HTG EdgeSeq Immuno-Oncology Assay Gene List

CD Marker Antibodies. atlasantibodies.com

CD Marker Antibodies atlasantibodies.com CD Marker Antibodies Product Name Product Number Validated Applications Anti-ACE HPA029298 IHC,WB Anti-ACKR1 HPA016421 IHC Anti-ACKR1 HPA017672 IHC Anti-ADAM17

Nature Genetics: doi: /ng Supplementary Figure 1

Supplementary Figure 1 Characterization of HPV Tg/+ ; Krt17 / mice. (a) Macroscopic images of HPV16 Tg/+ mouse ears at P40, P70 and P120. (b) Immunostaining of HPV16 Tg/+ ear tissue sections for K17 (red)

SUPPLEMENTAL DATA. Table S1. Genes in each pathway selected for analysis.

SUPPLEMENTAL DATA Table S1. Genes in each pathway selected for analysis. Gene Chr Start End bp Pathway 1 AKR1C1 10 5000044 5022159 22115 COX 2 AKR1C2 10 5029967 5060207 30240 COX 3 AKR1C3 10 5077549 5149878

Supplemental Table 1: Enriched GO categories per cluster

Supplemental Table 1: Enriched GO categories per cluster Cluster Enriched with #genes Raw p-value Corrected p-value Frequency in set (%) Cluster 1 immune response - GO:0006955 32 2.36E-14 0.001 13.5 Cluster

Eosinophils! 40! 30! 20! 10! 0! NS!

A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the

Bronchoalveolar lavage fluid analysis showed increased eosinophil in 30% of subjects with IrIa BAL

Bronchoalveolar lavage fluid analysis showed increased eosinophil in 30% of subjects with IrIa BAL UBC Chan-Yeung Centre for Occupational and Environmental Respiratory Disease Understanding exposure effects

BD Rhapsody Immune Response Panel Hs

Doc ID: 55665 Rev. 2.0 PRODUCT INSERT BD Rhapsody Immune Response Panel Hs BD Biosciences Kit Part Number: 633750 Purpose The BD Rhapsody Immune Response Panel Hs is a set of ready-to-use primer pools

Supplementary Table S1: Gene expression targets

Supplementary Table S1: Gene expression targets Probe ID Gene ID Gene Descriptions Cell type Antigen-dependent activation MmugDNA.32422.1.S1_at CD180 CD180 molecule B 1 MmugDNA.18254.1.S1_at CD19 CD19

Transduction of lentivirus to human primary CD4+ T cells

Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)

Supplemental Figure 1. Mother. Son. Brother. Nephew. Sister (deceased)

Supplemental Figure 1 IRF8:NM_002163:c.C602T IRF8:NM_002163:c.C671T M Son Br Nephew Sister (deceased) Supplemental Figure 1. Confirmation of family member IRF8 variants by Sanger sequencing. The proband

Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases

Supplementary Tables: Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases Supplementary Table 2: Contingency tables used in the fisher exact

Figure 1: Effects of cisplatin on survival of lung cancer cells.

Figure 1 Figure 1: Effects of cisplatin on survival of lung cancer cells. To determine the IC 50 concentration of cisplatin, cells were treated with various concentrations of cisplatin and cell survival

Gene Target NCBI_NAME NCBI_ACCESSION GENE_FUNCTION ABCF1 ABCF1_ ATP_binding_cassette_subfamily_F_member_1 NM_ Housekeeping ADGRE5

ABCF1 ABCF1_11741283 ATP_binding_cassette_subfamily_F_member_1 NM_001025091 Housekeeping ADGRE5 ADGRE5_26552764 adhesion_g_protein coupled_receptor_e5 NM_078481 Adhesion,migration ADORA2A ADORA2A_771873

Department of International Health (Vaccine science track) Johns Hopkins University Bloomberg School of Public Health

Acute Respiratory Distress Syndrome is a TH17 and Treg immune disease By Wan-Jiung Hu Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2 Nangang 115, Taipei, Taiwan Previous

The circulating T helper subsets and regulatory T cells in patients with common variable immunodeficiency with no monogenic disease

1 Supplementary data The circulating T helper subsets and regulatory T cells in patients with common variable immunodeficiency with no monogenic disease Azizi et al. 2 Table S1. Excluded 373 genes variants

Biomarkers of cancer immunotherapy Jason Luke, MD, FACP

Biomarkers of cancer immunotherapy Jason Luke, MD, FACP Assistant Professor of Medicine Disclosures Consultancy: 7 Hills, Actym, Amgen, Array, AstraZeneca, BeneVir, Bristol-Myers Squibb, Castle, CheckMate,

* Kyoto Encyclopedia of Genes and Genomes.

Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

qpcr-array Analysis Service

qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,

A genome-wide association study identifies vitiligo

A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples

Statistical Issues in Translational Cancer Research

Statistical Issues in Translational Cancer Research Martin Bøgsted Department of Haematology Aalborg University Hospital and Department of Clinical Medicine Aalborg University The only useful function

Department of International Health (Vaccine science track) Johns Hopkins University Bloomberg School of Public Health

Sepsis is a syndrome with hyperactivity of TH17-like innate immunity and hypoactivity of adaptive immunity By Wan-Jiung Hu Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2

A Network Analysis of Chinese Medicine Lianhua-Qingwen Formula

Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Supplementary Information File A Network Analysis of Chinese Medicine Lianhua-Qingwen

The innate immune system: Contributions to Immunogenicity of Therapeutic Proteins

The innate immune system: Contributions to Immunogenicity of Therapeutic Proteins Daniela Verthelyi, M.D., Ph.D. Laboratory of Immunology Division of Therapeu8c Proteins OBP, CDER, FDA Map to the talk:

B16F1 B16F10 Supplemental Figure S1

B16F1 B16F1 Supplemental Figure S1 Representative microangiography images of B16F1 and B16F1 tumors grown in the cranial windows. FITC-dextran (2 million MW) was injected systemically to visualize blood

The Changing Diagnostic Landscape of Primary Immune Deficiency

The Changing Diagnostic Landscape of Primary Immune Deficiency Dr. Sabeena Selvarajah Paediatric Immunology Fellow, Princess Margaret Hospital for Children, Term infant girl of non-consanguineous parents

Comprehensive immune transcriptomic analysis in bladder cancer reveals subtype specific immune gene expression patterns of prognostic relevance

/, 2017, Vol. 8, (No. 41), pp: 70982-71001 Comprehensive immune transcriptomic analysis in bladder cancer reveals subtype specific immune gene expression patterns of prognostic relevance Runhan Ren 1,2,

For focused group profiling of human HIV infection and host response genes expression

ExProfile TM Human HIV Infection and Host Response Related Gene qpcr Array For focused group profiling of human HIV infection and host response genes expression Cat. No. QG023-A (1 x 96-well plate, Format

Abstract. Introduction

Lack of Clinical Manifestations in Asymptomatic Dengue Infection Is Attributed to Broad Down-Regulation and Selective Up-Regulation of Host Defence Response Genes Adeline S. L. Yeo 1, Nur Atiqah Azhar

Sepsis is a syndrome with hyperactivity of TH17-like innate immunity and hypoactivity of adaptive immunity

Sepsis is a syndrome with hyperactivity of TH17-like innate immunity and hypoactivity of adaptive immunity By Wan-Jiung Hu Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2

Nature Immunology: doi: /ni.3745

Supplementary Figure 1 Experimental settings. (a) Experimental setup and bioinformatic data analysis of transcriptomic changes induced in neonatal and adult monocytes by stimulation with 10 ng/ml LPS for

An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action

An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the

Immunological characterization of a recipient of a cross-match positive. Thet Su Win, Naoka Murakami, Thiago J. Borges, Anil Chandraker, George

Supplementary Materials Immunological characterization of a recipient of a cross-match positive face transplant Thet Su Win, Naoka Murakami, Thiago J. Borges, Anil Chandraker, George Murphy, Christine

Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc.

Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc. Cellecta, Inc. Founded: April 2006 Headquarters: Mountain View, CA 12 SBIR Grants Custom Service Provider for Functional

Applied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)

RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format

blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific

Supplementary figure legends Figure 1: Selective expression of regulatory markers on CD4 + LAP + T cells. Human peripheral blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and

150 International Union of Immunological Societies Primary Immunodeficiency Disease Classification. IgG. loss of function

2008 Vol. 20No. 2175 IgG 46 T T T loss of function 150 International Union of Immunological Societies Primary Immunodeficiency Disease Classification Committee 8 1 1 T B 2 3 4 5 6 7 8 120 1 B 2 Infectious

Supplementary Table 1: OCAC study location, type, and number of cases and controls

Supplementary Table 1: OCAC study location, type, and number of cases and controls Study Name Abbreviation Study Location Study Type N Cases N Controls Australian Ovarian Cancer Study/Australian Cancer

1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created.

938 939 940 941 942 Figure S1 Schematic of the in silico TCRminer and MiXCR validation. 1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created. Then, 100,000 simulated 80 bp

ptglab.com PECAM1: Customer Testimonial

ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called

Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of

1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars

Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018

Targeted Agent and Profiling Utilization Registry (TAPUR ) Study February 2018 Precision Medicine Therapies designed to target the molecular alteration that aids cancer development 30 TARGET gene alterations

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

CPM (x 10-3 ) Tregs +Teffs. Tregs alone ICOS CLTA-4

A 2,5 B 4 Number of cells (x 1-6 ) 2, 1,5 1, 5 CPM (x 1-3 ) 3 2 1 5 1 15 2 25 3 Days of culture 1/1 1/2 1/4 1/8 1/16 1/32 Treg/Teff ratio C alone alone alone alone CD25 FoxP3 GITR CD44 ICOS CLTA-4 CD127

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

MathIOmica: Dynamic Transcriptome

Printed from the Complete Wolfram Language Documentation 1 MathIOmica: Dynamic Transcriptome Loading the MathIOmica Package Classification, Clustering and Visualization of Transcriptome Time eries Importing

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

Supporting Information

Supporting Information Rothhammer et al. 1.173/pnas.161413114 SI Materials and Methods EAE Clinical Scoring and Agents. Clinical sig of EAE were assessed as follows:, no sig of disease; 1, loss of tone

Supplementary appendix

Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kennedy GA, Varelias A, Vuckovic S, et al.

Supplementary Figures and Tables. An inflammatory gene signature distinguishes neurofibroma Schwann cells and

Supplementary Figures and Tables An inflammatory gene signature distinguishes neurofibroma Schwann cells and macrophages from cells in the normal peripheral nervous system Kwangmin Choi 1, Kakajan Komurov

Department of International Health (Vaccine science track) Johns Hopkins University Bloomberg School of Public Health

Acute Respiratory Distress Syndrome is a TH17 and Treg immune disease By Wan-Jiung Hu Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2 Nangang 115, Taipei, Taiwan Previous

Deconvolution of Heterogeneous Wound Tissue Samples into Relative Macrophage Phenotype Composition via Models based on Gene Expression

Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2017 Supplementary Information for: Deconvolution of Heterogeneous Wound Tissue Samples into

Supplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells

Cell Systems, Volume 5 Supplemental Information High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells Eric Lin, Lianette Rivera-Báez, Shamileh Fouladdel, Hyeun

Use of Molecular Assays to Assess Cellular Therapies

Use of Molecular Assays to Assess Cellular Therapies D. Stroncek, P. Jin, M. Sabatino, J. Ren, L. Castiello, E. Wang, and F.M. Marincola. Cellular Therapies Section Clinical Center, NIH Methods for the

Jocelyn Chapman, MD Division of Gynecologic Oncology. Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic

Jocelyn Chapman, MD Division of Gynecologic Oncology Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic Genetics underlies all cancers Somatic or tumor genetics Germline or inherited genetics

Bouabid Badaoui 1 *, Teresa Rutigliano 1, Anna Anselmo 1, Merijn Vanhee 2 b, Hans Nauwynck 2, Elisabetta Giuffra 1 a, Sara Botti 1.

RNA-Sequence Analysis of Primary Alveolar Macrophages after In Vitro Infection with Porcine Reproductive and Respiratory Syndrome Virus Strains of Differing Virulence Bouabid Badaoui 1 *, Teresa Rutigliano

Supplementary Material. Part I: Sample Information. Part II: Pathway Information

Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours

Type of file: PDF Title of file for HTML: Peer Review File Description:

Type of file: pdf Title of file for HTML: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References Type of file: xlsx Title of file for HTML: Supplementary

To compare the relative amount of of selected gene expression between sham and

Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter

Biomedical Informatics Insights. Differential Transcriptional Changes in Mice Exposed to Chemically Distinct Diesel Samples

Biomedical Informatics Insights Original Research Open Access Full open access to this and thousands of other papers at http://www.la-press.com. Differential Transcriptional Changes in Mice Exposed to

Molecular mechanisms underlying anti-inflammatory phenotype of neonatal splenic macrophages

Molecular mechanisms underlying anti-inflammatory phenotype of neonatal splenic macrophages Lakshman Chelvarajan,*, Diana Popa,* Yushu Liu, Thomas V. Getchell,*, Arnold J. Stromberg, and Subbarao Bondada*,,1

Table S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in

APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE

AMP COMPANION MEETING SYMPOSIUM AT USCAP 2015 NEXT-GENERATION OF PATHOLOGY: ROLE OF PATHOLOGIST IN NGS-BASED PERSONALIZED MEDICINE APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST

Genes, Genes, Everywhere! The key to a cure for IBD

Genes, Genes, Everywhere! The key to a cure for IBD Dermot McGovern MD, PhD, FRCP Director, Translational Medicine Professor of Medicine Joshua L and Lisa Z Greer Endowed Chair in IBD Genetics F. Widjaja

PRIMARY IMMUNODEFICIENCIES TESTING REQUISITION

MOLECULAR GENETICS LABORATORY For courier service and/or inquiries, please contact 513-636-4474 Fax: 513-636-4373 www.cincinnatichildrens.org/moleculargenetics Email: LabGeneticCounselors@cchmc.org Shipping

Department of Psychiatry & Behavioral Sciences, Medical University of South Carolina, Charleston, SC, USA 9. [3,4]. Vitamin D 3

For reprint orders, please contact: reprints@futuremedicine.com Pharmacogenomics Systems analysis of the prostate transcriptome in African American men compared with European American men Aim: African

Molecular basis of age-associated cytokine dysregulation in LPS-stimulated macrophages

Uncorrected Version. Published on April 6, 2006 as DOI:10.1189/jlb.0106024 Molecular basis of age-associated cytokine dysregulation in LPS-stimulated macrophages R. Lakshman Chelvarajan,*, Yushu Liu, Diana

Regulation of inflammation by histone deacetylases in rheumatoid arthritis: beyond epigenetics Grabiec, A.M.

UvA-DARE (Digital Academic Repository) Regulation of inflammation by histone deacetylases in rheumatoid arthritis: beyond epigenetics Grabiec, A.M. Link to publication Citation for published version (APA):

Comparison of in vitro transfection efficiency of HBV plasmids between genotypes HBV expressing plasmids (5

Supplemental Materials Figures legend Supplemental Table 1, 2 and 3 Supplemental Figure 1, Figure 2 and Figure 3 Supplemental Figure 1 Comparison of in vitro transfection efficiency of HBV plasmids between

Sino Biological Inc.

Sino Biological Inc. GENE PROTEIN ANTIBODY ELISA Kit Established in 2007, Sino Biological is a global biotechnology company manufacturing high quality research reagents for basic, translational, and clinical

Multi-omics integration reveals molecular networks and regulators of psoriasis

Zhao et al. BMC Systems Biology (2019) 13:8 https://doi.org/10.1186/s12918-018-0671-x RESEARCH ARTICLE Multi-omics integration reveals molecular networks and regulators of psoriasis Yuqi Zhao 1, Deepali

Unstable Angina is a syndrome correlated to mixed Th17 and Th1 immune disorder

Unstable Angina is a syndrome correlated to mixed Th17 and Th1 immune disorder By Wan-Chung Hu* *Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2 Nangang 115, Taipei,

Jennifer Hauenstein Oncology Cytogenetics Emory University Hospital Atlanta, GA

Comparison of Genomic Coverage using Affymetrix OncoScan Array and Illumina TruSight Tumor 170 NGS Panel for Detection of Copy Number Abnormalities in Clinical GBM Specimens Jennifer Hauenstein Oncology

Precision Oncology: Experience at UW

Precision Oncology: Experience at UW Colin Pritchard MD, PhD University of Washington, Department of Lab Medicine WSMOS Meeting November 1, 2013 Conflict of Interest Disclosures I declare the following,

An Integrative Pharmacogenomic Approach Identifies Two-drug. Combination Therapies for Personalized Cancer Medicine

An Integrative Pharmacogemic Approach Identifies Two-drug Combination Therapies for Personalized Cancer Medicine Yin Liu 1,2,3, Teng Fei 4,5, Xiaoqi Zheng 6, Myles Brown 4,5, Peng Zhang 7*, X. Shirley

Supplemental Table unique genes

Supplemental Table 1 Inflammation KEGG ID Title Gene Count KEGG:mmu04662 B cell receptor signaling pathway 20 KEGG:mmu04060 Cytokine-cytokine receptor interaction 44 KEGG:mmu04010 MAPK signaling pathway

Cancer, inflammation, and immunity crosstalk

Contact Technical Support BRCsupport@QIAGEN.COM 1-800-362-7737 Cancer, inflammation, and immunity crosstalk Jesse Liang, Ph.D. Legal disclaimer QIAGEN products shown here are intended for molecular biology

Nature Genetics: doi: /ng Supplementary Figure 1. Depths and coverages in whole-exome and targeted deep sequencing data.

Supplementary Figure 1 Depths and coverages in whole-exome and targeted deep sequencing data. Depth (top) and coverage (bottom) of whole-exome sequencing for 38 independent JPN cases (mean depth = 130)

Research Article Significant Modules and Biological Processes between Active Components of Salvia miltiorrhiza Depside Salt and Aspirin

Evidence-Based Complementary and Alternative Medicine Volume 2016, Article ID 3439521, 10 pages http://dx.doi.org/10.1155/2016/3439521 Research Article Significant Modules and Biological Processes between

A Systems Biology Approach to the Analysis of Subset- Specific Responses to Lipopolysaccharide in Dendritic Cells

A Systems Biology Approach to the Analysis of Subset- Specific Responses to Lipopolysaccharide in Dendritic Cells David G. Hancock 1,2, Elena Shklovskaya 1,2, Thomas V. Guy 1,2, Reza Falsafi 3, Chris D.

(12) Patent Application Publication (10) Pub. No.: US 2010/ A1

(19) United States (12) Patent Application Publication (10) Pub. No.: US 2010/0196889 A1 Bankaitis-Davis et al. US 2010.0196.889A1 (43) Pub. Date: Aug. 5, 2010 (54) GENE EXPRESSION PROFILING FOR IDENTIFICATION,

Transcriptional profiling provides insights into metronomic cyclophosphamide-activated, innate immune-dependent regression of brain tumor xenografts

Doloff and Waxman BMC Cancer (2015) 15:375 DOI 10.1186/s12885-015-1358-y RESEARCH ARTICLE Open Access Transcriptional profiling provides insights into metronomic cyclophosphamide-activated, innate immune-dependent

Table 1: NFkB Target Gene Sets 1.Genes included in the subset of 15k genes selected according to a MAD-based variation filter

Supplementary Information NFkB target gene sets The NFkB target gene sets are listed below (Table1). In addition to the previously performed mapping of Affymetrix probesets and corresponding Lymphochip

T-Cell Network Example for GeneNet (August 2015) or later

T-Cell Network Example for GeneNet 1.2.13 (August 2015) or later This note reproduces the T-Cell network example from R. Opgen-Rhein and K. Strimmer. 2006a. Using regularized dynamic correlation to infer

antibody and ELISA experts Cancer Research Products

Cancer Research Products WWW.BOSTERBIO.COM Cancer Research Cancer is a leading cause of death in developed nations, affecting millions of people around the world. Research into the molecular basis of these

SUPPLEMENTARY INFORMATION

doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page The handle http://hdl.handle.net/1887/43190 holds various files of this Leiden University dissertation. Author: Raeven, R.H.M. Title: Systems vaccinology : molecular signatures of immunity to

A fresh approach to Immuno-oncology: Ex vivo analysis of drug efficacy in fresh patient tumortissue

A fresh approach to Immuno-oncology: Ex vivo analysis of drug efficacy in fresh patient tumortissue Soner Altiok, MD, PhD Chief Scientific Officer Nilogen Oncosystems Tampa, Florida - Nilogen Oncosystems,

Supporting Information

Supporting Information Lin et al. 10.1073/pnas.1408759111 Fig. S1. Safety and potential toxicity evaluation of M1 in immunocompetent mice. Immunocompetent BALB/c mice received two doses of i.v. infusion

Gene expression of muscular and neuronal pathways is cooperatively dysregulated in patients

Gene expression of muscular and neuronal pathways is cooperatively dysregulated in patients with idiopathic achalasia Orazio Palmieri 1, Tommaso Mazza 2, Antonio Merla 1, Caterina Fusilli 2, Antonello

Developing a clinically feasible personalized medicine approach to pediatric

Developing a clinically feasible personalized medicine approach to pediatric septic shock Hector R. Wong, Natalie Z. Cvijanovich, Nick Anas, Geoffrey L. Allen, Neal J. Thomas, Michael T. Bigham, Scott

Case Study - Informatics

bd@jubilantbiosys.com Case Study - Informatics www.jubilantbiosys.com Validating as a Prognostic marker and Therapeutic Target for Multiple Cancers Introduction Human genome projects and high throughput

Integrative analysis of genetic data sets reveals a shared innate immune component in autism spectrum disorder and its co-morbidities

Integrative analysis of genetic data sets reveals a shared innate immune component in autism spectrum disorder and its co-morbidities The MIT Faculty has made this article openly available. Please share

Direct Intracellular Regulators of Apoptosis Array 1

Supplement Table A Direct Intracellular Regulators of Apoptosis 2 Mean Name Description.5 2.2.9 ATM ataxia telangiectasia mutated homolog.9.8.9 Bcl2aa B-cell leukemia/lymphoma 2 related protein Aa.6 2..9

Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope

Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope National Medical Center Disclosures I have no disclosures

Inflammation and extracellular proteinases

Inflammation and extracellular proteinases Plaque rupture 75% of MI (heart attack) Foamy macrophages Thin cap No collagen Thin fibrous cap (

Changing the Culture of Cancer Care II. Eric Holland Fred Hutchinson Cancer Research Center University of Washington Seattle

Changing the Culture of Cancer Care II Eric Holland Fred Hutchinson Cancer Research Center University of Washington Seattle Transforming Cancer Therapy Eric Holland Fred Hutchinson Cancer Research Center

Illumina s Cancer Research Portfolio and Dedicated Workflows

Illumina s Cancer Research Portfolio and Dedicated Workflows Michael Sohn Clinical Sales Specialist Spain&Italy 2017 2017 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish,

PRIMARY IMMUNODEFICIENCIES GENE PANEL

PRIMARY IMMUNODEFICIENCIES GENE PANEL Gene symbol Depth Coverage OMIM (reads) (avg %) disease Description ACP5 96 95 200 Spondyloenchondrodysplasia with immune dysregulation ACTB 101 17 243310 Baraitser-Winter

Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease

Cronicon OPEN ACCESS EC DIABETES AND METABOLIC RESEARCH Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease Amr TM Saeb* University Diabetes Center, College

Cardiovascular Disease Products

Cardiovascular Disease Products For more information, visit: www.bosterbio.com Cardiovascular Disease Research Cardiovascular disease is the leading cause of death in developed nations. Boster Bio aims