Epigenetic Histone Methylation Modulates Fibrotic Gene Expression

Transcription

1 Epigenetic Histone Methylation Modulates Fibrotic Gene Expression Guangdong Sun, Marpadga A. Reddy, Hang Yuan, Linda Lanting, Mitsuo Kato, and Rama Natarajan Gonda Diabetes Center, Beckman Research Institute of the City of Hope, Duarte, California; and Division of Nephrology, nd Hospital of Jilin University, Changchun, China ABSTRACT TGF- induced expression of extracellular matrix (ECM) genes plays a major role in the development of chronic renal diseases such as diabetic nephropathy. Although many key transcription factors are known, mechanisms involving the nuclear chromatin that modulate ECM gene expression remain unclear. Here, we examined the role of epigenetic chromatin marks such as histone H lysine methylation (HKme) in TGF- induced gene expression in rat mesangial cells under normal and high-glucose () conditions. TGF- increased the expression of the ECM-associated genes connective tissue growth factor, collagen- [ ], and plasminogen activator inhibitor-. Increased levels of chromatin marks associated with active genes (HKme, HKme, and HKme), and decreased levels of repressive marks (HK9me and HK9me) at these gene promoters accompanied these changes in expression. TGF- also increased expression of the HK methyltransferase SET7/9 and recruitment to these promoters. SET7/9 gene silencing with sirnas significantly attenuated TGF- induced ECM gene expression. Furthermore, a TGF- antibody not only blocked -induced ECM gene expression but also reversed -induced changes in promoter HKme levels and SET7/9 occupancy. Taken together, these results show the functional role of epigenetic chromatin histone HKme in TGF- mediated ECM gene expression in mesangial cells under normal and conditions. Pharmacologic and other therapies that reverse these modifications could have potential renoprotective effects for diabetic nephropathy. BASIC RESEARCH J Am Soc Nephrol :,. doi:.8/asn. TGF- has been implicated in various human disorders including vascular and renal diseases. Diabetic nephropathy (DN) is a chronic renal complication characterized by the thickening of glomerular and tubular basement membranes and progressive accumulation of extracellular matrix (ECM) proteins such as type I and type IV collagens, fibronectin, and laminin in the tubular interstitium and mesangium. Induction of profibrotic TGF- by diverse mediators such as high glucose (), advanced glycation endproducts (AGEs), and angiotensin II in glomerular mesangial cells (MCs) and other renal cells has been implicated in these events. 9 TGF- also increases ECM accumulation through induction of its downstream effector, connective tissue growth factor (CTGF),, and by decreasing matrix degradation through inhibition of proteases or activation of protease inhibitors such as plasminogen activator inhibitor- (PAI-). A TGF- specific antibody had significant anti-fibrotic effects in animal models of DN, including db/db type, and streptozotocin-induced type di- Received June,. Accepted July 8,. Published online ahead of print. Publication date available at. Correspondence: Dr. Rama Natarajan, Department of Diabetes, Beckman Research Institute of the City of Hope, East Duarte Road, Duarte, CA 9. Phone: --7, ext. 89; Fax: --8; RNatarajan@coh.org Copyright by the American Society of Nephrology J Am Soc Nephrol :, ISSN : -7/-

2 abetic mice and prevented -induced increase in matrix protein synthesis in renal cells., TGF- can regulate gene expression through Smad transcription factors and E-box dependent mechanisms.,7 However, the subtle nuclear chromatin mechanisms involved in TGF- induced expression of key ECM genes in MCs are not clear. Gene regulation by extracellular stimuli involves not only transcription factors binding to their cognate DNA binding sites but also epigenetic changes in chromatin without alterations in DNA sequence. Post-translational modifications on amino-terminal tails of nucleosomal histones such as histone H and H, including acetylation, methylation, and ubiquitination at key lysines, play key roles in modulating chromatin structure and gene transcription., They form a histone code that can dictate transcriptional outcomes of gene activation or repression. In general, acetylation of histone H lysines (HKAc) is associated with active gene transcription, whereas methylation (HKme) can be associated with either active or inactive gene promoters depending on the position of lysine modified. HKAc is mediated by histone acetyl transferases and HKme by histone methyltransferases (HMTs). HMTs can mono-, di-, or tri-methylate (HKme, -me, -me) specific lysine residues, thereby adding another epigenetic regulatory layer. Histone HKme is usually associated with gene activation and transcriptional elongation and is mediated by HMTs such as SET, MLL, and SET7/9., HK9me, on the other hand, is generally associated with gene repression and is mediated by HMTs such as SUV9H, G9a, and SETDB/ESET. Other lysines, including HK7, HK, and HK79, can also be methylated to various degrees. In addition, the discovery of histone lysine demethylases has added another dimension to gene regulation. 7 Together, these factors create a fine balance of gene regulation, a disruption of which could result in abnormal gene expression and disease phenotypes. To date, it is not known whether promoter histone H lysine methylation plays a role in TGF- induced transcription of ECM-associated genes in MCs or whether the effects of on such epigenetic events can be mediated through TGF-. Here we show that TGF- leads to the enrichment of HKme// and depletion of HK9me/ marks at ECM-associated gene promoters in rat MCs. A TGF- antibody could reverse -induced changes in HKme at these fibrotic gene promoters along with reductions in their expression. Furthermore, the HK HMT SET7/9 seemed to play a role in TGF- induced ECM gene expression. These data show novel epigenetic chromatin mechanisms in TGF- actions in MCs related to ECM deposition and DN. RESULTS ECM-Associated Genes Are Increased, Whereas, Reciprocally, Repressive HK9me Levels Are Decreased at Their Promoters in TGF- Treated Rat Mesangial Cells We first examined whether TGF- induced expression of key ECM-related genes was associated with changes in the repressive epigenetic marks HK9me and HK9me at their promoters. Serum-depleted rat mesangial cells (RMCs) were stimulated with TGF- ( ng/ml) for various time periods, and gene expression levels were analyzed by RT-QPCR. Collagen- (I) chain (Cola), CTGF, and PAI- mrna levels were significantly increased by TGF- from to hours compared with control, whereas the housekeeping gene CypA showed no difference under these conditions (Figure A). Immunoblotting showed that protein levels of collagen I, CTGF, and PAI- (Figure B) were also similarly increased by TGF-. These results confirmed that TGF- can upregulate ECM-associated genes in RMCs. A mrna: Cola ctrl h h PAI- ctrl h h h h B Western blot IB:Collagen IB:CTGF IB:PAI- IB:β-actin h h Fold stimulation ctrl h h h h CTGF ctrl h h h h CypA ctrl h h h h Figure. TGF- increases the expression of ECM-associated genes in RMCs. (A) Serum depleted RMCs were stimulated with TGF- ( ng/ml) for various time periods ( to hours), and mrna levels of ECM-associated genes (Cola, CTGF, and PAI-) and housekeeping gene cyclophilin A (CypA) were analyzed by RT-QPCR. Gene expression was normalized to internal control -actin gene, and results are expressed as fold stimulation over control (ctrl) (mean SEM; P ; P versus ctrl, n ). (B) Western blot analysis of RMC cell lysates from control and TGF- treated RMCs using collagen I, CTGF, PAI-, and -actin antibodies. Results shown are representative of two separate experiments. Journal of the American Society of Nephrology J Am Soc Nephrol :,

3 BASIC RESEARCH We next performed chromatin immunoprecipitation (ChIP) assays with HK9me- and HK9me-specific antibodies. ChIP-enriched DNA samples were analyzed by quantitative PCR (QPCR) using primers spanning Smad binding sites and nearby cis-elements at these promoters (Figure A). Levels of both HK9me (Figure B) and HK9me (Figure C) at the Cola, CTGF, and PAI- promoters were significantly reduced in RMCs treated with TGF- fromto hours compared with control. In contrast, there were no significant differences at the CypA promoter. These results suggest that TGF- induced expression of these genes may be caused, at least in part, by a loss of repressive epigenetic histone modifications at their promoters. TGF- Enhances HKme Levels at the Promoters of ECM-Associated Genes We next examined whether TGF- could alter promoter levels of HKme, an epigenetic active mark, using ChIP assays with HKme, HKme, or HKme antibodies. As shown in Figure A, TGF- increased HKme levels at the Cola and CTGF promoters in RMCs at hours, and this was sustained up to hours. At the PAI- promoter, HKme levels were significantly increased only at hours. TGF- enhanced HKme levels from to hours at Cola and PAI- promoters, with no significant changes at the CTGF promoter (Figure B). TGF- significantly increased HKme levels at the Cola, CTGF, and PAI- promoters (Figure C). These increases A -8-7 SBE -7-9 SBE -8 - TSS PAI SBE - - TSS CTGF SBE -7 - TSS Cola B ChIP: HK9me Fold Enrichment C ChIP: Cola CTGF PAI- CypA HK9me Fold Enrichment HK9me Fold Enrichment HK9me Fold Enrichment HK9me Fold Enrichment HK9me Fold Enrichment HK9me Fold Enrichment HK9me Fold Enrichment Figure. TGF- decreases HK9me/ levels at ECM-associated gene promoters in RMCs. (A) Map showing locations of Cola, CTGF, and PAI- promoter primers used for ChIP-QPCRs. TSS, transcription start site; SBE, Smad binding elements. (B and C) Bar graphs showing HK9me (B) and HK9me (C) levels at the indicated gene promoters in control and TGF- ( ng/ml)-stimulated RMCs. ChIP assays were performed with HK9me and HK9me antibodies as described in Concise Methods. Immunoprecipitated DNA and input DNA were subjected to QPCRs with primers specific for the indicated gene promoters to measure enrichment levels. QPCR data were analyzed using the Ct method, and results normalized to input DNA were expressed as fold over respective untreated control (ctrl) cells (mean SEM; P ; P versus ctrl, n ). J Am Soc Nephrol :, TGF- and Histone Methylation

4 A ChIP: HKme Fold Enrichment B ChIP: HKme Fold Enrichment C ChIP: HKme Fold Enrichment 8 7 Cola CTGF PAI- CypA HKme Fold Enrichment HKme Fold Enrichment HKme Fold Enrichment HKme Fold Enrichment HKme Fold Enrichment HKme Fold Enrichment 7 7 HKme Fold Enrichment HKme Fold Enrichment HKme Fold Enrichment Figure. TGF- upregulates HKme// levels at ECM-associated gene promoters. HKme (A), HKme (B), and HKme (C) levels at indicated promoters in RMCs treated without (control, ctrl) or with TGF- ( ng/ml) for various time periods. ChIP assays were performed as described in Figure with specific antibodies, and results normalized to input DNA were expressed as fold enrichment over respective untreated ctrl (mean SEM; P ; P versus ctrl, n ). in promoter HKme// levels correlated with the increased expression of these genes by TGF-. On the other hand, the CypA promoter showed no significant changes in these marks, confirming specificity. These results suggest that increases in promoter HKme may be involved in TGF- induced upregulation of ECM-associated genes in RMCs. TGF- Specific Antibody Reverses -Induced Inhibition of Repressive HK9me in RMCs Serum-depleted RMCs were pretreated with TGF- specific antibody ( g/ml) or control mouse IgG ( g/ml) and then treated with either normal glucose ( mm) plus mm mannitol (), or ( mm) for 8 hours. Gene expression was evaluated by RT-QPCR, whereas promoter enrichments of HK9me or HK9me were assessed by ChIP-QPCRs. As shown in Figure A, significantly increased Cola, CTGF, and PAI- mrna levels compared with. These changes were significantly inhibited by TGF- antibody but not control IgG. More interestingly, ChIP assays showed that significantly decreased HK9me (Figure B) and HK9me levels (Figure C) at the Cola, CTGF, and PAI- promoters compared with, and this inhibitory effect of was significantly reversed by TGF- antibody but not IgG control. There were no significant differences at the CypA promoter. These results suggest that -induced ECM gene expression in RMCs is associated with decreased repressive marks HK9me and HK9me, which can be reversed, at least in part, by the TGF- antibody. TGF- Specific Antibody Reverses -Induced Increases in Promoter HKme in RMCs We next tested whether can increase active HKme marks at the promoters of ECM-associated genes and whether this can be reversed by the TGF- antibody. Serum-depleted RMCs were pretreated with TGF- antibody or IgG for hour and then treated with or for 8 hours, followed by ChIP assays with specific antibodies. Results showed that significantly increased HKme (Figure A), HKme (Figure B), and HKme (Figure C) levels at the Cola, CTGF, and PAI- promoters compared with. TGF- antibody, but not IgG, significantly attenuated these -induced increases (except for HKme at the Cola promoter; Figure, A C). In contrast, the CypA promoter showed no significant differences Journal of the American Society of Nephrology J Am Soc Nephrol :,

5 BASIC RESEARCH A mrna:. Cola. CTGF. PAI- +IgG +TGF-β Ab +ΙgG +TGF-β Ab +IgG +TGF-β Ab B ChIP: Cola CTGF PAI- CypA HK9me Fold Enrichment C ChIP: HK9me Fold Enrichment HK9me Fold Enrichment HK9me Fold Enrichment +IgG +IgG +TGF-β Ab +IgG +IgG +TGF-β Ab +IgG +IgG +TGF-β Ab +IgG +IgG +TGF-β Ab HK9me Fold Enrichment HK9me Fold Enrichment +IgG +IgG +TGF-β Ab +IgG +IgG +TGF-β Ab +IgG +IgG +TGF-β Ab +IgG +IgG +TGF-β Ab HK9me Fold Enrichment HK9me Fold Enrichment Figure. TGF- specific antibody reverses -induced expression of ECM-associated genes and -induced changes in HK9me/ at their promoters in RMCs. (A) mrna levels of ECM-associated genes in RMCs. Serum-depleted RMCs were pretreated with TGF- specific antibody ( g/ml) or mouse IgG ( g/ml) for hour and then treated with ( mm glucose mm mannitol) or ( mm glucose) for 8 hours. Gene expression was analyzed by RT-QPCR, and results are expressed as fold stimulation over cells (mean SEM; P versus ; P versus, n ). (B) HK9me and (C) HK9me enrichment levels at ECM and CypA gene promoters in RMCs treated with or pretreated with IgG or TGF- antibodies. ChIP assays were performed as described in Figure, and results are expressed as fold enrichment relative to (mean SEM; P versus ; P versus, n ). among all of the groups. These findings, coupled with the effects seen on HK9me/, show the mediatory role of TGF- in -induced epigenetic events at promoters of ECM genes and their subsequent expression and that blockade of these events may be a key mechanism for the antifibrotic and renoprotective effects of the TGF- antibody. SET7/9 Expression Is Increased by TGF- in RMCs We next examined the role of SET7/9, a HK mono-methyltransferase, in ECM gene expression. We first observed that SET7/9 mrna levels were increased by TGF- ( ng/ml) in a time-dependent fashion in RMCs (Figure A). SET7/9 protein levels were also increased (Figure, B and C). Pretreatment with actinomycin D ( g/ml) abolished TGF- induced SET7/9 mrna (Figure D), showing that TGF- may regulate SET7/9 at the level of transcription. TGF- Increases SET7/9 Recruitment to ECM-Associated Gene Promoters Next, we examined whether TGF- alters SET7/9 occupancy using ChIP assays with SET7/9 antibodies. Results showed that SET7/9 recruitment was significantly increased at the Cola, J Am Soc Nephrol :, TGF- and Histone Methylation

6 A ChIP: HKme Fold Enrichment B ChIP: HKme Fold Enrichment C ChIP: HKme Fold Enrichment IgG +IgG +IgG Cola CTGF PAI- CypA +IgG +IgG +IgG +TGF-β Ab +TGF-β Ab +TGF-β Ab HKme Fold Enrichment HKme Fold Enrichment HKme Fold Enrichment. +IgG +IgG +IgG +IgG +IgG +IgG +TGF-β Ab +TGF-β Ab +TGF-β Ab HKme Fold Enrichment HKme Fold Enrichment HKme Fold Enrichment.... +IgG +IgG +IgG +IgG +IgG +IgG +TGF-β Ab +TGF-β Ab +TGF-β Ab HKme Fold Enrichment HKme Fold Enrichment HKme Fold Enrichment +IgG +IgG +IgG +IgG +IgG +IgG +TGF-β Ab +TGF-β Ab +TGF-β Ab Figure. TGF- specific antibody reverses -induced HKme at ECM gene promoters in RMCs. (A C) Bar graphs showing the HKme (A), HKme (B), and HKme (C) levels at ECM and CypA gene promoters in RMCs pretreated with TGF- specific antibody ( g/ml) or mouse IgG ( g/ml) for hour, followed by treatment with or for 8 hours. ChIP assays were performed as described in Figure, and results are expressed as fold enrichment relative to (mean SEM; P versus ; P versus, n ). CTGF, and PAI- promoters from to hours after TGF- stimulation compared with control, with no change at the CypA promoter (Figure 7A). The SET7/9 recruitment pattern was quite similar to the increased HKme (Figure A), except at the PAI- promoter, suggesting a key role for SET7/9 in TGF- mediated increase in HKme in the induction of ECM genes. TGF- Specific Antibody Can Block -Induced SET7/9 Recruitment We next observed that can also enhance SET7/9 recruitment to the Cola, CTGF, and PAI- promoters compared with (Figure 7B). Furthermore, the TGF- antibody (but not IgG control) could significantly block these -induced increases in SET7/9 recruitment (Figure 7B). SET7/9 occupancy at the CypA promoter showed no differences under these conditions. These results suggest a mediatory role for TGF- in -induced SET7/9 recruitment and increased HKme at ECM gene promoters. SET7/9 Knockdown Can Attenuate TGF- Induced Expression of ECM-Associated Genes We further studied the functional role of SET7/9 in TGF- induced gene expression. RMCs were first transfected with various concentrations of sirna oligonucleotides targeting SET7/9 (siset7/9) or control sirnas (sineg). After 8 hours, total RNA from transfected cells was analyzed by RT-QPCR. As shown in Figure 8A, SET7/9 mrna levels were significantly reduced in RMCs transfected with si- SET7/9, with maximum inhibition at ng and no further decrease at ng. Next, RMCs were transfected with ng of siset7/9 or sineg, and 7 hours later, lysates were Journal of the American Society of Nephrology J Am Soc Nephrol :,

7 BASIC RESEARCH A mrna: B C IB:SET7/9 IB:β-actin SET7/9 Levels(Fold Over Control) D mrna: SET7/9 In this report, we first confirmed that TGF- can upregulate ECM-associated genes Cola, CTGF, and PAI- in RMCs. We then examined changes in key epigenetic chromatin marks, including histone HK9me/ and HKme// levels, at these gene promoters. Our results showed that these marks and the HK HMT and SET7/9 are involved in TGF- and -induced up-regulation of ECM-associated genes in RMCs. Furthermore, a TGF- antibody could reverse -induced changes in the levels of these promoter marks, and this correlated with the antibody-induced inhibition of their expression in RMCs. Increasing evidence shows that HK9me and HK9me marks are recognized by heterochromatin protein and generally correlate with gene silencing and transcriptional repression.,7,8 Our previous study showed that, in vascular smooth muscle cells (VSMCs) derived from diabetic db/db mice, HK9me levels were decreased at key inflammatory genes promoters and inversely correlated with the increased expression of these genes under basal and TNF- treated conditions. 9 Furthermore, human VSMCs and endothelial cells cultured under conditions also exhibited decreased levels of HK9me,,9 suggesting that a loss of the repressive HK9me mark can increase the expression of pathologic genes under diabetic conditions. Our current results showed for the first time that TGF- decreased HK9me and HK9me levels on Cola, CTGF, and PAI- promoters, and this inversely correlated with increased expression of these genes, thereby further supporting the notion that a relief of transcriptional repression caused by decreases in repressive chromatin histone modifications may contribute to increased expression of fibrotic genes by TGF-. We also showed that up-regulation of HKme// marks usually associated with active chromatin occurs in parallel with the downregulation of HK9me/ by TGF-, suggesting that this can further contribute to the increased gene expres- ctrl h h h h... analyzed by immunoblotting with SET7/9 antibody. As shown in Figure 8B, siset7/9 also significantly reduced SET7/9 protein levels compared with sineg. We next examined whether SET7/9 sirna can affect TGF-β ( ng/ml) ctrl h h h h ctrl h h h h. SET7/9 Actinomycin D Figure. TGF- induces the expression of SET7/9 mrna and protein in RMCs. (A) SET7/9 mrna expression in RMCs after TGF- treatment for various time periods was analyzed by RT-QPCR, normalized to internal control -actin gene, and expressed as fold stimulation over control (ctrl) (mean SEM; P ; P versus ctrl, n ). (B) Cell lysates from control (ctrl) RMCs and cells treated with TGF- for indicated time periods were analyzed by immunoblotting with SET7/9 and -actin antibodies. (C) SET7/9 protein levels were quantified by scanning densitometry, and results are expressed as fold over ctrl (mean SEM; P ; P versus ctrl, n ). (D) SET7/9 mrna expression in RMCs pretreated with or without actinomycin D followed by stimulation with TGF-. Gene expression was analyzed by RT-QPCR and normalized to internal control -actin gene, and results were expressed as fold stimulation over no actinomycin D and no TGF- treatment (mean SEM; P ; P versus no actinomycin D and no TGF- ; $ P versus no actinomycin D and TGF-, n ). $ HKme in RMCs because previous studies showed that SET7/9 can regulate HKme in endothelial cells and monocytes 8 and induce HKme in pancreatic islet cells, whereas others reported that SET7/9 may not mediate HKme or that it can activate transcription by also methylating nonhistone protein substrates. We transfected RMCs with siset7/9 and examined global HKme levels by immunoblotting. Total HKme levels were clearly decreased in SET7/9 knockdown RMCs compared with sineg, whereas HKme and HKme levels were not affected (Figure 8C). Thus, SET7/9 most likely mediates HKme, but not HKme or HKme, in RMCs. Furthermore, TGF- induced Cola, CTGF, and PAI- mrna levels were significantly attenuated by siset7/9 compared with sineg (Figure 8D). In contrast, CypA mrna levels were not affected (Figure 8D). These results further support a key role for SET7/9 in modulating TGF- responses in RMCs. DISCUSSION J Am Soc Nephrol :, TGF- and Histone Methylation 7

8 sociated genes. Knockdown of SET7/9 with sirnas could decrease global HKme, but not HKme or HKme, levels, suggesting that SET7/9-mediated HKme plays a key role, at least in part, in ECM-associated gene expression and that SET7/9 may be a potential therapeutic target for fibrotic disorders such as DN. The observed increases in HKme might synergize with other complementary events occurring at these promoters, such as increases in HKme and decreases in HK9me/, to enhance ECM gene expression in response to TGF- (Figure 9). Furthermore, the HMTs and histone demethylases (HDMs), as well as histone acetyl transferases (HATs) and histone deacetylases (HDACs) regulating these other chromatin marks, may also play cooperative roles. Additional studies are needed to assess these factors, including the role of HMTs that mediate HKme/ and HK9me/. It was suggested that SET7/9-mediated HK methylation functions in transcriptional activation by competing with HDACs to enhance H-K9 acetylation and prevent H-K9 methylation., SET7/9 can also methylate nonhistone proteins including p,, DNMT, TAF, and p., Furthermore, SET7/9 could regulate a subset of TNF- induced NF- B dependent inflammatory genes in monocytes 8 and -induced expression of NF- B p and inflammatory genes in endothelial cells. 9 These data show the diverse phys- A ChIP: Cola CTGF PAI- CypA 7 B ChIP: +IgG +IgG +TGF-β Ab IgG. +IgG +TGF-β Ab Figure 7. TGF- enhances SET7/9 recruitment at ECM-associated gene promoters, and the TGF- specific antibody reverses SET7/9 occupancy under conditions in RMCs. (A) SET7/9 recruitment at the indicated gene promoters in RMCs stimulated with TGF- ( ng/ml) for various time periods. (B) Inhibition of -induced SET7/9 enrichment at ECM gene promoters by TGF- Ab. Serum-depleted RMCs were pretreated with TGF- specific antibody (Ab) ( g/ml) or mouse IgG ( g/ml) for hour and then treated with normal glucose ( mm) plus mannitol ( mm) () or high glucose ( mm) () for 8 hours. SET7/9 recruitment was determined by ChIP assays with SET7/9 Ab as described in Figure. Results were normalized to input, and SET7/9 occupancy was expressed as fold enrichment over respective control samples (mean SEM; P ; P versus ctrl, n ) (A) or over samples (mean SEM; P versus ; P versus, n ) (B).. +IgG +IgG +TGF-β Ab +IgG +IgG +TGF-β Ab sion. Recent studies showed that methylated histone HK correlates with transcriptionally competent chromatin and is associated with active genes. This supports our observation that TGF- increased the expression of Cola, CTGF, and PAI- in RMCs, and this positively correlated with increased HKme, HKme, and HKme at their promoters. Evidence showed that treatment caused dynamic changes in HKme and HK9me in human monocytes and HKme in endothelial cells, 9 whereas HK9me levels were decreased in VSMCs from diabetic db/db mice relative to control db/ and in -treated VSMCs 9 and endothelial cells. This is in line with our results showing increases in HKme and decreases in HK9me at the Cola, CTGF, and PAI- promoters under conditions in RMCs, which correlated with -induced upregulation of these genes. Furthermore, the TGF- antibody could reverse -induced epigenetic alterations. This study also showed an increase, not only in the recruitment of HK HMT SET7/9 at the Cola, CTGF, and PAI- promoters, but also in the expression of SET7/9 in RMCs stimulated by TGF-, suggesting that this HMT is involved in TGF- induced up-regulation of ECM genes in RMCs. This was supported by our observations that SET7/9 gene silencing partially, but significantly, blocked TGF- induced ECM-as- 8 Journal of the American Society of Nephrology J Am Soc Nephrol :,

9 BASIC RESEARCH A mrna: Fold Over sineg D mrna: sineg SET7/9 control TGF- induced gene expression. Further studies are needed to determine such functional interplay between these two antagonistic histone modifications. It is also well known that tubulointerstitial disease contributes substantially to DN. In the future, it would be interesting to explore analogous approaches that examine epigenetic mechanisms in matrix gene expression in tubular epithelial and/or interstitial cells exposed to TGF-. Evidence showed that HDAC inhibitors attenuate fibrotic changes in tubulointerstitial injury. 9 Epigenetic mechanisms may affect ECM expression by also regulating the expression of metalloproteases and other proteases, because histone acetylation has been shown to regulate metalloproteases in some cells. Taken together, our studies showed that TGF- and can promote significant changes in promoter histone HK and HK9 methylation in MCs that correlate with parallel increases in the expression of genes related to ECM accumulasineg ng sineg ng siset7/9 ng siset7/9 ng siset7/9 ng Cola siset7/9 control TGF-β B... IB:SET7/9 IB:β-actin SET7/9 Protein Levels (Fold Over sineg) sineg CTGF siset7/9 sineg control TGF-β sineg siset7/9 siset7/9 sineg C PAI- siset7/9 HKme Protein Levels (Fold Over Respective sineg) control TGF-β HKme HKme CypA sineg HKme siset7/9 control TGF-β Figure 8. SET7/9 is involved in TGF- induced regulation of ECM-associated genes in RMCs. (A) RMCs were transfected with various concentrations of SET7/9 sirna (siset7/9) or control (sineg) oligonucleotidies. Forty-eight hours after transfection, SET7/9 mrna levels were analyzed by RT-QPCR. Results were normalized to internal control -actin gene, and SET7/9 levels were expressed as fold over sineg ng (mean SEM; P versus sineg ng). (B) SET7/9 protein levels in RMCs transfected with ng of siset7/9 or sineg oligonucleotidies. Total cell lysates were prepared 7 hours after transfection and immunoblotted (IB) with SET7/9 or -actin antibodies. Bar graph below represents the quantification of SET7/9 protein levels determined by densitometry and expressed as fold over sineg (mean SEM; P versus sineg, n ). (C) Global levels of HKme, HKme, and HKme in RMCs transfected with sineg or siset7/9 were determined by immunoblotting with indicated antibodies (mean SEM; P versus sineg, n ). (D) RMCs were transfected with ng of siset7/9 or sineg oligonucleotidies, serum depleted for hours, and stimulated with or without TGF- ( ng/ml) for hours. ECM-associated genes (Cola, CTGF, and PAI-) and CypA mrna expression were analyzed by RT-QPCR and normalized to internal control -actin gene. Results were expressed as fold over sineg (mean SEM; P versus ctrl sineg; P versus sineg TGF-, n ). iologic roles of SET7/9 in gene transactivation. It is possible that, in this study, SET7/9 may also act through methylating other nonhistone proteins and possibly even Smads. Further studies are needed to evaluate these aspects. Evidence showed that TGF- signaling through acetylation of Smad itself can up-regulate gene transcription, and acetylation of histones in the TGF- RII promoter regions can up-regulate its transcription. A few studies in diabetic kidneys have shown the involvement of HDACs in TGF- mediated ECM production and kidney fibrosis. 7,8 These studies suggest a role for HDACs in the pathogenesis of renal fibrosis and TGF- actions by possibly silencing key protective genes. In unpublished observations, we showed that TGF- can also increase levels of the active chromatin histone acetylation mark HK9Ac at the PAI- promoter, and this correlated with increased PAI- expression in MCs, suggesting that a balance between active and repressive marks at the K9 position may J Am Soc Nephrol :, TGF- and Histone Methylation 9

10 Figure 9. Schematic representation of histone H lysine methylation in TGF- mediated fibrotic gene expression in mesangial cells. Diabetic conditions and TGF- induced expression of ECM-associated genes Cola, CTGF, and PAI- in MC result in fibrosis in the pathogenesis of DN through increases in promoter levels of active chromatin marks (HKme, HKme, and HKme) and promoter occupancy or expression of K-HMTs such as SET7/9, and in parallel, through decreases in promoter levels of repressive chromatin marks HK9me and HK9me. Under diabetic () conditions, a TGF- antibody can reverse these chromatin modifications to exert renoprotective effects. tion and the pathogenesis of DN. Because histone lysine methylation has been associated with metabolic memory in other cells, 9,,9 it is possible that these epigenetic changes may also contribute to sustained diabetic renal complications that persist despite glycemic control. CONCISE METHODS Materials Recombinant human TGF- (-B) and pan-specific TGF- antibody (MAB8) were from R&D systems (Minneapolis, MN); normal mouse IgG( 7), normal rabbit IgG (PPB), and protein A agarose/salmon sperm DNA( 7) were from Upstate, (Billerica, MA). The following antibodies were used in the Western blotting analyses and ChIP assays: anti-ctgf (ab99), anti-collagen I (ab8), anti-histone H dimethyl K9 (ab), anti-h trimethyl K9 (ab8898), anti-h monomethyl K (ab889), anti-h dimethyl K (ab), and anti-h trimethyl K (ab88) from Abcam (Cambridge, MA); purified mouse anti-pai- () from BD Biosciences (San Jose, CA); anti- -actin (A) from Sigma (St. Louis, MO); and anti-set7/9(7 ) from Upstate Biotechnology. SET7/9 ON-TARGETplus sirna (J-999[9 ]) was from Thermo Scientific, and Silencer Negative Control sirna (AM) was from Ambion. Nucleofection kits (VPI-) were from Lonza (Allendale, NJ). Actinomycin D () was from Calbiochem (La Jolla, CA). Reverse transcriptase kits and SYBR Green PCR Master Mix kits were from Applied Biosystems (Foster City, CA), and RNA-STAT reagent was from Tel-Test (Friendswood, TX). Primers for -actin internal standards were from Ambion (Austin, TX). All other primers were designed using bioinformatics software and synthesized by IDT (Coralville, IA). Sequences of primers used in this study are listed in Table. Cell Culture All animal studies were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC). Primary cultures of RMCs were obtained by explant culture of renal glomeruli isolated from Sprague-Dawley rats and cultured in RPMI medium as described. RMCs were serum depleted in medium containing.% BSA before stimulation. Cells between and passages were used. Transient Transfections RMCs were plated in -mm culture dishes and transfected the next day (7% confluent) with SET7/9 ON-TARGETplus sirna (siset7/9) or Silencer Negative Control sirna (sineg) using Nucleofection reagent as described. This yielded transfection efficiencies of to %. About hours after transfection, cells were washed, and fresh medium containing % FBS was added. The next day, cells were placed in serum-free RPMI medium containing.% BSA for hours, treated with or without TGF- ( ng/ml), and processed for RNA or protein extraction or ChIP assays at the indicated time periods. Table. Primer sequences Primer Forward Primer Reverse Primer Annealing Temperature cdna primers rcol TGGTGCTCCTGGTATTGCTG cggacgttttccttcttctccg 8 rctgf cagctccgagaagggtcaagctg AACAGGCGCTCCACTCTGTG rpai- cggacttcttcaagctcttccg TGAAATAGAGGGCGTTCACCAG 8 rset7/9 ACAGAAGAAGGGAAGCCACA CGGACTCATAAGGGTCTGGA 8 rcypa TATCTGCACTGCCAAGACTGAGTG CTTCTTGCTGGTCTTGCCATTCC 8 r -actin CTGCCCTGGCTCCTAGCAC cggacgcagctcagtaacagtccg ChIP primers rcol pro GGCTGGAGAAAGGTGGGTCT CCCAGGTATGCAGGGTAGGA 8 rctgfpro ATCAGGAAGGGTGCGAAGAG TCCACATTCCTCCGTCTGAA 8 rcypapro TATCTGCACTGCCAAGACTGAGTG CTTCTTGCTGGTCTTGCCATTCC 8 rpai-pro gacaatatgtgccctgtgattgtc AGGCTGCTCTACTGGTCCTTGC Journal of the American Society of Nephrology J Am Soc Nephrol :,

11 BASIC RESEARCH RNA Isolation and Real-Time QPCR Total RNA was isolated from RMCs using RNA-STAT reagent according to the manufacturer s instructions. Total RNA ( g) was used to synthesize cdna using Moloney murine leukemia virus (MuLV) reverse transcriptase and random hexamers in a final volume of l as described by the manufacturer. QPCRs using SYBR green reagent with gene-specific primers (listed in Table ) and -actin gene primers (internal control) were performed in triplicate in a final volume of l in an ABI 7 real-time PCR thermal cycler (Applied Biosystems). Dissociation curves were run to detect nonspecific amplification, and we confirmed that single products were amplified in each reaction. Relative gene expression levels were calculated after normalization with internal control -actin gene using the Ct method, where Ct is the threshold value. 9 Results were expressed as fold over control. Western Blotting RMCs were lysed in SDS sample buffer, fractionated on to % SDS-PAGE gels (Bio-Rad, Hercules, CA), and immunoblotted with antibodies to PAI- (:,), CTGF (:), collagen I (:), and SET7/9 (:) as reported earlier. The blots were stripped and reprobed with an antibody to -actin (:,). Immunoblots were developed using a chemiluminescence method and scanned with a GS-8 densitometer to determine the intensity of protein bands with Quantity One software (Bio-Rad). ChIP Assays ChIPs were performed, and ChIP-enriched DNA was analyzed by real-time QPCR as described earlier. 9 Briefly, cells were fixed with % formaldehyde at 7 C for minutes, washed with cold PBS containing protease inhibitors, and lysed in Tris, ph 8., containing % SDS, mm PMSF, and complete protease inhibitor cocktail. Cell lysates were sonicated to fragment chromatin to -bp size, diluted in ChIP dilution buffer, and immunoprecipitated overnight at C with indicated specific antibodies, with IgG control, or without antibody (no antibody control). Next day, immune complexes were collected on protein-a agarose beads, and the beads were washed to remove nonspecific binding. DNA was eluted from the beads, crosslinks were reversed, and DNA was extracted. ChIP-enriched DNA samples and input DNA samples were analyzed by QPCR with SYBR reagent in a real-time PCR machine (ABI 7; Applied Biosystems) using primers specific for Cola, CTGF, or PAI- promoters spanning Smad binding elements or the control cyclophilin A promoter. All reactions were performed in triplicate in a final volume of l. Dissociation curves were run to detect nonspecific amplification, and we confirmed that single products were amplified in each reaction. QPCR data were analyzed using the Ct method as described earlier 9 and normalized with input samples. Results were expressed as fold over control. In all of the experiments, we verified that ChIP samples obtained with specific antibodies exhibited significant enrichment relative to IgG or no antibody controls. Statistical Analysis Data are expressed as mean SEM of multiple experiments. Paired t tests were used to compare two groups or ANOVA with Dunnet post tests for multiple groups, using PRISM software (GraphPad, San Diego, CA). Statistical significance was determined at the level. ACKNOWLEDGMENTS We thank Lingxiao Zhang and Jehyun Park for all their help and those who generously provided reagents. This work was supported by National Institutes of Health NIDDK Grants R DK 89 and R DK87 to R.N. DISCLOSURES None. REFERENCES. Shi Y, Massague J: Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell : 8 7,. Bottinger EP, Bitzer M: TGF-{beta} signaling in renal disease. JAmSoc Nephrol :,. Reeves WB, Andreoli TE: Transforming growth factor beta contributes to progressive diabetic nephropathy. Proc Natl Acad Sci USA 97: 77 79,. Ziyadeh FN, Sharma K: Overview: combating diabetic nephropathy. J Am Soc Nephrol : 7,. Brosius FC III: New insights into the mechanisms of fibrosis and sclerosis in diabetic nephropathy. Rev Endocr Metab Disord 9:, 8. Ziyadeh FN, Sharma K, Ericksen M, Wolf G: Stimulation of collagen gene expression and protein synthesis in murine mesangial cells by high glucose is mediated by autocrine activation of transforming growth factor-beta. J Clin Invest 9:, Ziyadeh FN, Han DC, Cohen JA, Guo J, Cohen MP: Glycated albumin stimulates fibronectin gene expression in glomerular mesangial cells: Involvement of the transforming growth factor-beta system. Kidney Int : 8, Yang CW, Vlassara H, Peten EP, He CJ, Striker GE, Striker LJ: Advanced glycation end products up-regulate gene expression found in diabetic glomerular disease. Proc Natl Acad Sci USA 9: 9 9, Wolf G, Ziyadeh FN: The role of angiotensin II in diabetic nephropathy: Emphasis on nonhemodynamic mechanisms. Am J Kidney Dis 9:, 997. Sakharova OV, Taal MW, Brenner BM: Pathogenesis of diabetic nephropathy: Focus on transforming growth factor-beta and connective tissue growth factor. Curr Opin Nephrol Hypertens : 77 78,. Guha M, Xu ZG, Tung D, Lanting L, Natarajan R: Specific downregulation of connective tissue growth factor attenuates progression of nephropathy in mouse models of type and type diabetes. Faseb J : 8, 7. Baricos WH, Reed JC, Cortez SL: Extracellular matrix degradation by cultured mesangial cells: Mediators and modulators. Exp Biol Med (Maywood) 8: 8,. Chen S, Carmen Iglesias-de la Cruz M, Jim B, Hong SW, Isono M, Ziyadeh FN: Reversibility of established diabetic glomerulopathy by anti-tgf-[beta] antibodies in db/db mice. Biochem Biophys Res Commun :,. Ziyadeh FN, Hoffman BB, Han DC, Iglesias-De La Cruz MC, Hong SW, Isono M, Chen S, McGowan TA, Sharma K: Long-term prevention of J Am Soc Nephrol :, TGF- and Histone Methylation

12 renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal antitransforming growth factor-beta antibody in db/db diabetic mice. Proc Natl Acad Sci USA 97: 8 8,. Sharma K, Jin Y, Guo J, Ziyadeh FN: Neutralization of TGF-beta by anti-tgf-beta antibody attenuates kidney hypertrophy and the enhanced extracellular matrix gene expression in STZ-induced diabetic mice. Diabetes :, 99. Leehey DJ, Singh AK, Alavi N, Singh R: Role of angiotensin II in diabetic nephropathy. Kidney Int Suppl 77: S9 S98, 7. Hua X, Liu X, Ansari DO, Lodish HF: Synergistic cooperation of TFE and smad proteins in TGF-beta-induced transcription of the plasminogen activator inhibitor- gene. Genes Dev : 8 9, Kato M, Zhang J, Wang M, Lanting L, Yuan H, Rossi JJ, Natarajan R: MicroRNA-9 in diabetic kidney glomeruli and its function in TGFbeta-induced collagen expression via inhibition of E-box repressors. Proc Natl Acad Sci USA : 7, 7 9. Kato M, Putta S, Wang M, Yuan H, Lanting L, Nair I, Gunn A, Nakagawa Y, Shimano H, Todorov I, Rossi JJ, Natarajan R: TGF-beta activates Akt kinase through a microrna-dependent amplifying circuit targeting PTEN. Nat Cell Biol : , 9. Schnaper HW, Hayashida T, Hubchak SC, Poncelet AC: TGF-beta signal transduction and mesangial cell fibrogenesis. Am J Physiol Renal Physiol, 8: F F,. Berger SL: Histone modifications in transcriptional regulation. Curr Opin Genet Dev : 8,. Shilatifard A: Chromatin modifications by methylation and ubiquitination: Implications in the regulation of gene expression. Annu Rev Biochem 7: 9,. Jenuwein T, Allis CD: Translating the histone code. Science 9: 7 8,. Martin C, Zhang Y: The diverse functions of histone lysine methylation. Nat Rev Mol Cell Biol : 88 89,. Ruthenburg AJ, Allis CD, Wysocka J: Methylation of lysine on histone H: Intricacy of writing and reading a single epigenetic mark. Mol Cell :, 7. Hampsey M, Reinberg D: Tails of intrigue: Phosphorylation of RNA polymerase II mediates histone methylation. Cell : 9, 7. Shi Y, Whetstine JR: Dynamic regulation of histone lysine methylation by demethylases. Mol Cell :, 7 8. Li Y, Reddy MA, Miao F, Shanmugam N, Yee, J-K, Hawkins D, Ren B, Natarajan R: Role of the histone H lysine methyltransferase, SET7/9, in the regulation of NF-{kappa}B-dependent inflammatory genes: Relevance to diabetes and inflammation. J Biol Chem 8: 77 78, 8 9. El-Osta A, Brasacchio D, Yao D, Pocai A, Jones PL, Roeder RG, Cooper ME, Brownlee M: Transient high glucose causes persistent epigenetic changes and altered gene expression during subsequent normoglycemia. J Exp Med : 9 7, 8. Brasacchio D, Okabe J, Tikellis C, Balcerczyk A, George P, Baker EK, Calkin AC, Brownlee M, Cooper ME, El-Osta A: Hyperglycemia induces a dynamic cooperativity of histone methylase and demethylase enzymes associated with gene-activating epigenetic marks that coexist on the lysine tail. Diabetes 8: 9, 9. Chakrabarti SK, Francis J, Ziesmann SM, Garmey JC, Mirmira RG: Covalent histone modifications underlie the developmental regulation of insulin gene transcription in pancreatic beta cells. J Biol Chem 78: 7,. Ivanov GS, Ivanova T, Kurash J, Ivanov A, Chuikov S, Gizatullin F, Herrera-Medina EM, Rauscher F III, Reinberg D, Barlev NA: Methylation-acetylation interplay activates p in response to DNA damage. Mol Cell Biol 7: 7 79, 7. Chuikov S, Kurash JK, Wilson JR, Xiao B, Justin N, Ivanov GS, McKinney K, Tempst P, Prives C, Gamblin SJ, Barlev NA, Reinberg D: Regulation of p activity through lysine methylation. Nature :,. Kouskouti A, Scheer E, Staub A, Tora L, Talianidis I: Gene-specific modulation of TAF function by SET9-mediated methylation. Mol Cell : 7 8,. Ea CK, Baltimore D: Regulation of NF-kappaB activity through lysine monomethylation of p. Proc Natl Acad Sci USA : , 9. Yang XD, Huang B, Li M, Lamb A, Kelleher NL, Chen LF: Negative regulation of NF-kappaB action by Set9-mediated lysine methylation of the RelA subunit. Embo J 8:, 9 7. Lachner M, O Carroll D, Rea S, Mechtler K, Jenuwein T: Methylation of histone H lysine 9 creates a binding site for HP proteins. Nature :, 8. El Gazzar M, Yoza BK, Chen X, Hu J, Hawkins GA, McCall CE: G9a and HP couple histone and DNA methylation to TNFalpha transcription silencing during endotoxin tolerance. J Biol Chem 8: 98 8, 8 9. Villeneuve LM, Reddy MA, Lanting LL, Wang M, Meng L, Natarajan R: Epigenetic histone H lysine 9 methylation in metabolic memory and inflammatory phenotype of vascular smooth muscle cells in diabetes. Proc Natl Acad Sci USA : 97 9, 8. Miao F, Wu X, Zhang L, Yuan YC, Riggs AD, Natarajan R: Genomewide analysis of histone lysine methylation variations caused by diabetic conditions in human monocytes. J Biol Chem 8: 8 8, 7. Wang H, Cao R, Xia L, Erdjument-Bromage H, Borchers C, Tempst P, Zhang Y: Purification and functional characterization of a histone H- lysine -specific methyltransferase. Mol Cell 8: 7 7,. Nishioka K, Chuikov S, Sarma K, Erdjument-Bromage H, Allis CD, Tempst P, Reinberg D: Set9, a novel histone H methyltransferase that facilitates transcription by precluding histone tail modifications required for heterochromatin formation. Genes Dev : 79 89,. Berger SL: The complex language of chromatin regulation during transcription. Nature 7: 7, 7. Esteve PO, Chin, Benner J, Feehery GR, Samaranayake M, Horwitz GA, Jacobsen SE, Pradhan S: Regulation of DNMT stability through SET7-mediated lysine methylation in mammalian cells. Proc Natl Acad Sci USA : 7 8, 9. Inoue Y, Itoh Y, Abe K, Okamoto T, Daitoku H, Fukamizu A, Onozaki K, Hayashi H: Smad is acetylated by p/cbp to regulate its transactivation activity. Oncogene : 8, 7. Park SH, Lee SR, Kim BC, Cho EA, Patel SP, Kang HB, Sausville EA, Nakanishi O, Trepel JB, Lee BI, Kim SJ: Transcriptional regulation of the transforming growth factor beta type II receptor gene by histone acetyltransferase and deacetylase is mediated by NF-Y in human breast cancer cells. J Biol Chem 77: 8 7, 7. Noh H, Oh EY, Seo JY, Yu MR, Kim YO, Ha H, Lee HB: Histone deacetylase- is a key regulator of diabetes- and transforming growth factor-beta-induced renal injury. Am J Physiol Renal Physiol 97: F79 F79, 9 8. Yoshikawa M, Hishikawa K, Marumo T, Fujita T: Inhibition of histone deacetylase activity suppresses epithelial-to-mesenchymal transition induced by TGF-beta in human renal epithelial cells. J Am Soc Nephrol 8: 8, 7 9. Marumo T, Hishikawa K, Yoshikawa M, Hirahashi J, Kawachi S, Fujita, T: Histone deacetylase modulates the proinflammatory and -fibrotic changes in tubulointerstitial injury. Am J Physiol Renal Physiol 98: F F,. Pons D, de Vries FR, van den Elsen PJ, Heijmans BT, Quax PH, Jukema JW: Epigenetic histone acetylation modifiers in vascular remodelling: New targets for therapy in cardiovascular disease. Eur Heart J : 77, 9. Xu ZG, Li SL, Lanting L, Kim YS, Shanmugam N, Reddy MA, Natarajan R: Relationship between /-lipoxygenase and COX- in mesangial cells: Potential role in diabetic nephropathy. Kidney Int 9: 9,. Reddy MA, Li SL, Sahar S, Kim YS, Xu ZG, Lanting L, Natarajan R: Key role of Src kinase in SB-induced activation of the receptor for advanced glycation end products in vascular smooth muscle cells. J Biol Chem 8: 8 9, Journal of the American Society of Nephrology J Am Soc Nephrol :,