Identifying transcriptional dichotomies by "stochastic sampling"

Size: px
Start display at page:

Download "Identifying transcriptional dichotomies by "stochastic sampling""

Transcription

1 Identifying transcriptional dichotomies by "stochastic sampling" Kevin Janes and Joan Brugge Department of Cell Biology Harvard Medical School pakt (S473) keratin 10 DAPI National Cancer Institute (CA105134) American Cancer Society (PF MGO) Nikon Imaging HMS

2 Of Mice and Men for mathematicians (why working with mammalian cells is annoying) 1. Removing or fluorescently tagging an endogenous protein is very time consuming (human >> mouse) 2. Mammalian reporters of transcription actual gene expression 3. Mechanistic power ~ (organismal relevance) -1 But... it s us

3 Heterogeneities during in vitro mammary acinar morphogenesis Laminin 5 GM130 (Golgi) phospho-akt cleaved caspase-3 Debnath and Brugge, Nat. Rev. Cancer (2005) Inner cells Apoptosis Clearance MCF-10A Outer cells P-Akt positive P-Akt negative Mature acinus

4 Heterogeneity within 3D structures K10 pakt (S473) FOXO1/4 vigilin Sudan black autofluorescence MCF10A-5E, day 10 Scale bar: 25 μm

5 Transcriptional profiling with single-cell PCR

6 Identifying molecular dichotomies by stochastic sampling

7 Pick n cells at random B rand (n,p) Iterate for m experiments chance of Calculate average gene expression [(5x3)+(1x7)] x noise(σ) Normalize and calculate histogram counts per bin X(b) 1 b reproducibility histogram bins Fit to the expected normal distribution X(b) b X(b) = Aexp [-(b-1) ] 2σ 2 average of middle four bins Calculated sum of squared error Binomial Control Compare with control gene (p = 0)

8 Optimal stochastic sampling with 10 cells and 16 replicates replicates 10 cells 0.25 SSE from normal fit SSE from normal fit Number of cells Number of experiments 16 replicates 10 cells 1.0 Dichotomy Control Correlation (R) 0.0 Correlation (R) Number of cells Number of experiments 8-fold difference in 20% of the population 25% measurement error

9 Single-cell cdna amplification In-house modifications (part 1) 5' mrna 3' AAAA...AAAAAAA + oligo(dt) TTTT...TTTTTTT oligo(dt) 24 Superscript III, 15 min at 50 o C AMV, MMLV reverse transcriptases, 15 min at 37 o C 5' mrna 3' bp AAAA...AAAAAAA TTTT...TTTTTTT RNAse H TTTT...TTTTTTT terminal transferase datp AAAAAAA...AAAA TTTT...TTTTTTT Replaced Minor improvements Major improvements

10 Single-cell cdna amplification In-house modifications (part 2) AAAAAAA...AAAA TTTT...TTTTTTT 10U AmpliTaq, ThermoPol Buffer 4 PCR cycles (94 o C,37 o C,72 o C) 3x sample split AL1 primer: AL1 seq TTTT...TTTT U AmpliTaq, PCR Buffer II 50 PCR cycles (94 o C,42 o C,72 o C) AAAA...AAAA TTTT...TTTT AL1 seq TTTT...TTTT AAAA...AAAA 21 PCR cycles (94 o C,42 o C,72 o C) AL1 seq AL1 seq' AAAA...AAAA TTTT...TTTT AL1 seq TTTT...TTTT AAAA...AAAA AL1 seq AL1 seq' Pool sample splits 5 PCR cycles (94 o C,42 o C,72 o C) Detect PCR fragments Replaced Minor improvements Major improvements

11 Quantitative amplification of small cell populations Cycle threshold n.d gapdh m = -3.9 m p = -3.5 Cycle threshold n.d prdx6 m = -3.5 m p = -3.7 Cycle threshold n.d btg1 m = -3.8 m p = -3.1 Cells Cells Cells Cycle threshold n.d fbxo32 m = -2.9 m p = -3.6 Cycle threshold n.d cav1 m = -3.4 m p = -3.5 Cycle threshold n.d map2k2 m = -2.9 m p = -3.4 Cells Cells Cells Cycle threshold n.d ccnb1 m = -3.9 m p = -3.0 Cycle threshold n.d runx1 m = -3.3 m p = -3.2 Frequency cell replicates = 0.36 Cells Cells Mean-centered C T

12 Heterogeneities during in vitro mammary acinar morphogenesis Laminin 5 GM130 (Golgi) phospho-akt cleaved caspase-3 Debnath and Brugge, Nat. Rev. Cancer (2005) Inner cells Apoptosis Clearance MCF-10A Outer cells P-Akt positive P-Akt negative Mature acinus

13 The FOXO regulatory network Akt FOXO Metabolism Growth arrest Transcription Signaling Sesn1 Sox4 Cav1 Hdlbp Cdkn1a Fbxo32 Sod2 Btg1 Sema3c

14 Dichotomous nucleocytoplasmic localization of FOXO-family members FOXO1/4 FOXO3a FOXO1/4 E-cadherin FOXO3a E-cadherin MCF10A-5E, day 10 Scale bar: 25 m

15 The FOXO regulatory network Akt FOXO Metabolism Growth arrest Transcription Signaling Sesn1 Sox4 Cav1 Hdlbp Cdkn1a Fbxo32 Sod2 Btg1 Sema3c

16 The FOXO regulatory network Transcription factor Transcriptional coactivator Unknown IKK Akt SGK Cdk2 JNK FOXO Metabolism Growth arrest Transcription Signaling Sesn1 Sox4 Cav1 Hdlbp Cdkn1a Fbxo32 Sod2 Btg1 Sema3c p53 Ets STAT AP-2 GATA-6 PR SREBP-1 C/EBP Sp3 Sp1 NF-κB PPARγ c-myc

17 Selective time-dependent induction of FOXO targets during morphogenesis Fold induction (log 10 ) prdx6 s100a hint1 cdkn1c sema3c fbxo32 btg1 sod2 sesn1 krt10 sox4 cav1 gapdh ccnb1 ubc cdkn1a Day of morphogenesis Known FOXO target Reported FOXO target Loading controls Other

18 Identifying heterogeneously expressed FOXO targets Sectioning Microdissection Amplification FOXO active Akt active FOXO inactive e.g., GAPDH

19 LCM cap Section Slide Infrared laser Polymer wetting Captured cells Arcturus Bioscience

20 Localized microdissection of outer cells Before After Scale bar: 20 μm

21 Stochastic sampling of matrix-attached cells at d10 of morphogenesis 8 ccnb1 4 sox4 sesn1 cdkn1c Group 1 Fold change from mean btg1 sema3c prdx6 gapdh hint1 s100a6 ubc cdkn1a cav1 Group fbxo32 sod Repeated 10-cell samplings krt10 Known FOXO target Reported FOXO target Loading controls Other

22 Fluctuations in stochastic samplings are not due to measurement noise 8 ccnb1 ccnb1 4 sox4 sesn1 btg1 s100a6 Fold change from mean cdkn1c btg1 sema3c prdx6 gapdh hint1 s100a6 ubc cdkn1a prdx6 cdkn1a ubc sema3c sod2 fbxo32 hint1 sox4 cav1 cav1 krt fbxo32 sod2 gapdh sesn Stochastic samplings krt10 cdkn1c Measurement replicates Known FOXO target Reported FOXO target Loading controls Other

23 Multicolor RNA fluorescence in situ hybridization sensitivity vigilin-dig Alexa 488 MnSOD Alexa 555 Merge Scale bar: 25 m

24 Image segmentation and quantification

25 Independent single-cell regulation of fbxo32 and sod2 expression Time course fbxo32-dnp Alexa 488 sod2-dig Alexa 555 Stochastic sampling Loading Alexa 647 Loading-normalized sod R = Loading-normalized fbxo32 Scale bar: 25 m

26 Time course Single-cell coregulation of fbxo32 and cav1 expression fbxo32-dnp Alexa 488 cav1-dig Alexa 568 Stochastic sampling Loading Alexa 647 Loading-normalized cav R = Loading-normalized fbxo Scale bar: 25 m

27 Single-cell coregulation among genes within FOXO subclusters identified by stochastic sampling ccnb1 sox4 sesn1 cdkn1c btg1 sema3c hint1 s100a6 prdx6 gapdh ubc cdkn1a cav1 fbxo32 sod2 krt10 Single-cell pairwise correlation Strong (R > 0.6) Weak (0.4 < R 0.6) None (R 0.4) n = cells FOXO subclusters

28 Normal probability plots of RNA FISH data 0.6 fbxo32-cav1-cdkn1c cluster 0.6 btg1-cdkn1c-sox4-sesn1-sema3c cluster Log-transformed quantiles p > 0.5 (J-B test) n = Standard Normal Quantile Log-transformed quantiles p < 0.05 (J-B test) n = Standard Normal Quantile

29

30 Single-cell cdna reamplification In-house modifications (part 3) AL1 seq' AAAA...AAAA TTTT...TTTT AL1 seq TTTT...TTTT AAAA...AAAA AL1 seq AL1 seq' 3.5 U High Fidelity polymerase PCR cycles (94 o C,42 o C,72 o C) H Aminoallyl-dUTP: U C=C NH 2 H H HC=C NH 2 AL1 seq' AAAA...AAAA U TTTT...TTTT AL1 seq TTTT...TTTT U AAAA...AAAA HC=C NH 2 H Alexa Fluor 555 succinimidyl ester H O HC=C N C AL1 seq' AAAA...AAAA U TTTT...TTTT AL1 seq TTTT...TTTT U AAAA...AAAA HC=C N C H O = = : O = L O C AL1 seq AL1 seq' AL1 seq AL1 seq' Replaced Minor improvements Major improvements

31 Validated stochastic profiling of 10-cell samples with Illumina gene chips Replicate reamplification-labeling-hybridization Replicate measurement Reamplification replicate # R 2 = Measurement replicate # R 2 = Reamplification replicate # Measurement replicate #1 Kristin Cabral Children s Hospital

32 Stochastic profiling of matrix-attached cells 3 targets 1 ligand 1 receptor 1 receptor 1 TF 3 targets 18 translation genes 1 transcription factor Covarying genes among random samplings Random samplings of 10 cells

33 Novel dichotomies identified by stochastic profiling of matrix-attached cells Receptors Cytoplasmic proteins Transcription factors Control JNK1 Day 10 Scale bar: 25 m

34

35 Heterogeneous multiacinar formation upon inducible activation of ErbB2 ErbB2 homodimers No dimerizer With dimerizer Muthuswamy et al., Nat Cell Biol 3:785 (2001) Normal acini: Ductal carcinoma in situ:

36 Single-cell heterogeneity in cancer Irish et al., Cell 118:217 (2004) "Lung cancer heterogeneity. Prognostic implications." Cancer 60:370 (1987). "Gastric cancer heterogeneity." Cancer 63:791 (1989). "Human breast cancer: heterogeneity of estrogen binding sites." Cancer 48:1791 (1981).... Shipitsin et al., Cancer Cell 11:259 (2007)

37

Reoviruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics

Reoviruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics Reoviruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Virion Naked icosahedral capsid (T=13), diameter 60-85 nm Capsid consists of two or three concentric protein

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Intersection of FOXO- and RUNX1-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression

Intersection of FOXO- and RUNX1-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression Intersection of FOXO- and RUNX-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression Lixin Wang a,, Joan S. rugge b, and Kevin. Janes a,, a Department

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

THE SPLICING FACTOR ONCOPROTEIN SRSF1 REGULATES APOPTOSIS AND PROLIFERATION TO PROMOTE MAMMARY EPITHELIAL CELL TRANSFORMATION

THE SPLICING FACTOR ONCOPROTEIN SRSF1 REGULATES APOPTOSIS AND PROLIFERATION TO PROMOTE MAMMARY EPITHELIAL CELL TRANSFORMATION SUPPLEMENTARY INFORMATION THE SPLICING FACTOR ONCOPROTEIN SRSF1 REGULATES APOPTOSIS AND PROLIFERATION TO PROMOTE MAMMARY EPITHELIAL CELL TRANSFORMATION Olga Anczuków, Avi Z. Rosenberg, Martin Akerman,

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,

More information

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets. Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature15260 Supplementary Data 1: Gene expression in individual basal/stem, luminal, and luminal progenitor cells. Box plots show expression levels for each gene from the 49-gene differentiation

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Next-Generation Immunohistochemistry: Multiplex tissue imaging with mass cytometry

Next-Generation Immunohistochemistry: Multiplex tissue imaging with mass cytometry Nat Met, April 2014 Nat Med, April 2014 Next-Generation Immunohistochemistry: Multiplex tissue imaging with mass cytometry Journal Club Timo Böge Overview Introduction Conventional Immunohistochemistry

More information

MicroRNA and Male Infertility: A Potential for Diagnosis

MicroRNA and Male Infertility: A Potential for Diagnosis Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

Introduction to Systems Biology of Cancer Lecture 2

Introduction to Systems Biology of Cancer Lecture 2 Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

The Avatar System TM Yields Biologically Relevant Results

The Avatar System TM Yields Biologically Relevant Results Application Note The Avatar System TM Yields Biologically Relevant Results Liquid biopsies stand to revolutionize the cancer field, enabling early detection and noninvasive monitoring of tumors. In the

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1 a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac

More information

Bayesian Inference for Single-cell ClUstering and ImpuTing (BISCUIT) Elham Azizi

Bayesian Inference for Single-cell ClUstering and ImpuTing (BISCUIT) Elham Azizi Bayesian Inference for Single-cell ClUstering and ImpuTing (BISCUIT) Elham Azizi BioC 2017: Where Software and Biology Connect Profiling Tumor-Immune Ecosystem in Breast Cancer Immunotherapy treatments

More information

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae

More information

Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters

Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Supplementary Data: Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Tiffany Hung 1,2, Yulei Wang 3, Michael F. Lin 4,5, Ashley K. Koegel 1,2, Yojiro Kotake 6-8, Gavin

More information

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in

More information

Next-Gen Analytics in Digital Pathology

Next-Gen Analytics in Digital Pathology Next-Gen Analytics in Digital Pathology Cliff Hoyt, CTO Cambridge Research & Instrumentation April 29, 2010 Seeing life in a new light 1 Digital Pathology Today Acquisition, storage, dissemination, remote

More information

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Fumagalli D, Venet D, Ignatiadis M, et al. RNA Sequencing to predict response to neoadjuvant anti-her2 therapy: a secondary analysis of the NeoALTTO randomized clinical trial.

More information

Spatially resolved multiparametric single cell analysis. Technical Journal Club 19th September 2017 Christina Müller (Group Speck)

Spatially resolved multiparametric single cell analysis. Technical Journal Club 19th September 2017 Christina Müller (Group Speck) Spatially resolved multiparametric single cell analysis Technical Journal Club 19th September 2017 Christina Müller (Group Speck) Why spatially resolved multiparametric single cell analysis? Multiparametric

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

PD-L1 Analyte Control DR

PD-L1 Analyte Control DR Quality in Control PD-L1 Analyte Control DR PD-L1_PI_v2 Product Codes: HCL019, HCL020 and HCL021 Contents PD-L1 Analyte Control DR 2 What is PD-L1? 3 The Role of PD-L1 in Cancer 3 PD-L1 Assessment 4 PD-L1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

ChIP-seq analysis. J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand

ChIP-seq analysis. J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand ChIP-seq analysis J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand Tuesday : quick introduction to ChIP-seq and peak-calling (Presentation + Practical session)

More information

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford Lecture 8 Understanding Transcription RNA-seq analysis Foundations of Computational Systems Biology David K. Gifford 1 Lecture 8 RNA-seq Analysis RNA-seq principles How can we characterize mrna isoform

More information

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28 A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER"

IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER" Edmond Marzbani, MD December 2, 2008 Early diagnosis of cancer Many solid tumors are potentially curable if diagnosed at an early stage

More information

WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx

WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines

More information

Protein SD Units (P-value) Cluster order

Protein SD Units (P-value) Cluster order SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

Rishabh Kala 1, Harsh N. Shah 1, Samantha L. Martin 1 and Trygve O. Tollefsbol 1,2,3,4,5*

Rishabh Kala 1, Harsh N. Shah 1, Samantha L. Martin 1 and Trygve O. Tollefsbol 1,2,3,4,5* Kala et al. BMC Cancer (2015) 15:672 DOI 10.1186/s12885-015-1693-z RESEARCH ARTICLE Open Access Epigenetic-based combinatorial resveratrol and pterostilbene alters DNA damage response by affecting SIRT1

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Gene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering

Gene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering Gene expression analysis Roadmap Microarray technology: how it work Applications: what can we do with it Preprocessing: Image processing Data normalization Classification Clustering Biclustering 1 Gene

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

Phosphorylation Site Company Cat #

Phosphorylation Site Company Cat # Supplemental Table 1. Antibodies used for RPPA analysis. Label Protein Phosphorylation Site Company Cat # Used on MDA_CLSS Used on MDA_Pilot 4EBP1 4EBP1 Cell Signaling 9452 No 4EBP1.pS65 4EBP1 S65 Cell

More information

Regulation of the IGF axis by TGF-b during periosteal chondrogenesis: implications for articular cartilage repair

Regulation of the IGF axis by TGF-b during periosteal chondrogenesis: implications for articular cartilage repair Regulation of the IGF axis by TGF-b during periosteal chondrogenesis: implications for articular cartilage repair Chapter 04 Boek 1_Gie.indb 55 21-05-2007 12:27:33 Chapter 04 Abstract Goal: TGF-b and IGF-I

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION -. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental

More information

Product Introduction. Product Codes: HCL029, HCL030 and HCL031. Issue

Product Introduction. Product Codes: HCL029, HCL030 and HCL031. Issue Product Introduction Product Codes: HCL029, HCL030 and HCL031 Issue 1. 180510 Contents Introduction to Estrogen Receptor 2 ER immunohistochemistry 3 Quality control 5 Cell lines as controls 6 Estrogen

More information

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

More information

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation. SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic

More information

The Role of the ErbB2/PI 3-K/Akt1 Pathway in the Development of Hormone. Department of Human Science, School of Nursing and Health Studies, Georgetown

The Role of the ErbB2/PI 3-K/Akt1 Pathway in the Development of Hormone. Department of Human Science, School of Nursing and Health Studies, Georgetown The Role of the ErbB2/PI 3-K/Akt1 Pathway in the Development of Hormone Resistance in Breast Cancer Whitney A. Cesari Department of Human Science, School of Nursing and Health Studies, Georgetown University,

More information

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each

More information

Supplement to SCnorm: robust normalization of single-cell RNA-seq data

Supplement to SCnorm: robust normalization of single-cell RNA-seq data Supplement to SCnorm: robust normalization of single-cell RNA-seq data Supplementary Note 1: SCnorm does not require spike-ins, since we find that the performance of spike-ins in scrna-seq is often compromised,

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high

More information

Prediction of invasiveness of hepatic tumor cells

Prediction of invasiveness of hepatic tumor cells Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1 1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary

More information

Cell cycle and apoptosis

Cell cycle and apoptosis Cell cycle and apoptosis Cell cycle Definition Stages and steps Cell cycle Interphase (G1/G0, S, and G2) Mitosis (prophase, metaphase, anaphase, telophase, karyokinesis, cytokinesis) Control checkpoints

More information

Plasma-Seq conducted with blood from male individuals without cancer.

Plasma-Seq conducted with blood from male individuals without cancer. Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Signal Transduction Pathway Smorgasbord

Signal Transduction Pathway Smorgasbord Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb) Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer

More information