 Type: Educational Exhibit Authors: J. Kwak,

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

FIBROEPITHELIAL LESIONS

FIBROEPITHELIAL LESIONS DEFINITIONS FIBROEPITHELIAL LESIONS Suzanne Moore FIBROADENOMA- A discrete benign tumour showing evidence of connective tissue and epithelial proliferation- WHO Fibrous stromal element of these tumours

More information

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP.

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP. ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 7 28 7 630 ~ 636 NTera-2 ** ** * 410081 COX-2 NTera-2 MTT NTera-2 NTera-2 Hoechest 33258

More information

AMPK Phosphorylation Assay Kit

AMPK Phosphorylation Assay Kit AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle

More information

BREAST PATHOLOGY MCQS

BREAST PATHOLOGY MCQS BREAST PATHOLOGY MCQS 1) :The most important factor in breast enlargement during pregnancy is A. stromal edema B. secretion of chorionic gonadotropin C. glandular hyperplasia D. proliferation of stroma

More information

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

More information

Epithelial Columnar Breast Lesions: Histopathology and Molecular Markers

Epithelial Columnar Breast Lesions: Histopathology and Molecular Markers 29th Annual International Conference Advances in the Application of Monoclonal Antibodies in Clinical Oncology and Symposium on Cancer Stem Cells 25 th -27t h June, 2012, Mykonos, Greece Epithelial Columnar

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,

More information