CD Marker Antibodies. atlasantibodies.com
|
|
|
- Tyrone Nathaniel Golden
- 5 years ago
- Views:
Transcription
1 CD Marker Antibodies atlasantibodies.com
2
3 CD Marker Antibodies Product Name Product Number Validated Applications Anti-ACE HPA IHC,WB Anti-ACKR1 HPA IHC Anti-ACKR1 HPA IHC Anti-ADAM17 HPA IHC,ICC-IF Anti-ADAM17 HPA WB,ICC-IF Anti-ADGRE5 HPA IHC Anti-ALK HPA IHC,ICC-IF Anti-ANPEP HPA IHC,WB,ICC-IF Anti-ATP1B3 HPA IHC,ICC-IF Anti-BST2 HPA IHC,WB,ICC-IF Anti-BTLA HPA IHC Anti-BTLA HPA IHC Anti-CD14 AMAb90897 IHC,WB Anti-CD14 HPA IHC,WB,ICC-IF Anti-CD14 HPA IHC,WB Anti-CD151 HPA IHC Anti-CD163 HPA IHC,ICC-IF Anti-CD163 HPA IHC Anti-CD163L1 HPA IHC Anti-CD180 HPA IHC Anti-CD1A HPA IHC Anti-CD1D HPA ICC-IF Anti-CD2 HPA IHC Anti-CD207 HPA IHC,WB Anti-CD22 HPA IHC Anti-CD226 HPA IHC Anti-CD247 HPA IHC,WB Anti-CD27 HPA IHC,WB Anti-CD28 HPA IHC Anti-CD300LF HPA IHC Anti-CD33 HPA ICC-IF Anti-CD33 HPA IHC Anti-CD34 HPA IHC,WB Anti-CD34 HPA IHC,ICC-IF Anti-CD36 HPA IHC,WB Anti-CD37 HPA IHC,WB Anti-CD37 HPA IHC Anti-CD38 HPA IHC,WB Anti-CD38 HPA IHC,WB Anti-CD3E HPA IHC,WB Anti-CD3E HPA IHC,WB Anti-CD3G HPA IHC,WB Anti-CD4 HPA IHC,WB Anti-CD4 AMAb90754 IHC,WB Anti-CD14 (HPA001887) staining of human appendix shows cytoplasmic positivity in immune cells. Anti-CD38 (HPA022132) staining of human tonsil shows strong cytoplasmic and membranous positivity in non-germinal center cells. Western blot analysis in human cell line Daudi. Anti-CD4 (HPA00425) staining of human tonsil shows moderate cytoplasmic positivity in lymphoid cells outside reaction centra. Western blot analysis in human spleen tissue. Anti-CD40 HPA IHC Anti-CD40 HPA IHC,WB
4 Product Name Product Number Validated Applications Anti-CD40 AMAb90905 IHC,WB Anti-CD40LG HPA IHC,WB Anti-CD44 HPA IHC,WB,ICC-IF Anti-CD46 HPA IHC Anti-CD47 HPA IHC Anti-CD48 HPA ICC-IF Anti-CD5 HPA IHC Anti-CD5 HPA IHC Anti-CD55 HPA IHC,WB Anti-CD55 HPA IHC Anti-CD59 HPA IHC,WB,ICC-IF Anti-CD63 HPA IHC Anti-CD68 HPA IHC,WB Anti-CD68 AMAb90873 IHC Anti-CD68 AMAb90874 IHC,WB Anti-CD69 HPA IHC Anti-CD7 HPA IHC Anti-CD72 HPA IHC,ICC-IF Anti-CD74 HPA IHC,WB Anti-CD80 HPA IHC Anti-CD81 HPA IHC,ICC-IF Anti-CD82 HPA IHC,WB Anti-CD83 HPA IHC,ICC-IF Anti-CD84 HPA IHC Anti-CD8A HPA IHC Anti-CD8A AMAb90883 IHC Anti-CD8B HPA ICC-IF Anti-CD93 HPA IHC,WB,ICC-IF Anti-CD93 HPA IHC,WB Anti-CD96 HPA IHC Anti-CD99 HPA IHC Anti-CDCP1 HPA IHC Anti-CDCP1 HPA IHC Anti-CDH1 HPA IHC Anti-CDH1 AMAb90862 IHC,WB Anti-CDH1 AMAb90863 IHC,WB Anti-CDH1 AMAb90865 IHC,WB Anti-CDH2 HPA IHC Anti-CEACAM1 HPA IHC,WB Anti-CLEC4M HPA IHC Anti-CR1 HPA IHC Anti-CR1 HPA IHC Anti-CR1 HPA IHC,WB Anti-CR2 HPA IHC Anti-CR2 HPA IHC,WB Anti-CSF1R HPA IHC,WB,ICC-IF Anti-CSF3R HPA IHC Anti-CXCR2 HPA IHC Anti-CXCR2 HPA IHC Anti-CXCR3 HPA IHC Anti-CXCR5 HPA IHC Anti-DDR2 HPA ICC-IF Anti-ENG HPA IHC,WB Anti-ENG HPA IHC Anti-ENG AMAb90925 IHC Anti-ENPP1 HPA IHC Anti-ENPP3 HPA IHC Anti-CD46 (HPA016903) staining of human prostate shows distinct membranous positivity in glandular cells. Anti-CD68 (HPA048982) staining of human tonsil shows strong cytoplasmic positivity in a subset of non-germinal center cells. Western blot analysis in U-87MG ATCC cells transfected with control sirna, target specific sirna probe #1 and #2, using Anti-CD68 antibody. Remaining relative intensity is presented. Loading control: Anti-GAPDH. Anti-CD74 (HPA010592) staining of human tonsil shows strong membranous and cytoplasmic positivity in germinal center cells and in non-germinal center cells. Western blot analysis in human cell line Daudi. Anti-CDH1 (HPA004812) staining of human kidney shows membranous positivity in distal tubules.
5 Product Name Product Number Validated Applications Anti-ENTPD1 HPA IHC,WB Anti-EPCAM HPA IHC,WB Anti-EPCAM HPA ICC-IF Anti-HER2 HPA ICC-IF Anti-HER2 HPA ICC-IF Anti-HER2 AMAb90627 IHC,WB Anti-F11R HPA IHC Anti-FCAR HPA IHC,ICC-IF Anti-FCGR2A HPA IHC,WB Anti-FCGR2B HPA IHC Anti-FCGR3A HPA IHC,WB Anti-FGFR3 HPA ICC-IF Anti-FZD10 HPA IHC,ICC-IF Anti-FZD10 HPA IHC,ICC-IF Anti-GGT2 HPA IHC,WB Anti-GGT2 HPA IHC,WB Anti-GP1BA HPA IHC Anti-GP9 HPA IHC Anti-GYPA HPA IHC Anti-GYPC HPA IHC,WB Anti-HMMR HPA ICC-IF Anti-ICAM1 HPA IHC,WB Anti-ICAM1 HPA IHC,WB Anti-IFITM1 HPA IHC,WB,ICC-IF Anti-IFNGR1 HPA ICC-IF Anti-IFNGR1 HPA IHC,WB Anti-IGF2R HPA IHC,ICC-IF Anti-IL2RA HPA IHC Anti-IL2RB HPA IHC Anti-IL2RG HPA IHC,WB Anti-IL4R HPA IHC Anti-ITGA2 HPA IHC Anti-ITGA2 HPA IHC Anti-ITGA2B HPA IHC Anti-ITGA2B HPA IHC Anti-ITGA2B HPA IHC,WB Anti-ITGA2B HPA IHC Anti-ITGA3 HPA IHC,WB Anti-ITGA5 HPA IHC,WB Anti-ITGAM AMAb90911 IHC,WB Anti-ITGAV HPA IHC,ICC-IF Anti-ITGAX HPA IHC Anti-ITGAX AMAb90915 IHC,WB Anti-ITGB2 HPA IHC,WB Anti-ITGB2 HPA IHC,WB,ICC-IF Anti-ITGB3 HPA IHC Anti-FCAR (HPA014050) Immunofluorescent staining of human cell line U-251 MG shows localization to plasma membrane. Antibody staining is shown in green. Anti-LAIR1 (HPA011155) staining of human lymph node shows strong cytoplasmic positivity in lymphoid cells outside reaction centra. Immunofluorescent staining of human cell line U-251 MG shows localization to plasma membrane. Antibody staining is shown in green. Anti-IL4R (HPA050124) staining of human tonsil shows moderate cytoplasmic positivity in germinal center cells. staining of human small intestine shows moderate cytoplasmic positivity in lymphoid cells. Anti-KIT (AMAb90904) Western blot analysis in human cell line THP-1 Anti-GAP- DH. Anti-ITGB4 HPA IHC,WB,ICC-IF Anti-ITGB4 HPA IHC,WB Anti-JAG1 HPA IHC Anti-KIT HPA ICC-IF Anti-KIT HPA IHC Anti-KIT AMAb90901 IHC,WB Anti-KIT AMAb90904 IHC,WB Anti-KLRK1 HPA ICC-IF Anti-LAG3 HPA IHC Anti-LAIR1 HPA IHC,WB,ICC-IF Anti-LAMP1 HPA IHC staining of human small intestine shows strong immunoreactivity in a subset of lymphoid cells.. Lane 1: Marker [kda] Lane 2: Human cell line RT-4
![Lane 1: Marker [kda] 230, 130, 95, 72, 56, 36, 28, 17, 11 Lane 2: Human cell line RT-4 Lane 3: Human cell line U-251MG sp Lane 4: Human plasma (IgG/HSA depleted) Lane 5: Human liver tissue](/docs-images/89/97696098/images/6-4.jpg "Lane 6: Human tonsil tissue Anti-NCAM1 (HPA039835) staining of human cerebral cortex shows distinct positivity in neuropil.")
6 Product Name Product Number Validated Applications Anti-LAMP1 HPA IHC Anti-LAMP2 HPA IHC Anti-LAMP3 HPA IHC,ICC-IF Anti-LRP1 HPA IHC Anti-LRP1 HPA IHC,WB,ICC-IF Anti-LY75 HPA IHC,WB Anti-MCAM HPA IHC,WB Anti-MME HPA IHC Anti-MME HPA IHC Anti-MRC1 HPA IHC,WB Anti-MRC1 HPA IHC,WB Anti-MRC1 AMAb90746 IHC,WB Anti-MRC2 HPA IHC Anti-MS4A1 HPA IHC,WB Anti-MS4A1 HPA IHC Anti-MSR1 HPA IHC,WB Anti-MUC1 HPA IHC Anti-MUC1 HPA IHC Anti-MUC1 HPA IHC,ICC-IF Anti-NCAM1 HPA IHC,WB,ICC-IF Anti-NGFR HPA IHC,WB,ICC-IF Anti-NT5E HPA IHC,WB,ICC-IF Anti-PDCD1 HPA IHC,WB Anti-PDGFRA HPA ICC-IF Anti-PRNP HPA IHC Anti-PROCR HPA IHC Anti-PVRL2 HPA IHC Anti-S1PR1 HPA ICC-IF Anti-SELP HPA IHC Anti-SELP HPA IHC Anti-SIGLEC1 HPA IHC,WB Anti-SIGLEC5 HPA IHC,WB Anti-SIGLEC6 HPA IHC,WB Anti-SIGLEC6 HPA IHC Anti-SLAMF7 HPA IHC,WB Anti-SLAMF8 HPA IHC Anti-SLC3A2 HPA IHC,WB,ICC-IF Anti-SLC44A1 HPA ICC-IF Anti-SPN HPA IHC Anti-TEK HPA ICC-IF Anti-TFRC HPA IHC,WB,ICC-IF Anti-THBD HPA IHC,WB,ICC-IF Anti-THY1 HPA IHC,ICC-IF Anti-THY1 AMAb90844 IHC,WB Anti-THY1 AMAb90846 IHC,WB Anti-TLR8 HPA IHC Anti-MS4A1 (HPA014341) staining of human spleen shows strong cytoplasmic positivity in cells of white pulp. Lane 1: Marker [kda] 230, 130, 95, 72, 56, 36, 28, 17, 11 Lane 2: Human cell line RT-4 Lane 3: Human cell line U-251MG sp Lane 4: Human plasma (IgG/HSA depleted) Lane 5: Human liver tissue Lane 6: Human tonsil tissue Anti-NCAM1 (HPA039835) staining of human cerebral cortex shows distinct positivity in neuropil. Immunofluorescent staining of human cell line U-2 OS shows localization to plasma membrane & cytosol. Antibody staining is shown in green. Anti-PDGFRA (HPA004947) Immunofluorescent staining of human cell line CACO-2 shows localization to nucleoplasm, plasma membrane & cell junctions. Antibody staining is shown in green. Western blot analysis in human brain tissue. Anti-TNFRSF11A HPA ICC-IF Anti-TNFRSF13C HPA IHC,WB Anti-TNFSF11 HPA IHC Anti-TSPAN7 HPA IHC,WB Anti-TSPAN7 AMAb90621 IHC,WB Anti-TSPAN7 AMAb90624 IHC Anti-VCAM1 HPA IHC
7
8 atlasantibodies.com Our website provides you with easy access to all characterization data, and online ordering via our web shop. You can also send your order to or send an to to discuss any matters regarding use of antibodies. You ll find we re Totally Human. Atlas Antibodies AB Voltavägen 13A SE Bromma, Sweden atlasantibodies.com Phone +46(0) Fax +46(0)
ptglab.com PECAM1: Customer Testimonial
ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called
HTG EdgeSeq Immuno-Oncology Assay Gene List
A2M ABCB1 ABCB11 ABCC2 ABCG2 ABL1 ABL2 ACTB ADA ADAM17 ADGRE5 ADORA2A AICDA AKT3 ALCAM ALO5 ANA1 APAF1 APP ATF1 ATF2 ATG12 ATG16L1 ATG5 ATG7 ATM ATP5F1 AL BATF BA BCL10 BCL2 BCL2L1 BCL6 BID BIRC5 BLNK
Sino Biological Inc.
Sino Biological Inc. GENE PROTEIN ANTIBODY ELISA Kit Established in 2007, Sino Biological is a global biotechnology company manufacturing high quality research reagents for basic, translational, and clinical
BD Rhapsody Immune Response Panel Hs
Doc ID: 55665 Rev. 2.0 PRODUCT INSERT BD Rhapsody Immune Response Panel Hs BD Biosciences Kit Part Number: 633750 Purpose The BD Rhapsody Immune Response Panel Hs is a set of ready-to-use primer pools
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
Supplemental Figure 1: Anti-GDF15 antibody blocks binding of GDF15 to hgfral.
Supplemental Figure 1: Anti-GDF15 antibody blocks binding of GDF15 to hgfral. Anti-GDF15 antibody (mab26, a neutralizing monoclonal antibody to wtgdf15) blocks binding of GDF15 to human GFRAL in a dose-dependent
Supplemental Figure 1. Mother. Son. Brother. Nephew. Sister (deceased)
Supplemental Figure 1 IRF8:NM_002163:c.C602T IRF8:NM_002163:c.C671T M Son Br Nephew Sister (deceased) Supplemental Figure 1. Confirmation of family member IRF8 variants by Sanger sequencing. The proband
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Anti-DC-SIGN/CD209 murine monoclonal antibodies
Anti-DC-SIGN/CD209 murine monoclonal antibodies DC-SIGN (DC Specific, ICAM-3 Grabbing, Nonintegrin) / CD209 and L-SIGN (liver/lymph node-specific ICAM-3-grabbing nonintegrin CD299/ DC-SIGNR (DC-SIGN-related
Immunology. Antibodies for immunology research
Immunology Antibodies for immunology research antibodies for immunology research BP0169 BP0003-1 BP0004-1 BP0061 CD4 + T cells Control LOB12.3 Relative Cell Number CD4 (55 kda) CD8α (35 kda) CD8α (35 kda)
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Supplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells
Cell Systems, Volume 5 Supplemental Information High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells Eric Lin, Lianette Rivera-Báez, Shamileh Fouladdel, Hyeun
Supplemental Table 1: Enriched GO categories per cluster
Supplemental Table 1: Enriched GO categories per cluster Cluster Enriched with #genes Raw p-value Corrected p-value Frequency in set (%) Cluster 1 immune response - GO:0006955 32 2.36E-14 0.001 13.5 Cluster
Biomarkers of cancer immunotherapy Jason Luke, MD, FACP
Biomarkers of cancer immunotherapy Jason Luke, MD, FACP Assistant Professor of Medicine Disclosures Consultancy: 7 Hills, Actym, Amgen, Array, AstraZeneca, BeneVir, Bristol-Myers Squibb, Castle, CheckMate,
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Department of International Health (Vaccine science track) Johns Hopkins University Bloomberg School of Public Health
Acute Respiratory Distress Syndrome is a TH17 and Treg immune disease By Wan-Jiung Hu Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2 Nangang 115, Taipei, Taiwan Previous
Transduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
Eosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
Cardiovascular Disease Products
Cardiovascular Disease Products For more information, visit: www.bosterbio.com Cardiovascular Disease Research Cardiovascular disease is the leading cause of death in developed nations. Boster Bio aims
To compare the relative amount of of selected gene expression between sham and
Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter
Title: Single Cell Dual Adherent-Suspension Co-Culture Micro-Environment for Studying Tumor- Stromal Interactions
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2016 Title: Single Cell Dual Adherent-Suspension Co-Culture Micro-Environment for Studying Tumor-
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.
Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: immunoprecipitation with anti-casr antibody The Casr protein was expressed in transiently transfected HEK cells. Cell lysates from HEK cells were subjected
A. Forced Myc expression increases total B cells in bone marrow of premalignant mice
31 Nemajerova et al. Supplemental Figures Supplemental Figure 1 A. Forced Myc expression increases total B cells in bone marrow of premalignant mice independently of the presence or absence of p73. Cells
Antibodies for human plasmacytoïd dendritic cells studies Dendritics SAS, 60 avenue Rockefeller, F Lyon
Antibodies for human plasmacytoïd dendritic cells studies Dendritics SAS, 60 avenue Rockefeller, F-69008 Lyon www.dendritics.net Human plasmacytoïd dendritic cells (PDCs) are considered the main sentinels
DISCOVER MORE WITH LESS SAMPLE. nanostring.com/3d
nanostring.com/3d DISCOVER MORE WITH LESS SAMPLE. WHY COMPROMISE? ncounter Vantage ASSAYS POWERED BY 3D BIOLOGY TECHNOLOGY Don t let sample volume limit your analytical aspirations. Quantify DNA, RNA,
The circulating T helper subsets and regulatory T cells in patients with common variable immunodeficiency with no monogenic disease
1 Supplementary data The circulating T helper subsets and regulatory T cells in patients with common variable immunodeficiency with no monogenic disease Azizi et al. 2 Table S1. Excluded 373 genes variants
Supplementary Table S1: Gene expression targets
Supplementary Table S1: Gene expression targets Probe ID Gene ID Gene Descriptions Cell type Antigen-dependent activation MmugDNA.32422.1.S1_at CD180 CD180 molecule B 1 MmugDNA.18254.1.S1_at CD19 CD19
Gene Target NCBI_NAME NCBI_ACCESSION GENE_FUNCTION ABCF1 ABCF1_ ATP_binding_cassette_subfamily_F_member_1 NM_ Housekeeping ADGRE5
ABCF1 ABCF1_11741283 ATP_binding_cassette_subfamily_F_member_1 NM_001025091 Housekeeping ADGRE5 ADGRE5_26552764 adhesion_g_protein coupled_receptor_e5 NM_078481 Adhesion,migration ADORA2A ADORA2A_771873
MACS Marker Screen. MACS Marker Screen. Catalog antibodies. antibodies CD4 (VIT4) CD11b. MACS Marker Screen antibodies. Catalog. antibodies CD2 CD14
MACS Marker Screen The performance of MACS Marker Screen was tested and compared with catalog reagents offered in single vials as liquid antibody reagents. The were reconstituted using 25 µl of deionized
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
LN04 - Lymphoma Tissue Microarray
Reveal Biosciences offers Histochemical Staining, Immunohistochemistry (IHC), In Situ Hybridization (ISH), Whole Slide Imaging, and Quantitative Image Analysis on any TMA LN04 - Lymphoma Tissue Microarray
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
A fresh approach to Immuno-oncology: Ex vivo analysis of drug efficacy in fresh patient tumortissue
A fresh approach to Immuno-oncology: Ex vivo analysis of drug efficacy in fresh patient tumortissue Soner Altiok, MD, PhD Chief Scientific Officer Nilogen Oncosystems Tampa, Florida - Nilogen Oncosystems,
Differentiation and Protective Capacity of Virus- Specific CD8 + T Cells Suggest Murine Norovirus Persistence in an Immune-Privileged Enteric Niche
Article Differentiation and Protective Capacity of Virus- Specific CD8 + T Cells Suggest Murine Norovirus Persistence in an Immune-Privileged Enteric Niche Graphical Abstract Authors Vesselin T. Tomov,
Type of file: PDF Title of file for HTML: Peer Review File Description:
Type of file: pdf Title of file for HTML: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References Type of file: xlsx Title of file for HTML: Supplementary
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Unravelling subclonal heterogeneity and aggressive disease states in TNBC through single-cell RNA-seq
ARTICLE DOI:.8/s67-8-6- OPEN Unravelling subclonal heterogeneity and aggressive disease states in TNBC through single-cell RNA-seq 6789():,; Mihriban Karaayvaz, Simona Cristea,,, Shawn M. Gillespie,, Anoop
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
SUPPLEMENTARY INFORMATION
doi:10.1038/nature15260 Supplementary Data 1: Gene expression in individual basal/stem, luminal, and luminal progenitor cells. Box plots show expression levels for each gene from the 49-gene differentiation
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Department of International Health (Vaccine science track) Johns Hopkins University Bloomberg School of Public Health
Sepsis is a syndrome with hyperactivity of TH17-like innate immunity and hypoactivity of adaptive immunity By Wan-Jiung Hu Postdoctorate Genomics Research Center Academia Sinica No 128 Academia Road section2
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
Protein Catalogue. Sino Biological Biological Solution Specialist. ili: V, ::J ::J ::J. ö (0 C (1) N --0
V, ::J 0 OJ 0 0 (0 0 0 - ::J 0 --0 0 ili: ::J 0 0 ö 0 (0 C (1) N 0 Protein Catalogue N 0 Sino Biological Biological Solution Specialist SinoBiological Inc. Established in 2007, Sino Biological is a global
Immunohistochemistry Research Products
Immunohistochemistry Research Products Multiple Tissue Arrays (MTA) Primary and Secondary Antibodies Detection Systems Antigen Retrieval Solutions Tissue Processing Fixatives BD Biosciences Clontech Discovery
Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases
Supplementary Tables: Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases Supplementary Table 2: Contingency tables used in the fisher exact
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure S1. CNTRL-FGFR1 fusion kinase induces both T-cell lymphoma and AML. A) Peripheral blood smears from a CNTRL-FGFR1 mouse, showing predominance of immature
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Supplementary Material: Exploring wound-healing genomic machinery with a network-based approach
Supplementary Material: Exploring wound-healing genomic machinery with a network-based approach Francesca Vitali, Simone Marini, Martina Balli, Hanne Grosemans, Maurilio Sampaolesi, Yves A. Lussier, Maria
Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5
Product Datasheet DARC Antibody NB100-2421 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb100-2421
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
Anti-PD-L1 antibody [28-8] ab205921
![Anti-PD-L1 antibody [28-8] ab205921](/thumbs/84/91196262.jpg "Anti-PD-L1 antibody [28-8] ab205921")
Anti-PD-L1 antibody [28-8] ab205921 2 Abreviews 16 References 15 Images Overview Product name Anti-PD-L1 antibody [28-8] Description Tested applications Species reactivity Immunogen Rabbit monoclonal [28-8]
Chapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues
Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages
Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc.
Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc. Cellecta, Inc. Founded: April 2006 Headquarters: Mountain View, CA 12 SBIR Grants Custom Service Provider for Functional
Granulocyte and lymphocyte proteins
Granulocyte and lymphocyte proteins Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized partner in the development and manufacturing
Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
Supplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
qpcr-array Analysis Service
qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Department of Psychiatry & Behavioral Sciences, Medical University of South Carolina, Charleston, SC, USA 9. [3,4]. Vitamin D 3
![Department of Psychiatry & Behavioral Sciences, Medical University of South Carolina, Charleston, SC, USA 9. [3,4]. Vitamin D 3](/thumbs/86/93312719.jpg "Department of Psychiatry & Behavioral Sciences, Medical University of South Carolina, Charleston, SC, USA 9. [3,4]. Vitamin D 3")
For reprint orders, please contact: reprints@futuremedicine.com Pharmacogenomics Systems analysis of the prostate transcriptome in African American men compared with European American men Aim: African
MT09 - Normal Human Tissue Microarray, FDA
Reveal Biosciences offers Histochemical Staining, Immunohistochemistry (IHC), In Situ Hybridization (ISH), Whole Slide Imaging, and Quantitative Image Analysis on any TMA MT09 - Normal Human Tissue Microarray,
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Immunological characterization of a recipient of a cross-match positive. Thet Su Win, Naoka Murakami, Thiago J. Borges, Anil Chandraker, George
Supplementary Materials Immunological characterization of a recipient of a cross-match positive face transplant Thet Su Win, Naoka Murakami, Thiago J. Borges, Anil Chandraker, George Murphy, Christine
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
CATALOG OF ANTIBODIES FOR IMMUNOLOGY
CATALOG OF ANTIBODIES FOR IMMUNOLOGY Table of Contents Innate Immunity... 2-8 Cytokines... 2-4 Chemokines... 4-6 Toll-Like Receptors... 7-8 Adaptive Immunity...9-13 B Cells...9-10 T Cells...11-12 MHCs...
Supplementary Information
Supplementary Information Supplementary Figure 1. Western blotting with ERβ antibodies Full blots corresponding to Fig. 2, along with replicated experiments at different time points, different batches,
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
ANKH Ankylosis, progressive homolog NP_ Type3 ANPEP Alanyl (membrane) aminopeptidase NP_ Type2
Supplementary Table S1. List of Membrane Proteins Whose Gene Expression Intensity Ratios in Mesenchymal Stem Cells Compared with Mononuclear Cells and Fibroblasts Could Be Mapped ACP2 Acid phosphatase
Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
8: Lymphatic vessels and lymphoid tissue. nur
8: Lymphatic vessels and lymphoid tissue nur Lymphatic vascular system Functions return to the blood extracellular fluid (Lymph) from connective tissue spaces. ensures the return of water, electrolytes
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Characterization of HPV Tg/+ ; Krt17 / mice. (a) Macroscopic images of HPV16 Tg/+ mouse ears at P40, P70 and P120. (b) Immunostaining of HPV16 Tg/+ ear tissue sections for K17 (red)
CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
150 International Union of Immunological Societies Primary Immunodeficiency Disease Classification. IgG. loss of function
2008 Vol. 20No. 2175 IgG 46 T T T loss of function 150 International Union of Immunological Societies Primary Immunodeficiency Disease Classification Committee 8 1 1 T B 2 3 4 5 6 7 8 120 1 B 2 Infectious
Lymphoid Organs and Lymphocyte Trafficking. Dr. Issa Abu-Dayyeh
Lymphoid Organs and Lymphocyte Trafficking Dr. Issa Abu-Dayyeh Invader recognition Where does invader recognition take place?? Secondary lymphoid organs: Lymph nodes Spleen Mucosal-associated lymphoid
Bronchoalveolar lavage fluid analysis showed increased eosinophil in 30% of subjects with IrIa BAL
Bronchoalveolar lavage fluid analysis showed increased eosinophil in 30% of subjects with IrIa BAL UBC Chan-Yeung Centre for Occupational and Environmental Respiratory Disease Understanding exposure effects
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of
Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular Chondrocytes by Paracrine Secretion Lei Xu, Yuxi Wu, Zhimiao Xiong, Yan Zhou, Zhaoyang Ye *, Wen-Song Tan * State Key Laboratory of
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
Supporting Information
Supporting Information Rothhammer et al. 1.173/pnas.161413114 SI Materials and Methods EAE Clinical Scoring and Agents. Clinical sig of EAE were assessed as follows:, no sig of disease; 1, loss of tone
IN VITRO MODELS OF LYMPHATIC ENDOTHELIAL CELLS: CYTOKINE RECEPTOR EXPRESSION PROFILING AND INCORPORATION INTO ORGANOTYPIC CULTURE MODELS
IN VITRO MODELS OF LYMPHATIC ENDOTHELIAL CELLS: CYTOKINE RECEPTOR EXPRESSION PROFILING AND INCORPORATION INTO ORGANOTYPIC CULTURE MODELS by Fan Yang BS. Shandong University, China, 2014 Submitted to the
An Integrative Pharmacogenomic Approach Identifies Two-drug. Combination Therapies for Personalized Cancer Medicine
An Integrative Pharmacogemic Approach Identifies Two-drug Combination Therapies for Personalized Cancer Medicine Yin Liu 1,2,3, Teng Fei 4,5, Xiaoqi Zheng 6, Myles Brown 4,5, Peng Zhang 7*, X. Shirley
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
VDx: Unlocking Complex Diagnostics
VDx: Unlocking Complex Diagnostics VDx now offers PARR testing in-house on formalin-fixed tissue Complicated Case? Is this cat s chronic lymphocytic enteritis really chronic IBD or is this early small
The Lymphatic System
The Lymphatic System The Lymphatic Systems Overview General Functions Organization Components Lymphatic System General Functions Transportation Excess fluid from capillary exchange Fats & fat soluble vitamins
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Stable transfected HEK293-OATP cells for transporter analysis A model system for the assay of drug uptake.
Stable transfected HEK293-OATP cells for transporter analysis A model system for the assay of drug uptake. PRIMACYT Cell Culture Technology GmbH, Hagenower Str. 73, D-19061 Schwerin, Germany E-mail: info@primacyt.com,
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11986 relative IL-6 expression Viable intracellular Bp per well 18 16 1 1 5 5 3 1 6 +DG 8 8 8 Control DG Time (h) hours B. pertussis IL-6 (pg/ml) 15 Control DG
Prestige Antibodies in Neuroscience
ExPlore with Confidence: Prestige Antibodies in Neuroscience The life science business of Merck KGaA, Darmstadt, Germany operates as MilliporeSigma in the U.S. and Canada. A Prestige Antibodies In Neuroscience