Developmental Pathways and Transcriptional Networks in Prostate Cancer Progression

Size: px
Start display at page:

Download "Developmental Pathways and Transcriptional Networks in Prostate Cancer Progression"

Transcription

1 Developmental Pathways and Transcriptional Networks in Prostate Cancer Progression ASIP Cotran Established Investigator Award Lecture April 21, 2009 Carlos S. Moreno, Ph.D. Department of Pathology and Laboratory Medicine Emory University

2 Prostate Cancer Over 218,000 new cases and 27,000 deaths in US (2007) Second leading cause of cancer deaths in American men Gold Standard Pathology Gleason Score Gleason 6 Gleason 7 Gleason 8+ Excellent prognosis Prognosis uncertain Poor prognosis

3 Prostate Cancer Expression Profiling Identify Genes Correlated with Gleason Score Identify Genes Predictive of Outcome Identify Novel Therapeutic Targets

4 Expression Pattern of 143 Probe Sets Significantly Altered in Tumor vs. Normal Liu et al, Cancer Res 46:

5 Upstream Signals CONFAC Analysis Software Tx Factors Up/Down Gene Clusters Downstream Events Cellular Consequences Genetic Pathways GO Ontologies

6 CONFAC Analysis of Genes Increased in Prostate Cancer Identified Enrichment of Homeobox Sites Karanam and Moreno, NAR, 32:W475 W475 84, 2004.

7 HOXC6 gene was the most highly correlated with Gleason Score Spearman's Rho P Value Corrected p value E Ramachandran et al, Oncogene, 24(1):188, 2005.

8 HOXC6 sirna Transfection Decreases Viability of LNCaP and C4 2 2 Cells Ramachandran et al, Oncogene, 24(1):188, 2005.

9 HOXC6 Represses IGFBP3 Expression Ramachandran et al, Oncogene, 24(1):188, 2005.

10 Are these HOXC6 targets Direct or Indirect?

11 ChIP chip assay Global Analysis of TF Binding Requires a Highly Specific Antibody Buck and Leib, Genomics. 83(3):

12 Stable HOXC6 HA HA LNCaP Cell Lines McCabe et al, Cancer Research, 68(6): , 96, 2008.

13 NimbleGen 25K Promoter Array Set Queries 25,000 Promoters 4kb upstream 1kb downstream of TSS 50mer probes tiled every 150 bp

14 HOXC6 HA HA ChIP chip 468 Promoters Reproducibly Enriched in HOXC6 HA HA LNCaP cells over input chromatin (p( < 1.0E 3), But NOT in YFP LNCaP cells HOXC6 direct targets: BMP7 PDGFRA CARD8 PSEN1

15 ChIP chip Validation McCabe et al, Cancer Research, 68(6): , 96, 2008.

16 ChIP QPCR Validation McCabe et al, Cancer Research, 68(6): , 96, 2008.

17 HOXC6 Activates Expression of Luciferase Reporters McCabe et al, Cancer Research, 68(6): , 96, 2008.

18 What about HOXC6 Function in vivo? Hoxc6 / mice Demetri Spyropoulos, MUSC Whole Genome Expression Profiling Hoxc6 / prostates vs wild type prostates

19 HOXC6 Activates Expression of PDGFRα, FGFR2, DKK3, and WIF1 in mouse prostates McCabe et al, Cancer Research, 68(6): , 96, 2008.

20 WIF 1, DKK, and SFRP block Wnt Signaling Journal of Cell Science 116, , 2003.

21 HOXC6 Represses Expression of BMP7 in mouse prostates McCabe et al, Cancer Research, 68(6): , 96, 2008.

22 BMP7 Blocks Notch Signals and Prostate Cancer Metastasis Buijs et al, AJP 171(3):1047, 2007

23 Model of HOXC6 Network in Prostate Cancer McCabe et al, Cancer Research, 68(6): , 96, 2008.

24 Can Recombinant BMP7 Block the effects of HOXC6 overexpression? BMP7 inhibits pro proliferative proliferative and anti apoptotic apoptotic effects of HOXC6 overexpression McCabe et al, Cancer Research, 68(6): , 96, 2008.

25 Does inhibition of PDGFRα block pro proliferative proliferative effects of HOXC6 overexpression? McCabe et al, Cancer Research, 68(6): , 96, 2008.

26 HOXC6 activates Wnt Repressor Genes How Are WIF1, SFRP1, SFRP2, DKK3 Downregulated in Aggressive Cancers when HOXC6 is Overexpressed?

27 WIF1, DKK3, SFRP1, and SFRP2 Promoters are Hypermethylated in Prostate Cancers and Lung Metastases

28 Model of HOXC6 and Wnt Pathway

29 How can we better model HOX6 overexpression in vivo? Doxycycline inducible HOXC6 transgenic expression system Cross Probasin2 rtta x HOXC6 GFP 8 week old Pb2 rtta GFP male (4 weeks of Dox; 1 mg/ml) B, bladder; U, urethra; SV, seminal vessicle; lobes of the prostate: anterior (AL), dorsal (DL), lateral (LL), ventral (VL).

30 SOX4 SOX4 mrna is Strongly Correlated with Gleason Score Liu et al, Cancer Res 46:

31 SOX4 Protein is Strongly Correlated with Gleason Score Liu et al, Cancer Res 46:

32 SOX4 sirna Decreases Viability and Induces Apoptosis in LNCaP Cells Liu et al, Cancer Res 46:

33 What is SOX4? Highly conserved, single exon transcription factor Homology to TCF/LEF Family High Mobility Group (HMG) Binds AT rich sequences Induces extreme DNA bending Required for development of Heart, Pancreas, B cells, CNS, Bone DNA binding domain Prostate??? Overexpressed in many cancers (Prostate, Breast, Colon, Lung, Leukemia, Lymphoma, Medulloblastoma, Glioblastoma). Little functional molecular information exists

34 Effects of SOX4 Perturbation on Global Gene Expression Liu et al, Cancer Res 46:

35 The Wnt Pathway TLE1

36 SOX4 stably binds to β catenin in a Wnt3A dependent manner

37 SOX4 cooperates with β catenin to activate TOP FLASH Luciferase Reporters Scharer et al, Cancer Research, 69(2): , 2009.

38 SOX4 Direct Target Genes Play Roles in Survival, Apoptosis, and Wnt Signaling Scharer et al, Cancer Research, 69(2): , 2009.

39 SOX4 ChIP chip Analysis Create an HA tagged SOX4 cell lines LNCaP RWPE 1 Confirm SOX4 expression and presence at known target Scharer et al, Cancer Research, 69(2): , 2009.

40 SOX4 Transcriptional Targets 282 High Confidence Direct Targets Scharer et al, Cancer Research, 69(2): , 2009.

41 SOX4 ChIP chip Assay Validation 24/28 (86%) of candidate SOX4 targets were confirmed Scharer et al, Cancer Research, 69(2): , 2009.

42 SOX4 ChIP chip Target gene expression levels Are changed by QRT PCR Scharer et al, Cancer Research, 69(2): , 2009.

43 SOX4 ChIP chip Target gene expression levels Are changed by QRT PCR Scharer et al, Cancer Research, 69(2): , 2009.

44 The MicroRNA Pathway Jinek and Doudna, Nature, 457(7228):405, 2009 Robb and Rana, Molecular Cell, 26(4):523, 2007.

45 SOX4 Regulates Dicer expression Scharer et al, Cancer Research, 69(2): , 2009.

46 SOX4 Transcriptional Network Scharer et al, Cancer Research, 69(2): , 2009.

47 The Notch Pathway SOX4 and HOXC6 both Feed into the Notch Pathway Radtke, F., and K. Raj Nat Rev Cancer 3:

48 SOX4 and HOXC6 both Induce Notch 1 Cleavage

49 Dominant Negative SOX4 inhibits Wnt3a Induction of DLL1

50 SOX4 and HOXC6 Feed Into The PI3K AKT Pathway

51

52 SOX4 is important for metastasis SOX4 partial shrna knockdown reduces transwell invasion and lung metastases in MDA MB 231 Breast Cancer Cells

53 Prostate Cancer Biomarkers of Recurrence Long term Follow up data required Largest and best annotated samples are from Formalin Fixed Fixed Paraffin Embedded (FFPE) Tissues Standard Microarrays Cannot Use RNA Prepared from FFPE tissues Illumina DASL Assay Enables RNA profiling of FFPE samples

54 DASL assay (cdna NA mediated Annealing, Selection, extension and Ligation) Total RNA isolated from FFPE tissue b cdna synthesis P1 P2 Address b P3 Query oligo annealing, extension, and ligation P1 P2 P3 PCR with common primers Address /WV /WV Product capture by hybridization to array Yeakley et al. Nature Biotechnology. (2002) Fan et al. Genome Research. (2004)

55 Illumina DASL Assay Enables RNA profiling of FFPE samples Designed our own Custom DASL Prostate Cancer Gene Panel 1536 probes querying 522 genes Illumina human mirna v2 DASL panel Queries 1,146 human small RNAs (> 97% coverage of mirbase release 12) Profiled 85 radical prostatectomies 71 with long term (4 10 year) follow up 46 with Gleason Score 7

56 Clustering of Samples using Predictive Biomarkers

57 Combined Biomarker Panels (14 genes, all cases)

58 What regulates the changes in mirna levels?

59 Does SOX4 Directly Regulate mirnas associated with PCa recurrence?

60 SAM mirna Survival Analysis Top 6 mirnas from Cox Regression Analysis Recurrence vs. Non Recurrence Symbol Predicted Target Genes Score mir 103 BTG2, 3.51 mir 339 BCL mir 183 BTG mir 182 ITPR mir 221 FOS 3.02 mir 136 HOXC

61 BTG 2 Staining is Reduced in PCa

62 SOX4 is required for p53 activation in response to DNA damage SOX4 regulates p53 protein stability and activity SOX4 stabilizes p53 by blocking MDM2 ubiquitination of p53 SOX4 regulates cell cycle arrest, apoptosis, and tumorigenesis in a p53 dependent manner

63 SOX4 Directly Regulates PUMA Liu et al, Cancer Res 46:

64 Model of SOX4 mirna BTG Pathway

65 Summary SOX4 and HOXC6 Regulate Growth Factor Receptors SOX4 and HOXC6 Regulate Components of the Wnt Pathway SOX4 and HOXC6 Regulate Components of the Notch Pathway SOX4 and HOXC6 Regulate Components of the mirna Pathway

66 Acknowledgements Moreno Lab Dr. Colleen McCabe Noelani Anderson Christopher Scharer Yu Heng Lai Dr. Mohamed Ali Seyed Suresh Karanam Dr. Pengbo Liu Dr. Sumathi Ramachandran Holly Williams MUSC Demetri Spyropoulos University of Toronto Dr. Arun Seth Dr. Robert Nam Funding: NIH R01 CA Georgia Research Alliance Winship Cancer Institute Dept. Pathology & Lab Medicine Emory University / Winship Cancer Institute Dr. Brian Leyland Jones Dr. Wei Zhou Dr. John Petros Dr. Adeboye O Osunkoya Dr. Brent Johnson Daron Williams Dr. W. David Martin Dr. Andrew Young Dr. Fray Marshall Dr. David Jaye Dr. Milton Datta Emory Biomarker Service Center Dr. Mark Bouzyk Dr. Maja Ordanic Kodani Benjamin Barwick Nicholas Wagar Mingjing Xia

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

TITLE: Identification of the Transformational Properties and Transcriptional Targets of the Oncogenic SRY Transcription Factor SOX4

TITLE: Identification of the Transformational Properties and Transcriptional Targets of the Oncogenic SRY Transcription Factor SOX4 AD (Leave blank) Award Number: W81XWH-07-1-0044 TITLE: Identification of the Transformational Properties and Transcriptional Targets of the Oncogenic SRY Transcription Factor SOX4 PRINCIPAL INVESTIGATOR:

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA

More information

Upcoming Webinars. Profiling genes by pathways and diseases. Sample & Assay Technologies -1-

Upcoming Webinars. Profiling genes by pathways and diseases. Sample & Assay Technologies -1- Upcoming Webinars -1- Keep up to date: Follow Pathway focused biology on Facebook www.facebook.com/pathwaycentral Latest information on, pathway focused research and demos. -2- Understanding Gene Expression

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer

TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer AD Award Number: W81XWH-6-1-64 TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Sunshine Daddario, B.A. CONTRACTING ORGANIZATION: University of Colorado Health

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE

More information

Genome-Wide Promoter Analysis of the SOX4 Transcriptional Network in Prostate Cancer Cells

Genome-Wide Promoter Analysis of the SOX4 Transcriptional Network in Prostate Cancer Cells Genome-Wide Promoter Analysis of the SOX4 Transcriptional Network in Prostate Cancer Cells Christopher D. Scharer, 1,2 Colleen D. McCabe, 2 Mohamed Ali-Seyed, 2 Michael F. Berger, 4,7 Martha L. Bulyk,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,

More information

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence. Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression

More information

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

More information

Personalized Therapy for Prostate Cancer due to Genetic Testings

Personalized Therapy for Prostate Cancer due to Genetic Testings Personalized Therapy for Prostate Cancer due to Genetic Testings Stephen J. Freedland, MD Professor of Urology Director, Center for Integrated Research on Cancer and Lifestyle Cedars-Sinai Medical Center

More information

MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site

MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site POLICY: PG0364 ORIGINAL EFFECTIVE: 04/22/16 LAST REVIEW: 07/26/18 MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site GUIDELINES This policy does not certify benefits or authorization

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Generating Mouse Models of Pancreatic Cancer

Generating Mouse Models of Pancreatic Cancer Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives

More information

TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer

TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer AD Award Number: W81XWH-07-1-0155 TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING ORGANIZATION: Vanderbilt

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/Beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University

More information

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

BIOL2005 WORKSHEET 2008

BIOL2005 WORKSHEET 2008 BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your

More information

NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez

NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION Ana M. Martinez Switching from Repression to Activation: MicroRNAs can Up-Regulate Translation. Shoba Vasudevan, Yingchun Tong, Joan A. Steitz AU-rich

More information

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1

Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1 Supplementary Tale S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort TCGA Case ID Gene-1 Gene-2 Chr. # of Gene 1 Chr. # of Gene 2 Genomic coordiante of Gene 1 at fusion junction Genomic

More information

CHAPTER 6 SUMMARIZING DISCUSSION

CHAPTER 6 SUMMARIZING DISCUSSION CHAPTER 6 SUMMARIZING DISCUSSION More than 20 years ago the founding member of the Wnt gene family, Wnt-1/Int1, was discovered as a proto-oncogene activated in mammary gland tumors by the mouse mammary

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

s u p p l e m e n ta ry i n f o r m at i o n

s u p p l e m e n ta ry i n f o r m at i o n Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)

More information

Gene expression profiling predicts clinical outcome of prostate cancer. Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M.

Gene expression profiling predicts clinical outcome of prostate cancer. Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M. SUPPLEMENTARY DATA Gene expression profiling predicts clinical outcome of prostate cancer Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M. Hoffman, William L. Gerald Table of Contents

More information

RNA preparation from extracted paraffin cores:

RNA preparation from extracted paraffin cores: Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization

More information

FGL2 A new biomarker for cancer in a simple blood test

FGL2 A new biomarker for cancer in a simple blood test FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member

More information

Summary and Concluding Remarks

Summary and Concluding Remarks Summary and Concluding Remarks Chapter 6 The intestinal epithelium provides an excellent model system for investigating molecular mechanisms regulating cell lineage establishment, stem cell proliferation,

More information

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-07-1-0 TITLE: PRINCIPAL INVESTIGATOR: CONTRACTING ORGANIZATION: REPORT DATE: TYPE OF REPORT: PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

More information

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of

Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of 1,000 most differentially expressed genes with NKX2-1 amplification in lung adenocarcinoma cell lines and anti-correlated

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Introduction to Systems Biology of Cancer Lecture 2

Introduction to Systems Biology of Cancer Lecture 2 Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology

More information

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,

More information

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters

Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Supplementary Data: Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Tiffany Hung 1,2, Yulei Wang 3, Michael F. Lin 4,5, Ashley K. Koegel 1,2, Yojiro Kotake 6-8, Gavin

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,

More information

Identification of mirna expression profiles for diagnosis and prognosis of prostate cancer

Identification of mirna expression profiles for diagnosis and prognosis of prostate cancer Identification of mirna expression profiles for diagnosis and prognosis of prostate cancer To my grandfather Curt "Cula" Carlsson "Research is to see what everybody else has seen, and to think what nobody

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate

Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).

More information

Milk micro-rna information and lactation

Milk micro-rna information and lactation Christophe Lefèvre, BioDeakin,. Deakin University, Geelong VIC Australia Milk micro-rna information and lactation New Signals in milk? - Markers of milk and lactation status? - Signal infant development?

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

Supplemental Material for:

Supplemental Material for: Supplemental Material for: Transcriptional silencing of γ-globin by BCL11A involves long-range interactions and cooperation with SOX6 Jian Xu, Vijay G. Sankaran, Min Ni, Tobias F. Menne, Rishi V. Puram,

More information

From reference genes to global mean normalization

From reference genes to global mean normalization From reference genes to global mean normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle qpcr Symposium USA November 9, 2009 Millbrae, CA outline what is normalization

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

C H A R A C T E R I Z A T I O N O F T H E N O V E L D O M A I N W I T H N O N A M E G E N E I N C O L O N C A N C E R

C H A R A C T E R I Z A T I O N O F T H E N O V E L D O M A I N W I T H N O N A M E G E N E I N C O L O N C A N C E R C H A R A C T E R I Z A T I O N O F T H E N O V E L D O M A I N W I T H N O N A M E G E N E I N C O L O N C A N C E R Charleen Rupnarain A dissertation submitted to the Faculty of Science, University of

More information

Post-transcriptional regulation of an intronic microrna

Post-transcriptional regulation of an intronic microrna Post-transcriptional regulation of an intronic microrna Carl Novina Dana-Farber Cancer Institute Harvard Medical School Broad Institute of Harvard and MIT Qiagen Webinar 05-17-11 Outline 1. The biology

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-1-1-176 TITLE: Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer PRINCIPAL INVESTIGATOR: Hsieh, Jer-Tsong CONTRACTING ORGANIZATION: University of Texas Southwestern

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between

More information

P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,

P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Molecular Heterogeneity of High Gleason Prostate Cancer

Molecular Heterogeneity of High Gleason Prostate Cancer Molecular Heterogeneity of High Gleason Prostate Cancer Aliccia Bollig-Fischer, PhD Assistant Professor Department of Oncology Karmanos Cancer Institute Wayne State University Detroit, Michigan, USA Disclosure

More information

Supplementary Information

Supplementary Information Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina

More information

Micro RNA Research. Ken Kosik. Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr.

Micro RNA Research. Ken Kosik. Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr. Ken Kosik Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr. Program Co-Director, Neurosciences Research Institute Micro RNA Research Neuroscience

More information

Profiles of gene expression & diagnosis/prognosis of cancer Lorena Roa de la Cruz

Profiles of gene expression & diagnosis/prognosis of cancer Lorena Roa de la Cruz Genomics Profiles of gene expression & diagnosis/prognosis of cancer Lorena Roa de la Cruz Gene expression profiling Measurement of the activity of thousands of genes at once Techniques used for gene expression

More information

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TMA-VARESE COHORT-1 TMA-BERN COHORT-2 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA

More information

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information