Metformin Prevents Alcohol-Induced Liver Injury in the Mouse: Critical Role of Plasminogen Activator Inhibitor-1
|
|
- Herbert Palmer
- 5 years ago
- Views:
Transcription
1 GASTROENTEROLOGY 26;13: Metformin Prevents AlcoholInduced Liver Injury in the Mouse: Criticl Role of Plsminogen Activtor Inhibitor1 INA BERGHEIM,* LUPING GUO,* MOLLY ANNE DAVIS,* JASON C. LAMBERT,* JULIANE I. BEIER,* ILINCA DUVEAU,* JAMES P. LUYENDYK, ROBERT A. ROTH, nd GAVIN E. ARTEEL* *Deprtment of Phrmcology nd Toxicology nd the Jmes Grhm BrownCncer Center, University of Louisville Helth Sciences Center, Louisville, Kentucky; nd Deprtment of Phrmcology nd Toxicology, Ntionl Food Sfety nd Toxicology Center, Center for Integrtive Toxicology, Michign Stte University, Est Lnsing, Michign See editoril on pge Bckground & Aims: The bigunide drug metformin hs recently been found to improve stetosis nd liver dmge in niml models nd in humns with nonlcoholic stetoheptitis. Methods: The im of the present study ws to determine whether metformin lso prevents stetosis nd liver dmge in mouse models of cute nd chronic lcohol exposure. Results: Acute ethnol exposure cused >2fold increse in heptic lipids, peking 12 hours fter dministrtion. Metformin tretment significntly blunted the ethnol effect by >6%. Although metformin is known inducer of AMP kinse (AMPK) ctivity, the heptoprotective property of metformin did not correlte with ctivtion of AMPK or of AMPKdependent pthwys. Insted, the protective effects of metformin correlted with complete prevention of the upregultion of plsminogen ctivtor inhibitor (PAI)1 cused by ethnol. Indeed, similr protective effect ginst cute lcoholinduced lipid ccumultion ws observed in PAI1 / mice. Heptic ft ccumultion cused by chronic enterl ethnol feeding ws lso prevented by metformin or by knocking out PAI1. Under these conditions, necroinflmmtory chnges cused by ethnol were lso significntly ttenuted. Conclusions: Tken together, these findings suggest novel mechnism of ction for metformin nd identify new role of PAI1 in heptic injury cused by ethnol. Alcoholic liver disese (ALD) rnks mong the mjor cuses of morbidity nd mortlity in the world. 1 Ft ccumultion in the liver is 1 of the first chrcteristics of the onset of ALD. 2 Originlly thought to be pthologiclly inert histologic chnge, more recent work indictes tht stetosis my ply criticl role not only in the initition, but lso in the progression of ALD. 3 Indeed, results of clinicl studies indicte tht ptients with ftty liver re more vulnerble to developing lter stges of the disese (eg, fibrosis nd cirrhosis 4 ). Becuse of n incomplete understnding of the mechnism(s) involved in the disese process, universlly ccepted therpy to prevent or reverse ALD in humns is lcking. Therefore, better understnding of the biochemicl nd pthologic chnges tht cuse lcoholinduced ftty liver my led to therpies tht not only prevent stetosis, but my lso hve therpeutic effects on lter stges of ALD. Stetosis resulting from lcohol hs historiclly been considered the direct result of lcohol metbolism on oxidtion of ftty cids. However, other fctors my lso contribute. For exmple, number of drugs nd geneticlly ltered mice hve decresed stetotic response to lcohol without ny pprent effect on lcohol metbolism (see Arteel 5 for review). There is strong ssocition between heptic insulin resistnce nd ftty liver s well s stetoheptitis in humns. 6,7 In support of this hypothesis, the results of severl niml nd humn studies suggested tht the insulinsensitizing bigunide, metformin, confers protection in nonlcoholic ftty liver disese (NAFLD) nd nonlcoholic stetoheptitits (NASH). 8 1 The nturl history of NAFLD displys similr fetures to tht of ALD. Indeed, studies indicte tht ftty liver disese, be it lcoholic or nonlcoholic, my shre similr mechnisms nd pthologic fetures. 11,12 Given the protective effect of metformin in NAFLD nd NASH, it hs been suggested tht metformin my lso be effective in the tretment of ALD. Abbrevitions used in this pper: ACC, cetyl CoA crboxylse; ALD, lcoholic liver disese; AMPK, AMP kinse; CPT, crnitine plmitoyltrnsferse; HGF, heptic growth fctor; MTTP, microsoml triglyceride trnsfer protein; NAFLD, nonlcoholic ftty liver disese; NASH, nonlcoholic stetoheptitis; PAI1, plsminogen ctivtor inhibitor 1; SREBP1, sterol regultor element binding protein 1; TNF, tumor necrosis fctor lph; TNFR1, tumor necrosis fctor lph receptor 1; upa, urokinsetype plsminogen ctivtor; VLDL, very lowdensity lipoprotein. 26 by the Americn Gstroenterologicl Assocition Institute 16585/6/$32. doi:1.153/j.gstro
2 21 BERGHEIM ET AL GASTROENTEROLOGY Vol. 13, No. 7 Although the mechnism(s) by which metformin confers protection in ftty liver diseses is uncler, it hs been proposed tht downregultion of tumor necrosis fctor (TNF) medited signling 9 s well s n ctivtion of AMPkinse (AMPK) nd AMPKdependent pthwys my medite this effect; specificlly, the enhncement of oxidtion of ftty cids cused by AMPKdependent signling hs been proposed to be criticl. 13 Animl models of ethnol exposure hve mde it possible to produce pthologic chnges in rodent liver tht resemble erly ltertions in humn ALD. Furthermore, these models provide n importnt tool to determine the effect of specific genetic ltertions in trnsgenic or knockout mice. For exmple, ft ccumultion cused by chronic lcohol ingestion ws completely blocked in mice deficient in TNF receptor 1 (TNFR1). 14 Here, using mouse models of cute nd chronic lcohol exposure, the hypothesis tht metformin protects ginst lcoholinduced lipid ccumultion nd heptic dmge ws tested, nd the potentil role of plsminogen ctivtor inhibitor1 (PAI1) in this effect were determined. Mterils nd Methods Animls nd Tretments Mice were housed in pthogenfree brrier fcility ccredited by the Assocition for Assessment nd Accredittion of Lbortory Animl Cre nd procedures were pproved by the locl Institutionl Animl Cre nd Use Committee. Sixweekold C57BL/6J, TNF knockout (B6.129Tnfrsf1tm1Mk/J; TNFR1 / ), nd PAI1 knockout (B6.129S2Serpine1tm1Mlg/J; PAI1 / ) mice were obtined from Jckson Lbortory (Br Hrbor, ME). All knockout mice used in this study were bckcrossed t lest 1 times onto C57BL/6, voiding concerns regrding genetic differences between wildtype strin nd the knockouts t nonspecific loci. Food nd tp wter were llowed d libitum prior to experimenttion. Acute lcohol exposure model. 1,1Dimethylbigunide hydrochloride (metformin; Sigm, St. Louis, MO) or vehicle (sline) ws given once dy (2 mg/kg IP) for 4 dys prior to ethnol dministrtion; this dosge ws bsed on preliminry rngefinding studies nd previous work published by others. 15 One hour fter the lst metformin dose, mice received ethnol (6 g/kg IG) or isocloric/isovolumetric mltosedextrin solution. This model ws slightly modified from Enomoto et l 16 nd hs been proposed s predictive/ screening tool for therpies ginst liver dmge due to chronic lcohol intke. With this dose of lcohol, mice were sluggish, but conscious nd regined norml behvior within 6 hours of lcohol feeding. This dose cused no mortlity. Chronic enterl lcohol exposure model. Surgicl implnttion of the intrgstric cnnul nd enterl feeding ws performed s described previously. 17 Briefly, liquid diet described by Thompson nd Reitz 18 supplemented with lipotropes s detiled by Morimoto et l 19 ws prepred dily. Either ethnolcontining or isocloric mltosedextrin (control) diet ws fed for 4 weeks s described elsewhere. The initil rte of ethnol delivery (16 g/kg per dy) ws incresed in stepwise mnner 1 g/kg every 2 dys until the end of the first week nd then 1 g/kg every 4 dys until the end of the experiment. In prllel studies, dditionl wildtype mice fed enterl diet received metformin (35 mg/kg per dy in the diet) during the course of the study. The dose of metformin ws bsed on previous studies investigting the effect of chronic metformin on dietry stetosis in mice, 9 nd shown to be welltolerted in preliminry experiments with lcohol. At scrifice, nimls were nesthetized with sodium pentobrbitl (75 mg/kg IP).5, 1, 2, 3, 6, or 12 hours fter ethnol dministrtion. Blood ws collected from the ven cv just prior to scrifice by exsnguintion nd plsm ws stored t 8 C for further nlysis. Portions of liver tissue were frozen immeditely in liquid nitrogen, wheres others were fixed in neutrlbuffered formlin, or frozenfixed in OCT mounting medi (Tissue Tek, Htfield, PA) for subsequent sectioning nd mounting on microscope slides. Cell Culture nd Tretment AML12 cells (lph mouse liver 12, Americn Type Culture Collection, Mnsss, VA) were grown in DMEM/ HAM s F12 medi (Gibco, Crlsbd, CA) supplemented with 1% FBS, 4 ng/ml dexmethsone,.5 mg/ml insulin, nd 5 ng/ml selenium (Gibco) in humidified 5% CO 2 tmosphere t 37 C until they were 8% confluent. Cells were serum strved for 18 hours nd treted with 5 mol of metformin for 7 hours, nlogous to previous work by others. 13,2 Medium ws subsequently removed nd replced with fresh serumfree medium with or without metformin (5 mol). Prllel groups were lso incubted in the presence nd bsence of the insulin receptor kinse inhibitor tyrphostin AG124 (3 mol; Sigm). After 2 minutes, 5 ng/ml of TNF (mouse TNF ; Sigm) ws dded. Cells were incubted for 3 hours, rinsed with phosphtebuffered sline, nd lysed with RNASTAT 6 TelTest (Ambion, Austin, TX) for lter RNA isoltion nd nlysis by reltime reverse trnscriptse polymerse chin rection (RTPCR; see below). Immunoblots All buffers used for protein extrction contined protese, tyrosine phosphtse, nd serine/threonine phosphtse inhibitors purchsed from Sigm. To prepre totl heptic protein, snpfrozen liver smples were homogenized with lysis buffer (2 mmol MOPS, 15 mmol NCl, 1 mmol EDTA, 1% Nonidet P4, 1% sodium deoxycholte,.1% SDS) contining protese, tyrosine phosphtse, nd serine/ threonine phosphtse inhibitors (s described). To prepre cytosolic frctions, livers were homogenized in Dignum A buffer (1 mmol HEPES, 1.5 mmol MgCl 2, 5 mmol KCl,.5 mmol DTT), nd then extrcted with Dignm C (1 mmol HEPES, 5% glycerol, 84 mmol NCl, 1.5 mmol Mg 2 Cl,.2
3 June 26 METFORMIN PREVENTS ALCOHOLINDUCED LIVER INJURY 211 Tble 1. Primers nd Probes Used for RelTime RTPCR Detection of PAI1 nd Actin Forwrd (3=5=) Reverse (3=5=) Probe (3=5=) PAI1 CACCAACATTTTGGACGCTGA TCAGTCATGCCCAGCTTCTCC CCA GGC TGC CCC GCC TCC TC Actin GGCTCCCAGCACCATGAA AGCCACCGATCCACACAGA AAGATCATTGCTCCTCCTGAGCGCAAGTA PAI1, plsminogen ctivtor inhibitor 1; RTPCR, reverse trnscriptse polymerse chin rection. mmol EDTA,.5 mmol DTT) buffer to obtin nucler proteins. Respective lystes (4 75 g protein per well) were seprted on either 5% or 8% SDSpolycrylmide gel. Proteins were trnsferred to HybondP polyvinylidene difluoride membrnes using semidry electroblotter. The resulting blots were then probed with ntibodies ginst phosphocmet (Cell Signling Technology, Beverly, MA), polipoprotein B1 nd B48, sterol regultor element binding protein 1 (SREBP1; both Snt Cruz, Snt Cruz, CA), phosphoampk (Cell Signling Technology), or phosphocetyl CoA crboxylse (ACC; Upstte, Wlthm, MA) nd bnds were visulized using Amershm Biosciences ECL plus kit (Amershm Biosciences, Pisctwy, NJ). To ensure equl loding, ll blots were stined with Ponceu red; hptene signls were normlized to ctin using commercilly vilble ntibody (Sigm). Microsoml Triglyceride Trnsfer Protein Activity Frozen mouse livers were homogenized in extrction buffer (1 mmol Tris, ph 7.4, 15 mmol NCl, 2 mmol EDTA) centrifuged t 7 g for 5 minutes. Fluorescent ( ex 465 nm, em 535 nm) mesurement of microsoml triglyceride protein ctivity ws performed with commercilly vilble kit ccording to the instructions of the mnufcturer (Ror Biomedicl Inc., New York, NY). One hundred microgrms of totl protein ws utilized in ech rection. Very LowDensity Lipoprotein Extrction Plsm smples were mixed with OptiPrep (12% finl concentrtion, AXISSHIELD PoC AS, Oslo, Norwy), over lyered with HEPESbuffered sline (.85% NCl; 1 mmol HEPES, ph 7.4), nd centrifuged t 35, g for 3 hours t 16 C. Immeditely fter centrifugtion, smples were collected in 2 L frctions strting from the bottom of the centrifugtion tube. To scertin pproprite frctiontion of lipoproteins, 2 L from ech frction ws seprted in n grose lipoprotein gel (Beckmn Coulter, Fullerton, CA), fixed (6% ethnol, 1% glcil cetic cid), nd stined overnight (55% ethnol,.1 % Prgon Lipo Stin [Beckmn Coulter]). Gels were destined (45% ethnol) nd dried. The remining very lowdensity lipoprotein (VLDL) frction ws stored t 4 C for lter detection of triglyceride levels. Triglyceride Determintions Mouse livers were homogenized in 2 phosphtebuffered sline. Tissue lipids were extrcted with methnol: chloroform (1:2), dried in n evporting centrifuge, nd resuspended in 5% ftfree bovine serum lbumin. Colorimetric ssessment of heptic nd plsm triglyceride levels ws crried out using Sigm Dignostics Triglyceride Regent (Sigm). Vlues were normlized to protein in homogente prior to extrction determined by the Brdford ssy (BioRd Lbortories, Hercules, CA). Oil Red O Stining Frozen sections of liver (1 m) were stined with oil Red O (Sigm) for 1 minutes, wshed, nd counterstined with hemtoxylin for 45 seconds (DAKO, Crpinteri, CA). 21 A Metmorph imge cquisition nd nlysis system (Chester, PA) incorporting Nikon microscope (Nikon, Melville, NY) ws used to cpture nd nlyze the oil Red O stined tissue sections t 2 mgnifiction. 22 The extent of lbeling in the liver lobule ws defined s the percent of the field re within the defult color rnge determined by the softwre. Dt from ech tissue section (5 fields per section) were pooled to determine mens. RNA Isoltion nd RelTime RTPCR Totl RNA ws extrcted from liver tissue smples by gunidium thiocyntebsed method (RNA STAT 6 Tel Test, Ambion). RNA concentrtions were determined spectrophotometriclly, nd 1 g totl RNA ws reverse trnscribed using n AMV reverse trnscriptse kit (Promeg, Mdison, WI) nd rndom primers. PCR primers for PAI1 nd ctin were designed using primer 3 (Whitehed Institute for Biomedicl Reserch, Cmbridge, MA). Primers were designed to cross introns to ensure tht only cdna nd not genomic DNA ws mplified (Tble 1). The fluorogenic MGB probe ws lbeled with the reporter dye FAM (6crboxyfluorescein). TqMn Universl PCR Mster Mix (Applied Biosystems, Foster City, CA) ws used to prepre the PCR mix. The 2 mixture ws optimized for TqMn rections nd contins AmpliTq gold DNA polymerse, AmpErse, dntps with UTP, nd pssive reference. Primers nd probe were dded to finl concentrtion of 3 nd 1 nmol, respectively. The mplifiction rections were crried out in the ABI Prism 77 sequence detection system (Applied Biosystems) with initil hold steps (5 C for 2 minutes, followed by 95 C for 1 minutes) nd 5 cycles of 2step PCR (92 C for 15 seconds, 6 C for 1 minute). The fluorescence intensity of ech smple ws mesured t ech temperture chnge to monitor mplifiction of the trget gene. The comprtive CT method ws used to determine fold differences between smples. The comprtive CT method determines the mount of trget, norml
4 212 BERGHEIM ET AL GASTROENTEROLOGY Vol. 13, No. 7 ized to n endogenous reference ( ctin) nd reltive to clibrtor (2 Ct ). The purity of PCR products were verified by gel electrophoresis. Histologic Anlysis nd Clinicl Chemistry Formlinfixed nd prffinembedded sections (6 m) were cut nd stined with hemtoxylin nd eosin for pthologic ssessment fter chronic enterl lcohol feeding. Pthology ws scored s described by Nnji et l. 23 : stetosis 5%, 1; 25% 5%, 2; 5% 75%, 3; 75%, 4; 1 or 2 for one or more inflmmtory or necrotic foci. Plsm lnine minotrnsferse (ALT) ctivity ws determined using commercilly vilble kit (Thermo Electron, Melbourne, Austrli). Urine ws collected dily nd urine lcohol concentrtions mesured using routine spectrophotometric techniques. 24 Sttisticl Anlyses Results re reported s mens SEM (n 4 6). ANOVA with Bonferroni s post hoc test ws used for the determintion of sttisticl significnce mong tretment groups. For comprison of pthologic scores, the Mnn Whitney rnksum test ws used. A P vlue.5 ws selected before the study s the level of significnce. Results Metformin Prevents Ft Accumultion After Acute Alcohol Figure 1 shows representtive photomicrogrphs depicting lipid ccumultion in mouse livers fter cute ethnol ingestion, s determined by oil Red O stining, nd Figure 2A shows quntittion of oil Red O stining by imge nlysis. Figure 2B shows quntittion of heptic triglycerides fter cute ethnol. Lipid stining (Figures 1 nd 2A) nd triglyceride content (Figure 2B) in livers from mltosedextrin treted nimls were miniml regrdless of other tretments nd did not differ from stining in livers from nive control mice; results with wildtype mice re shown to represent these groups. In contrst, ethnol tretment cused significnt 2 fold ccumultion of lipid droplets in livers of wildtype nimls, peking 12 hours fter dministrtion (Figures 1C nd 2A); this effect ws significntly blunted in wildtype mice treted with metformin (Figure 1E nd 2A). As hs been observed previously with chronic ethnol, 14 lipid ccumultion ws drmticlly blunted in TNFR1 / mice (Figures 1D nd 2A); lipid ccumultion in TNFR1 / mice ws similr to wildtype mice treted with metformin (Figures 1E nd 2A). Pretretment with metformin did not enhnce protection from lipid ccumultion cused by ethnol in TNFR1 / mice (Figures 1F nd 2A). Similr ptterns were observed for heptic triglyceride ccumultion in these groups (Figure 2B). Figure 1. Effect of metformin on heptic ft ccumultion fter cute ethnol ingestion in mice. Representtive photomicrogrphs re shown depicting oil Red O stining of liver sections (2 ) of wildtype nd (E, F) TNFR1 / mice given ethnol (EtOH) or isocloric mltosedextrin. Animls were either injected with 2 mg/kg metformin or sline prior to ethnol (mltose dextrin) dministrtion. See Mterils nd Methods for detils. Effect of Acute Ethnol nd Metformin on Phosphoryltion of AMPK nd ACC, nd Nucler Locliztion of SREBP1 in Mouse Liver Results of in vitro studies hve indicted tht the inhibition of lipid ccumultion cused by metformin could, in prt, be medited through n ctivtion of AMPK, leding to phosphoryltion nd inctivtion of ACC 25 ; this inhibition of ACC could subsequently result in decresed formtion of mlonyl CoA, known llosteric inhibitor of crnitine plmitoyltrnsferse (CPT)1, nd subsequent mitochondril heptic oxidtion. Furthermore, it hs been suggested tht the lco
5 June 26 METFORMIN PREVENTS ALCOHOLINDUCED LIVER INJURY 213 A Ft Accumultion (% of Microscope Field) B Heptic Triglycerides (% of Control) Ethnol Metformin,b,b,b,b Wildtype,b,b,b,b,b,b holinduced loss of AMPK ctivity might lso result in n ctivtion of SREBP1, one of the key regultors of ft metbolism. 26 Therefore, phosphoryltion of AMPK nd ACC nd nucler trnsloction of SREBP1 were determined by Western blot fter cute lcohol ingestion (Figure 3). Figure 3 depicts representtive results (A) nd densitometric nlysis (B) of these immunoblots. Under these conditions, cute ethnol did not significntly lter the phosphoryltion sttus of AMPK nd did not hve n pprent effect on nucler SREBP1 levels t ny time point tested (Figure 3), including, 1, nd 2 hours fter ethnol dministrtion (dt not shown). Acute ethnol cused significnt increse in the phosphoryltion sttus of ACC with vlues 2fold higher 6 hours fter ethnol ingestion. The effect of metformin pretretment in vivo on the chnges in these prmeters ws lso determined (Figures 3A nd 3B). Metformin neither TNFR1 / PAI1 / Figure 2. Quntittion of triglycerides nd heptic ft ccumultion 12 hours fter cute lcohol ingestion in mice. Animls nd tretments re s described in Mterils nd Methods. Imge nlysis of lipid ccumultion (A; see lso Figure 1) nd determintion of heptic triglycerides (B) were performed s described in Mterils nd Methods. Dt re mens SEM (n 4 6) nd re normlized to percent of control (A) or s percent of microscope field (B). P.5 compred with wildtype control; b P.5 compred with wildtype ethnoltreted. significntly ltered the phosphoryltion sttus of AMPK nd ACC, nor the nucler locliztion of SREBP1, in control (mltosedextrin)treted mice (dt not shown). Anlogous to ethnol lone (Figures 3A nd 3B), the phosphoryltion sttus of AMPK nd nucler locliztion of SREBP1 were unffected by metformin under these conditions. Metformin dministrtion lso did not significntly lter the increse in ACC phosphoryltion cused by ethnol lone. Metformin Prevents Induction of PAI1 Expression in Liver Tissue Cused by Acute Alcohol Metformin confers other effects in the cell in ddition to ctivting AMPK. For exmple, it is lso potent inhibitor of PAI1 expression. 27 To determine if PAI1 expression ws ltered by cute lcohol ingestion, PAI1 mrna levels were determined by reltime PCR in liver smples 12 hours fter cute lcohol ingestion (Figure 4A). Acute lcohol ingestion cused biphsic increse in heptic PAI1 mrna levels, peking 2 nd 12 hours fter ethnol ingestion, with vlues 5 nd 1fold over controls, respectively (Figure 4A). In prllel experiments, the effect of metformin on the induction of PAI1 were determined 12 hours fter ethnol ingestion (Figure 4B). Metformin hd no effect on bsl expression of PAI1 in the bsence of ethnol in wildtype mice. Furthermore, bsl levels of PAI1 mrna in TNFR1 / mice were not different from wildtype mice. The results with wildtype mice treted with mltosedextrin re shown s summry of these groups in Figure 4B. However, metformin tretment significntly blunted the induction of PAI1 expression cused by ethnol in wildtype mice, with vlues in this group similr to mltosedextrin controls (Figure 4B). Anlogous to findings with lipid ccumultion (see Figure 1), the increse in PAI1 expression cused by ethnol ws lso prevented in TNFR1 / mice. Heptic Lipid Levels After Acute Alcohol Ingestion: Effect of Knocking Out PAI1 Figure 2 lso summrizes the effect of ethnol on the levels of heptic lipid ccumultion (A) nd triglyceride content (B) in PAI1 knockout (PAI1 / ) mice. The increse in heptic lipid levels cused by cute ethnol ws lso significntly blunted in PAI1 / mice (see Figure 2), with vlues similr to those of ethnol treted wildtype mice given metformin or TNFR1 / mice. As with TNFR1 / mice, metformin tretment conferred no dditionl protective effect ginst cute ethnolinduced lipid ccumultion in PAI1 / mice (Figure 2).
6 214 BERGHEIM ET AL GASTROENTEROLOGY Vol. 13, No. 7 Figure 3. Effect of ethnol nd metformin on the phosphoryltion sttus of AMPK nd ACC, s well s nucler trnsloction of SREBP1 fter cute lcohol ingestion. Animls nd tretments re s described in Mterils nd Methods. (A) Representtive Western blots depicting phosphorylted nd totl AMPK nd ACC, s well s nucler locliztion of SREBP1 6 hours fter cute ethnol dministrtion. (B) Results of quntittive nlysis. Dt re presented s men vlues SEM nd re normlized to percent of control (n 4 6). P.5 compred with wildtype mice dministered mltose dextrin. Metformin Prevents TNF Induced PAI1 Expression in AML12 Cells As described, correltion between TNF, lipid ccumultion (Figures 1 nd 2), nd the expression of PAI1 (Figure 4) ws observed fter cute ethnol in vivo. Therefore, the effect of TNF nd metformin on the expression of PAI1 ws determined in AML12 cells (see Mterils nd Methods). Incubtion of AML12 cells with TNF (5 ng/ml) for 3 hours resulted in significnt increse of PAI1 mrna expression by 3fold (Figure 5). In cells concomitntly treted with metformin (5 mol), the induction of PAI1 expression cused by TNF ws significntly suppressed by 4%; this protective effect ws lso prevented by concomitnt dministrtion of the insulin receptor tyrosine kinse inhibitor, tyrphostin AG124 (see Figure 5). Furthermore, the protective effect of metformin ws prevented if norml insulin found in the culture medium ws excluded (dt not shown). Impired Heptic cmet Signling nd Lipid Secretion Cused by Acute Alcohol Is Prevented by Metformin nd in PAI1 / Mice Previous studies hve indicted tht in the liver, heptic growth fctor (HGF)/cMet signling nd subsequent lipoprotein synthesis is impired by lcohol ingestion, which my in prt medite heptic triglyceride ccumultion. 28,29 Therefore, the effect of ethnol nd metformin on cmet ctivtion ws evluted. Figure 6 depicts representtive Western blot (A) nd quntittive nlysis (B) of this protein. The phosphoryltion
7 June 26 METFORMIN PREVENTS ALCOHOLINDUCED LIVER INJURY 215 A B Reltive mrna Expression (% of Control) Reltive mrna Expression (% of Control) 12 PAI Ethnol Metformin Hours fter Acute Ethnol PAI1 (12 h) Wildtype sttus of cmet in liver ws similr in the bsence of ethnol, regrdless of dditionl tretment or mouse strin (Figure 6A, lne 1 is representtive for ll control groups). Acute ethnol cused no significnt ltertion in the rtio of phospho:totl cmet 12 hours fter lcohol ingestion (Figures 6A lne 2, nd 6B). However, pretretment with metformin cused significnt 3fold increse in the rtio of phospho:totl cmet fter cute ethnol dministrtion. Similrly, cmet phosphoryltion ws enhnced following cute dministrtion of ethnol in PAI1 / nd TNFR1 / mice. In line with the dt on lipid ccumultion (Figure 2), metformin hd no dditionl effect on cmet phosphoryltion in these strins (dt not shown). Previous studies hve shown tht cmet ctivtion cn increse VLDL synthesis in liver. Therefore, heptic polipoprotein B1 nd B48 protein (Figures 6C nd 6D) levels nd the ctivity of the microsoml triglyceride trnsfer protein (MTTP; Figure 6E) were determined 12 b b TNFR1 / Figure 4. Effect of ethnol nd metformin on the expression of PAI1 mrna in liver. Animls nd tretments re s described in Mterils nd Methods. Expression of PAI1 mrna ws determined by reltime RTPCR s described in Mterils nd Methods. (A) Expression of PAI1 mrna 12 hours fter cute lcohol ingestion in wildtype mice. P.5 compred with t hours. (B) Effect of metformin or knocking out TNFR1 (TNFR1 / ) on the increse in PAI1 expression cused by ethnol 12 hours fter dministrtion. Dt re men vlues SEM (n 4 6). P.5 compred with wildtype mice dministered mltose dextrin. b P.5 compred with wildtype given ethnol. hours fter cute lcohol ingestion. Levels of polipoprotein B1 in livers of wildtype nimls exposed to cute lcohol did not differ from those of controls (Figures 6C nd 6D). However, in livers of nimls pretreted with metformin, s well s in PAI1 / nd TNFR1 / mice, levels of polipoprotein B1 were significntly incresed by pproximtely 4fold in comprison to wildtype nimls exposed to ethnol. No differences were found between wildtype, PAI1 / nd TNFR1 / mice treted with mltosedextrin nd sline or mltosedextrin nd metformin (Figure 6C, lne 1 shown to represent these groups). Wheres ethnol hd no pprent effect on the bsl level of polipoprotein B48 in wildtype nimls, concomitnt metformin tretment lso led to n increse in this protein fter ethnol dministrtion (Figures 6C nd 6D). A similr increse in levels of this protein ws observed in TNFR1 / nd PAI1 / mice given ethnol. MTTP ctivity in mltosedextrin treted nimls ws similr to those of chow fed mice, irrespective of strin or dditionl tretment (eg, metformin); results for wildtype mice given mltosedextrin re therefore shown to represent these groups. Acute lcohol ingestion hd no effect on heptic MTTP ctivity in wildtype mice (Figure 6E). However, similr to polipoprotein B1 nd B48 levels, in livers of metformin pretreted wildtype mice s well s TNFR1 / nd PAI1 / mice ethnol ingestion resulted in significnt induction of MTTP ctivity in comprison with controls. Specificlly, MTTP ctivity in livers of these nimls ws 35% higher in comprison with controls (Figure 6E). Furthermore, cute ethnol ingestion resulted in 6% decrese in reltive RNA Concentrtion (% of Control) Metformin AG124 TNFα,b Figure 5. Effect of metformin nd tyrphostinag124 on TNF induced PAI1 mrna levels in AML12 cells. AML12 cells were pretreted s described in Mterils nd Methods. PAI1 mrna levels were determined in cell culture smples using reltime RTPCR. Dt re men vlues SEM nd re normlized to percent of control. Quntittive nlysis of 3 seprte experiments. P.5 compred to control. b P.5 compred with TNF treted cells.
8 216 BERGHEIM ET AL GASTROENTEROLOGY Vol. 13, No. 7 Figure 6. Effect of ethnol nd metformin on phosphoryltion sttus of cmet, heptic levels of ApoB (1 nd 48), nd heptic MTTP ctivity fter cute lcohol ingestion. Animls nd tretments re s described in Mterils nd Methods. (A) Representtive Western blots of phosphorylted nd totl cmet. (B) Quntittive nlysis of blots. (C) Representtive Western blots of ApoB1 nd B48. (D) Quntittive nlysis of blots. Dt for ApoB1 nd B48 were normlized to ctin. (E) Results of determintion of heptic MTTP ctivity. Dt re men vlues SEM (B, D, nd E) nd re normlized to percent of control (n 4 6). P.5 compred with wildtype mice dministered mltose dextrin. b P.5 compred with wildtype mice dministered ethnol. the mount of triglycerides (normlized to totl protein) in the plsm VLDL frction compred to controls (dt not shown); this decrese ws not observed in wildtype mice treted with metformin nd vlues were not significntly different from wildtype nimls treted with mltose dextrin. Effect of Metformin nd Deletion of PAI1 on Chronic AlcoholInduced Liver Dmge Although studies with cute ethnol (Figures 1 6) implicted potentil role of PAI1 in erly stetosis owing to ethnol, whether or not metformin or
9 June 26 METFORMIN PREVENTS ALCOHOLINDUCED LIVER INJURY 217 knocking out PAI1 will prevent chronic liver dmge owing to ethnol remined uncler. Therefore, the effect of metformin or knocking out PAI1 on liver dmge owing to chronic enterl lcohol feeding ws determined. All nimls gined weight during the course of the study; there were no significnt differences in body weight gins between the groups studied, indicting tht nimls were dequtely nourished. As reported previously by severl groups, 14,3 dily urine lcohol concentrtions fluctuted between nd 5 mg/dl, which is cused by fluctutions in hormones from the hypothlmic pituitry thyroid xis. 31 Wildtype mice ( metformin) nd PAI1 / mice hve similr ptterns of urine lcohol cycling nd verge men nd pek urine lcohol levels were not significntly different between the groups with vlues of 2 nd 45 mg/dl, respectively. In wildtype mice fed control diet, liver weights (s percent of body weight) were 5.3.2; chronic enterl ethnol nerly doubled liver weight in wildtype mice, with vlues of Although not significntly ffecting the liver weight in nimls fed control diet, metformin dministrtion or knocking out PAI1 significntly ttenuted the increse in liver size cused by ethnol by 3% 4%, with vlues of nd for wildtype mice given metformin nd PAI1 / mice, respectively. Figure 7 shows representtive photomicrogrphs of livers from wildtype ( metformin) nd PAI1 / mice fed enterl diet with nd without ethnol for 4 weeks. Figure 8 depicts corresponding ALT vlues (A) nd pthologic scores (B) in these groups. There were no significnt pthologic chnges fter 4 weeks of highft control diet in wildtype ( metformin) or in PAI1 / mice (Figure 7A shown to represent these groups) ALT levels were norml with vlues 25 IU/L (Figure 8A). As expected, enterl ethnol lone for 4 weeks cused severe ftty infiltrtion (Figure 7B), with focl inflmmtion (Figure 7E) nd necrosis (Figure 7F) in wildtype mice, s is summrized by the pthology scores (Figure 8B). Enterl ethnol lso incresed ALT levels significntly 5fold over control vlues in this group (Figure 8A) in wildtype mice. In wildtype mice, metformin dministrtion prevented liver dmge cused by ethnol (Figure 7C), s quntitted by significnt blunting of the increse in ALT (Figure 8A) nd pthology scores (Figure 8B). Similr to the effect of metformin in wildtype mice, PAI 1 / mice were lso protected ginst liver dmge due to chronic ethnol (Figures 7D nd 8). Interestingly, the protection ginst stetosis due to chronic ethnol with metformin or knocking out PAI1 (Figure 8B, upper left pnel), ws not s robust s observed with these tretments fter cute ethnol (Figures 1 nd 2). However, Figure 7. Photomicrogrphs of livers following chronic ethnol tretment. Animls were fed highft control or highft ethnolcontining diets enterlly for 4 weeks s described in Mterils nd Methods. Representtive photomicrogrphs (1 ) of livers from wildtype mice fed control diet (A), wildtype mice fed ethnol diet (B), wildtype mice fed ethnol diet contining metformin (C), nd PAI1 knockout mice fed ethnol diet (D) re shown. Additionl pnels (2 ) show focl inflmmtory (E) nd necrotic (F) chnges observed in wildtype mice fed chronic ethnolcontining diet. inflmmtion nd necrosis due to ethnol were lmost completely blunted in these groups (Figure 8B, upper right nd lower left pnels). Tble 2 summrizes the effect of ethnol, metformin, or knocking out PAI1 on some indices determined bove with cute ethnol. As observed with cute ethnol (Figure 4), the expression of PAI1 ws significntly induced in wildtype mice fed chronic ethnol (Tble 2); however, the mgnitude of induction ws not s robust s observed fter cute ethnol. Metformin tretment prevented the induction of PAI1 cused by ethnol; indeed, expression of PAI1 in this group ws ctully only 3% of tht of wildtype mice fed control diet (Tble 2). As expected, PAI1 mrna ws not detectble in PAI1 / mice. As hd been observed with cute ethnol under these conditions (Figure 3), the phosphoryltion sttus of AMPK ws not significntly ltered in ny
10 218 BERGHEIM ET AL GASTROENTEROLOGY Vol. 13, No. 7 A B ALT (IU/L) Ethnol Metformin Pthology Score Ethnol Metformin Wildtype Stetosis 2,b,b b Necrosis b Wildtype PAI1 / ,b PAI1 / b Inflmmtion b,b Totl b,b Wildtype PAI1 / Figure 8. Effect of ethnol nd metformin on lnine minotrnsferse ctivity nd pthology scores. Animls were fed highft control or highft ethnolcontining diets enterlly for 4 weeks s described in Mterils nd Methods. Alnine minotrnsferse (ALT; A) ctivity nd pthology scores (B) were determined s described in Mterils nd Methods. Dt represent mens SEM (n 4 6). P.5 compred to mice fed highft control diet; b P.5 compred to wildtype mice fed highft ethnol diet. group fter chronic enterl ethnol feeding (Tble 2). Furthermore, in wildtype mice fed chronic ethnol, the phosphoryltion of ACC ws not significntly ltered. Wheres metformin hd no significnt effect on the phosphoryltion sttus of ACC in wildtype mice fed control diet, the sttus ws significntly decresed in metformintreted mice fed ethnol in comprison with wildtype mice fed ethnol in the bsence of metformin (Tble 2). The reltive phosphoryltion sttus of ACC ws significntly lower in PAI1 / mice in comprison with wildtype mice fed in the bsence of metformin, but ethnol hd no effect on this strin. Discussion Results of severl studies hve identified ccumultion of lipids in the liver to be criticl erly stge in the development of ALD (for review see Teli et l 32 nd Wnless nd Shiot 33 ). However, therpies to prevent the initition of this process re limited; the mechnisms involved re still poorly understood. Animl models resembling conditions of erly stge ALD in humns hve been found to be useful tools to investigte mechnisms nd pthophysiology underlying the effects of ethnol on the liver. Here, n cute model of lcohol exposure consisting of 1 bolus dose of lcohol ws used to mimic these erly chnges. Acute nd chronic lcoholinduced liver injury seem to shre similr mechnisms (for review see Thurmn et l 34 ). Therefore, cute lcohol exposure cn lso be used to mimic very erly effects of ethnol in the progression of chronic liver dmge. Although it should be emphsized tht cute ethnol by no mens mimics ll effects of chronic ethnol on the liver (eg, inflmmtion), this model could potentilly serve s screening tool for new therpies. For exmple, Enomoto et l 16 showed tht compounds previously shown to protect ginst chronic lcoholinduced liver dmge lso protected rt liver ginst cute ethnolinduced stetosis. In the present study, the hypothesis Tble 2. Effect of Chronic Ethnol on Select Prmeters in Mice High ft control Wildtype mice Wildtype mice metformin PAI1 / mice High ft ethnol High ft control High ft ethnol High ft control High ft ethnol PAI1 mrna b n/d n/d pampk:tampk pacc:tacc b b 78 9 b Feeding of chronic enterl diet nd metformin tretment re s described in Mterils nd Methods. Expression of PAI1 ws determined by reltime RTPCR. The rtio of phosphorylted AMPK nd ACC to totl protein ws determined by Western blot, s described in Mterils nd Methods. Dt re men vlues SEM nd re normlized to percent of wildtype mice fed control diet (n 4 6). n/d, not detectble. P.5 compred with wildtype mice dministered mltose dextrin. b P.5 compred with wildtype mice dministered ethnol.
11 June 26 METFORMIN PREVENTS ALCOHOLINDUCED LIVER INJURY 219 tht metformin protects ginst erly lcoholinduced ft ccumultion ws first tested in model of cute lcohol ingestion. Indeed, pretretment with metformin significntly blunted lipid ccumultion in the liver of mice owing to cute lcohol exposure (see Figures 1D nd 5). Metformin Confers Protection Aginst Ethnol Independent of AMPK Signling One mechnism by which lcohol is proposed to cuse lipid ccumultion is by inhibition of oxidtion of ftty cids. Previous in vitro studies with metformin indicte tht this drug my prevent such n inhibition. Specificlly, metformin ws shown in vitro to ctivte AMPK, leding to phosphoryltion nd inhibition of ACC 13 ; mlonyl CoA, the product of ACC, is n llosteric inhibitor of CPT1, key component of oxidtion of ftty cids. Furthermore, it hs been suggested tht the lcoholmedited impirment of AMPK ctivity might result in n ctivtion of SREBP1, key regultor of ft metbolism. In the present study, decrese in AMPK/ ACC phosphoryltion nd/or nucler trnsloction of SREBP1 ws not observed with cute lcohol ingestion; indeed, cute lcohol dministrtion led to n increse in the phosphoryltion sttus of ACC. After chronic enterl lcohol exposure, the phosphoryltion sttus of AMPK nd ACC were lso not decresed (see Tble 2). Despite conferring protective effect ginst lcoholinduced lipid ccumultion, metformin did not lter AMPK nd ACC phosphoryltion or nucler trnsloction of SREBP1 under these conditions. It my be tht dosges of metformin required to induce AMPK re higher thn those used here. Tken together, these dt suggest tht the protective effect of metformin under these conditions is independent of AMPK ctivtion nd its dependent pthwys. These results do not preclude role of AMPK signling in lcoholinduced liver injury, but rther suggest tht dditionl pthwys my contribute to lipid ccumultion. Ethnol Induces Heptic PAI1 Expression: Prevention With Metformin In ddition to ctivting AMPK, metformin hs been shown to suppress induction of PAI1 expression. 2,27 Here, cute lcohol ingestion led to biphsic induction of heptic PAI1 mrna expression, peking t 2 nd 12 hours fter lcohol ingestion; this increse ws blunted by metformin pretretment (Figure 5B). PAI1 ws lso observed to be induced in the liver by chronic ethnol ingestion (Tble 2). To further investigte the role of PAI1 under these conditions, lipid ccumultion fter cute nd chronic lcohol dministrtion ws determined in PAI1 / mice (Figures 1, 2, 7, nd 8). PAI1 / mice were protected ginst lipid ccumultion owing to ethnol (Figures 1 nd 2). Importntly, this effect ws not further enhnced by metformin pretretment in this mouse strin. Although less effective reltive to cute studies with ethnol, metformin or knocking out PAI1 lso significntly ttenuted stetosis owing to chronic ethnol dministrtion (Figures 7 nd 8). Previous studies hve indicted link between heptic PAI1 expression nd TNF. 38,39 Indeed, both in increses heptic lipid content (Figures 1 nd 2) nd PAI1 expression due to ethnol (Figure 4) were significntly blunted in TNFR1 / mice reltive to wildtype mice. Furthermore, metformin did not confer dditionl protective effects ginst lipid ccumultion nd PAI1 induction in this strin of mice. In line with link between PAI1 nd TNF, ddition of TNF to AML12 cells cused n increse in PAI1 expression (Figure 6), similr to wht hs been observed by others. 4 The mechnism by which TNF induces PAI1 expression is not completely understood. However, it ws shown here tht metformin prevented TNF induced PAI1 expression. This protective effect of metformin ws brogted by either removing insulin from the culture medi, or by blocking insulin receptor signling (tyrphostin AG124; Figure 6), suggesting link between the protective effects of PAI1 nd insulin signling under these conditions. How Does PAI1 Medite AlcoholInduced Lipid Accumultion? PAI1 is n cute phse protein expressed under conditions of inflmmtion. PAI1 is mjor inhibitor of both tissuetype plsminogen ctivtor nd urokinsetype plsminogen ctivtor (upa), thereby plying mjor regultory role in fibrinolysis. 41 However, recent work hs indicted tht PAI1 my hve other functions, nmely, in lipid metbolism. For exmple, M et l 42 found in model of highft/highcrbohydrte diet induced obesity tht PAI1 / mice were protected from heptic lipid ccumultion. Furthermore, Alessi et l 43 reported tht circulting plsm PAI1 levels in humns re closely relted to the degree of liver stetosis. The findings of the current work indeed support the hypothesis tht PAI1 is cuslly involved in heptic stetosis. Although phrmcologic (metformin) or genetic (TNFR1 / nd PAI1 / ) inhibition of PAI1 induction clerly prevented cute lcoholinduced ft ccumultion, the mechnisms of this inhibitory effect were uncler. In ddition to the inhibition of oxidtion of ftty cids, ethnol lso inhibits the synthesis nd excretion of VLDL lipids, 44,45 which cn lso led to ft
12 211 BERGHEIM ET AL GASTROENTEROLOGY Vol. 13, No. 7 ccumultion. Although upa is minly known for its function in proteolytic clevge of plsminogen to plsmin, it hs lso been shown to ctivte prohgf, 46 which binds to the cmet receptor with high ffinity. 47 Results of in vitro studies performed by Kibori et l 48 suggested tht ctivtion of cmet by HGF stimultes lipoprotein secretion in heptocytes. Indeed, chronic ethnol tretment downregultes heptic cmet nd polipoprotein expression. 49 Furthermore, HGF dministrtion enhnces the rte of recovery from experimentl lcoholinduced ftty liver nd is ssocited with incresed synthesis nd secretion of polipoprotein B nd subsequent formtion of VLDL. 28,49 Although cute ethnol dministrtion did not significntly decrese cmet phosphoryltion, heptic polipoprotein levels, nd MTTP ctivity per se in wildtype nimls, pretretment with metformin cused significnt increse in ll of these prmeters. In support of the hypothesis tht TNF nd PAI1 re involved in this process, TNFR1 / nd PAI1 / mice hd similr response to ethnol s did metformin treted wildtype mice. Importntly, metformin pretretment did not enhnce these prmeters in either knockout strin, further supporting the hypothesis tht TNF nd PAI1 signling involve shred pthwy. Tken together, these dt suggest tht the protective effect of metformin ginst lcoholinduced stetosis is medited t lest in prt by prevention of the ctivtion of PAI1 by TNF nd subsequent upregultion of VLDL synthesis through HGFmediting signling. These dt suggest tht the protective effect under these conditions represents compenstory increse in VLDL synthesis to ccount for the greter mount of lipids in the heptocyte fter ethnol exposure. With chronic ethnol dministrtion, other fctors tht cn contribute to lipid ccumultion my surpss the importnce of PAI1, thereby explining the less effective inhibition under these conditions. Does PAI1 Ply Cusl Role in Alcoholic Liver Disese? A very interesting finding in studies of PAI1 / mice in the chronic enterl ethnol model is tht it ppers tht genetic inhibition of PAI1 lso conferred ntiinflmmtory effects. Specificlly, lthough knocking out PAI1 significntly blunted the stetotic chnges cused by ethnol, this strin hd lmost complete brogtion of inflmmtory chnges cused by ethnol under these conditions (Figure 8). A similr ntiinflmmtory effect of knocking out PAI1 ws observed by Kitching et l 5 in mouse model of glomerulonephritis; PAI1 / mice hd fewer infiltrting leukocytes nd less severe dmge to the glomeruli in their model. Two potentil mechnisms identified in the literture by which PAI1 could medite proinflmmtory response include impired fibrinolysis, leding to fibrin ccumultion (eg, Holdsworth et l 51 nd Loike et l 52 ), or inhibition of the proteolytic ctivtion/dectivtion of inflmmtory/ntiinflmmtory cytokines by PAI These potentil mechnisms re of course not mutully exclusive nd my ll contribute to liver dmge cused by ethnol (medited by PAI1). The results of the present study suggest novel pthwy in lcoholinduced stetosis nd liver dmge involving the induction of PAI1 expression in the liver vi metformin sensitive, TNF dependent pthwy. Furthermore, these results lso suggest new mechnism by which metformin protects the liver from ft ccumultion t the level of VLDL synthesis. Although tretment of ALD in humns with metformin my be limited due to the possible risk of lctic cidosis, 56,57 these results suggest tht therpies tht more specificlly trget PAI1 expression or enhnce upa ctivity might be useful therpies to tret ALD or prevent its progression. This hypothesis is further bolstered by the possibility tht inhibition of PAI1 my lso be ntiinflmmtory nd ntifibrotic in liver. 58,59 References 1. Grnt BF, Dufour MC, Hrford TC. Epidemiology of lcoholic liver disese. Semin Liver Dis 1988;8: McSween RN, Burt AD. Histologic spectrum of lcoholic liver disese. Semin Liver Dis 1986;6: Dy CP, Jmes OF. Heptic stetosis: innocent bystnder or guilty prty? Heptology 1998;27: Hrrison SA, Diehl AM. Ft nd the liver moleculr overview. Semin Gstrointest Dis 22;13: Arteel GE. Oxidnts nd ntioxidnts in lcoholinduced liver disese. Gstroenterology 23;124: Snyl AJ, CmpbellSrgent C, Mirshhi F, Rizzo WB, Contos MJ, Sterling RK, Luketic VA, Shiffmn ML, Clore JN. Nonlcoholic stetoheptitis: ssocition of insulin resistnce nd mitochondril bnormlities. Gstroenterology 21;12: Sglm K, Kilic R, Yilmz MI, Gulec M, Bykl Y, Kutlu M. Insulin resistnce in ptients with stetoheptitis. Heptogstroenterology 23;5: Nir S, Diehl AM, Wisemn M, Frr GH Jr, Perrillo RP. Metformin in the tretment of nonlcoholic stetoheptitis: pilot open lbel tril. Aliment Phrmcol Ther 24;2: Lin HZ, Yng SQ, Chuckree C, Kuhjd F, Ronnet G, Diehl AM. Metformin reverses ftty liver disese in obese, leptindeficient mice. Nt Med 2;6: Mrchesini G, Brizi M, Binchi G, Tomssetti S, Zoli M, Melchiond N. Metformin in nonlcoholic stetoheptitis. Lncet 21;358: Diehl AM, Goodmn Z, Ishk KG. Alcohollike liver disese in nonlcoholics. A clinicl nd histologic comprison with lcoholinduced liver injury. Gstroenterology 1988;95: Hll PD. Pthologicl spectrum of lcoholic liver disese. Alcohol Alcohol Suppl 1994;2:
13 June 26 METFORMIN PREVENTS ALCOHOLINDUCED LIVER INJURY Zhou G, Myers R, Li Y, Chen Y, Shen X, FenykMelody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshmn MF, Goodyer LJ, Moller DE. Role of AMPctivted protein kinse in mechnism of metformin ction. J Clin Invest 21;18: Yin M, Wheeler MD, Kono H, Brdford BU, Gllucci RM, Luster MI, Thurmn RG. Essentil role of tumor necrosis fctor in lcoholinduced liver injury. Gstroenterology 1999;117: Yzr A, Polt G, Un I, Levent A, Kygusuz A, Buyukfsr K, Cmdeviren H. Effects of glibenclmide, metformin nd insulin on the incidence nd ltency of deth by oubininduced rrhythmis in mice. Phrmcol Res 22;45: Enomoto N, Ikejim K, Ymshin S, Enomoto A, Nishiur T, Nishimur T, Brenner DA, Schemmer P, Brdford BU, River CA, Zhong Z, Thurmn RG. Kupffer cellderived prostglndin E(2) is involved in lcoholinduced ft ccumultion in rt liver. Am J Physiol Gstrointest Liver Physiol 2;279:G1 G McKim SE, Gbele E, Isym F, Lmbert JC, Tucker LM, Wheeler MD, Connor HD, Mson RP, Doll MA, Hein DW, Arteel GE. Inducible nitric oxide synthse is required in lcoholinduced liver injury: studies with knockout mice. Gstroenterology 23;125: Thompson JA, Reitz RC. Effects of ethnol ingestion nd dietry ft levels on mitochondril lipids in mle nd femle rts. Lipid 1978;13: Morimoto M, Zern MA, Hgbjork AL, IngelmnSundberg M, French SW. Fish oil, lcohol, nd liver pthology: role of cytochrome P452E1. Proc Soc Exp Biol Med 1994;27: Anfosso F, Chomiki N, Alessi MC, Vgue P, JuhnVgue I. Plsminogen ctivtor inhibitor1 synthesis in the humn heptom cell line Hep G2. Metformin inhibits the stimulting effect of insulin. J Clin Invest 1993;91: vn Goor H, Gerrits PO, Grond J. The ppliction of lipidsoluble stins in plsticembedded sections. Histochemistry 1986;85: Arteel GE, Iimuro Y, Yin M, Rleigh JA, Thurmn RG. Chronic enterl ethnol tretment cuses hypoxi in rt liver tissue in vivo. Heptology 1997;25: Nnji AA, Mendenhll CL, French SW. Beef ft prevents lcoholic liver disese in the rt. Alcohol Clin Exp Res 1989;13: McKim SE, Konno A, Gbele E, Uesugi T, Froh M, Sies H, Thurmn RG, Arteel GE. Coco extrct protects ginst erly lcoholinduced liver injury in the rt. Arch Biochem Biophys 22;46: You M, Crbb DW. Recent dvnces in lcoholic liver disese II. Minireview: moleculr mechnisms of lcoholic ftty liver. Am J Physiol Gstrointest Liver Physiol 24;287:G1 G You M, Mtsumoto M, Pcold CM, Cho WK, Crbb DW. The role of AMPctivted protein kinse in the ction of ethnol in the liver. Gstroenterology 24;127: Grnt PJ, Sticklnd MH, Booth NA, Prentice CR. Metformin cuses reduction in bsl nd postvenous occlusion plsminogen ctivtor inhibitor1 in type 2 dibetic ptients. Dibet Med 1991;8: Tomit K, Azum T, Kitmur N, Nishid J, Tmiy G, Ok A, Inokuchi S, Nishimur T, Suemtsu M, Ishii H. Pioglitzone prevents lcoholinduced ftty liver in rts through upregultion of cmet. Gstroenterology 24;126: Thr M, Mtsumoto K, Nukiw T, Nkmur T. Heptocyte growth fctor leds to recovery from lcoholinduced ftty liver in rts. J Clin Invest 1999;13: Kono H, Rusyn I, Yin M, Gbele E, Ymshin S, Diklov A, Kdiisk MB, Connor HD, Mson RP, Segl BH, Brdford BU, Hollnd SM, Thurmn RG. NADPH oxidsederived free rdicls re key oxidnts in lcoholinduced liver disese. J Clin Invest 2;16: Li J, Nguyen V, French BA, Prlow AF, Su GL, Fu P, Yun QX, French SW. Mechnism of the lcohol cyclic pttern: role of the hypothlmicpituitrythyroid xis. Am J Physiol Gstrointest Liver Physiol 2;279:G118 G Teli MR, Dy CP, Burt AD, Bennett MK, Jmes OF. Determinnts of progression to cirrhosis or fibrosis in pure lcoholic ftty liver. Lncet 1995;346: Wnless IR, Shiot K. The pthogenesis of nonlcoholic stetoheptitis nd other ftty liver diseses: fourstep model including the role of lipid relese nd heptic venulr obstruction in the progression to cirrhosis. Semin Liver Dis 24;24: Thurmn RG, Brdford BU, Iimuro Y, Knecht KT, Arteel GE, Yin M, Connor HD, Wll C, Rleigh JA, Frnkenberg MV, Adchi Y, Formn DT, Brenner D, Kdiisk M, Mson RP. The role of gutderived bcteril toxins nd free rdicls in lcoholinduced liver injury. J Gstroenterol Heptol 1998;13 Suppl:S Adchi Y, Brdford BU, Go W, Bojes HK, Thurmn RG. Inctivtion of Kupffer cells prevents erly lcoholinduced liver injury. Heptology 1994;2: Adchi Y, Moore LE, Brdford BU, Go W, Thurmn RG. Antibiotics prevent liver injury in rts following longterm exposure to ethnol. Gstroenterology 1995;18: Iimuro Y, Ikejim K, Rose ML, Brdford BU, Thurmn RG. Nimodipine, dihydropyridinetype clcium chnnel blocker, prevents lcoholic heptitis due to chronic intrgstric ethnol exposure in the rt. Heptology 1996;24: Swdey MS, Loskutoff DJ. Regultion of murine type 1 plsminogen ctivtor inhibitor gene expression in vivo. Tissue specificity nd induction by lipopolyscchride, tumor necrosis fctorlph, nd trnsforming growth fctorbet. J Clin Invest 1991;88: Ferns C, Loskutoff DJ. Induction of plsminogen ctivtor inhibitor 1 gene expression in murine liver by lipopolyscchride. Cellulr locliztion nd role of endogenous tumor necrosis fctorlph. Am J Pthol 1997;15: Seki T, Gelehrter TD. Interleukin1 induction of type1 plsminogen ctivtor inhibitor (PAI1) gene expression in the mouse heptocyte line, AML 12. J Cell Physiol 1996;168: Kruithof EK. Plsminogen ctivtor inhibitors review. Enzyme 1988;4: M LJ, Mo SL, Tylor KL, Knjnbuch T, Gun Y, Zhng Y, Brown NJ, Swift LL, McGuinness OP, Wssermn DH, Vughn DE, Fogo AB. Prevention of obesity nd insulin resistnce in mice lcking plsminogen ctivtor inhibitor 1. Dibetes 24;53: Alessi MC, Bstelic D, Mvri A, Mornge P, Berthet B, Grino M, JuhnVgue I. Plsm PAI1 levels re more strongly relted to liver stetosis thn to dipose tissue ccumultion. Arterioscler Thromb Vsc Biol 23;23: Venktesn S, Wrd RJ, Peters TJ. Effect of chronic ethnol feeding on the heptic secretion of verylowdensity lipoproteins. Biochim Biophys Act 1988;96: Guzmn M, Cstro J. Zonl heterogeneity of the effects of chronic ethnol feeding on heptic ftty cid metbolism. Heptology 199;12: Nldini L, Vign E, Brdelli A, Follenzi A, Glimi F, Comoglio PM. Biologicl ctivtion of prohgf (heptocyte growth fctor) by urokinse is controlled by stoichiometric rection. J Biol Chem 1995;27: Bottro DP, Rubin JS, Fletto DL, Chn AM, Kmiecik TE, Vnde Woude GF, Aronson SA. Identifiction of the heptocyte growth fctor receptor s the cmet protooncogene product. Science 1991;251: Kibori M, Kwon AH, Od M, Kmiym Y, Kitmur N, Okumur T. Heptocyte growth fctor stimultes synthesis of lipids nd secretion of lipoproteins in rt heptocytes. Heptology 1998; 27: Sugimoto T, Ymshit S, Ishigmi M, Ski N, Hirno K, Thr M, Mtsumoto K, Nkmur T, Mtsuzw Y. Decresed micro
Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationCompound K attenuates glucose intolerance and hepatic steatosis through AMPK-dependent pathways in type 2 diabetic OLETF rats
ORIGINAL ARTICLE Koren J Intern Med 218;33:347-355 Compound K ttenutes glucose intolernce nd heptic stetosis through AMPK-dependent pthwys in type 2 dibetic OLETF rts Yoo-Cheol Hwng 1, D-Hee Oh 1, Moon
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationCHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS
CHAPTER- 3 CHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS 3.1. INTRODUCTION The liver, hs vriety of trnsminse to synthesize nd
More informationSUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis
SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationComparison of three simple methods for the
J. clin. Pth. (1967), 2, 5 Comprison of three simple methods for the ssessment of 'free' thyroid hormone T. M. D. GIMLETTE1 From the Rdio-Isotope Lbortory, St. Thoms's Hospitl, London SYNOPSIS A dilysis
More informationSESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator?
SESSIONE I: RELATORI Ghrelin: from oroxigenic signl to metbolic mster regultor? Prof. Rocco Brzzoni Professore ssocito di Medicin Intern Università degli Studi di Trieste Ghrelin: d segnle oressizznte
More informationDietary fat source alters hepatic gene expression profile and determines the type of liver pathology in rats overfed via total enteral nutrition
Physiol Genomics 44: 173 189, 212. First published September 18, 212; doi:1.1152/physiolgenomics.69.212. Dietry ft source lters heptic gene expression profile nd determines the type of liver pthology in
More informationThe RUTHERFORD-2 trial in heterozygous FH: Results and implications
The RUTHERFORD-2 tril in heterozygous FH: Results nd implictions Slide deck kindly supplied s n eductionl resource by Professor Derick Rl MD PhD Crbohydrte & Lipid Metbolism Reserch Unit University of
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationSafety and Tolerability of Subcutaneous Sarilumab and Intravenous Tocilizumab in Patients With RA
Sfety nd Tolerbility of Subcutneous Srilumb nd Intrvenous Tocilizumb in Ptients With RA Pul Emery, 1 Jun Rondon, 2 Anju Grg, 3 Hubert vn Hoogstrten, 3 Neil M.H. Grhm, 4 Ming Liu, 4 Nncy Liu, 3 Jnie Prrino,
More informationAdult mouse model of early hepatocellular carcinoma promoted by alcoholic liver disease
University of Msschusetts Medicl School escholrship@umms Open Access Articles Open Access Publictions by UMMS Authors -8-16 Adult mouse model of erly heptocellulr crcinom promoted by lcoholic liver disese
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationBritish Journal of Pharmacology (2003) 139, & 2003 Nature Publishing Group All rights reserved /03 $
British Journl of Phrmcology (23) 139, 11 2 & 23 Nture Publishing Group All rights reserved 7 1188/3 $25. www.nture.com/bjp Inhibition of lipopolyscchride-inducible nitric oxide synthse, TNF- nd COX-2
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationMyricetin Ameliorates Defective Post-Receptor Insulin Signaling via
Evidence-Bsed Complementry nd Alterntive Medicine Volume 211, Article ID 15752, 9 pges doi:1.193/ecm/neq17 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi β-endorphin Signling in
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationnon-alcoholic liver disorders
Gut, 1986, 27, 756-764 Liver nd biliry Impired cetldehyde metbolism in ptients with non-lcoholic liver disorders K MTTHEWSON, H L MRDINI, K BRTLETT, ND C RECORD From the Gstroenterology Unit nd Deprtment
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationMyricetin Ameliorates Defective Post-Receptor Insulin Signaling via b-endorphin Signaling in the Skeletal Muscles of Fructose-Fed Rats
ecam Advnce Access published Mrch 3, 2010 ecam 2010;Pge 1 of 9 doi:10.1093/ecm/neq017 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi b-endorphin Signling in the Skeletl Muscles
More informationCombined high-fat diet and sustained high sucrose consumption promotes NAFLD in a murine model
ORIGINAL ARTICLE July-August, Vol. 14 No. 4, 215: 54-546 Combined high-ft diet nd sustined high sucrose consumption promotes NAFLD in murine model Gonzlo Torres-Villlobos,*, Nshl Hmdn-Pérez,* Armndo R.
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationRole of Grape Seed Proanthocyanidins in the Suppression of High Calorie Diet-Induced Hepatic Injury and Apoptosis
Interntionl Journl of Science nd Reserch (IJSR), Indi Online ISSN: 2319-7064 Role of Grpe Seed Pronthocynidins in the Suppression of High Clorie Diet-Induced Heptic Injury nd Apoptosis Bskrn Yoglkshmi
More informationSoybean Hulls as an Alternative Feed for Horses
Animl Industry Report AS 650 ASL R1931 2004 Soyben Hulls s n Alterntive Feed for Horses Josie Booth Iow Stte University Howrd Tyler Iow Stte University Peggy Miller-Auwerd Iow Stte University Jenette Moore
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationHypoglycemic Activity of Polygala erioptera (Whole Plant) in Normal and Alloxan Induced Diabetic Rats
Asin Journl of Chemistry Vol. 20, No. 1 (2008), 107-112 Hypoglycemic Activity of Polygl eriopter (Whole Plnt) in Norml nd Alloxn Induced Dibetic Rts G. SAMMAIAH* nd R.S. SRIVASTAVA Deprtment of Phrmceutics,
More informationEfficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis
Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationUlinastatin reduces urinary sepsis related inflammation by upregulating IL 10 and downregulating TNF α levels
MOLECULAR MEDICINE REPORTS 8: 29-34, 2013 Ulinsttin reduces urinry sepsis relted inflmmtion by upregulting IL 10 nd downregulting TNF α levels XIAN CHEN 1*, YI WANG 1*, HONGMEI LUO 2, ZHIGANG LUO 1, LISHA
More informationNorthern blot analysis
Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C 5 2 4 1 um C 5 2 4 1 um Angus dipocytes expressed SCD higher thn Wgyu dipocyte
More informationRecent advances in cryopreservation od salmonid fish semen. Andrzej Ciereszko
Recent dvnces in cryopreservtion od slmonid fish semen Andrzej Ciereszko Institute of Animl Reproduction nd Food Reserch, Polish Acdemy of Sciences in Olsztyn, Polnd Justifiction for the studies Poor performnce
More informationOriginal Article INTRODUCTION. Diabetes Metab J 2011;35: pissn eissn
Originl rticle Dibetes Metb J 2011;35:489-496 http://dx.doi.org/10.4093/dmj.2011.35.5.489 pissn 2233-6079 eissn 2233-6087 D I E T E S & M E T O L I S M J O U R N L Dietry Olete Hs eneficil Effects on Every
More informationInhibition of adipocyte differentiation in 3T3-L1 cell line by quercetin or isorhamnetin
Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2012 Inhibition of dipocyte differentition in 3T3-L1 cell line by quercetin or isorhmnetin Din Gbriel Crvjl-Aldz Louisin Stte
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationScientific research on the biological value of olive oil
Scientific reserch on the biologicl vlue olive oil Cov F.G. Ally M. (ed.). L' économie de l' olivier Pr : CIHEAM Options Méditerrnéennes : Série Etudes; n. 1988-V 1988 pges 149-152 Article vilble on le
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationphosphatase isoenzyme activity: estimation of
J Clin Pthol 1988;41:202-206 Quntittive method for determining serum lkline phosphtse isoenzyme ctivity: estimtion of intestinl component M J PEAKE, M PEJAKOVIC, G H WHITE From the Deprtment ofbiochemistry
More informationPrimers used for real time qpcr
Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199
More informationAnalysis of Regulatory of Interrelated Activity of Hepatocyte and Hepatitis B Viruses
Interntionl Journl of Biomedicl Mterils Reserch 8 6(): -7 http://www.sciencepublishinggroup.com/j/ijbmr doi:.648/j.ijbmr.86. ISSN: 33-756 (Print) ISSN: 33-7579 (Online) Anlysis of Regultory of Interrelted
More informationHepatitis A virus (HAV) infection contributes approximately
Multiple Fctors Contribute to Positive Results for Heptitis A Virus Immunoglobulin M Antibody Adnn Altoom, MD, PhD; M. Qsim Ansri, MD; Jennifer Cuthbert, MD Context. In the United Sttes, successful vccintion
More informationRole of hydroxytyrosol in ameliorating effects of high fat
Role of hydroxytyrosol in meliorting effects of high ft diet on mle rts CNS Hyder A. N. Al-Zmely, Zen Shkir Mhmoud Al -Tmemi Dept. of physiology nd biochemistry, College of veterinry Medicine, AL-Qssim
More informationA. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5
Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationDiabetes mellitus secondary to pancreatic diseases (type 3c): The effect of smoking on the exocrine endocrine interactions of the pancreas
764062DVR0010.1177/1479164118764062Dibetes & Vsculr Disese ReserchŚliwińsk-Mossoń et l. reserch-rticle2018 Originl Article Dibetes mellitus secondry to pncretic diseses (type 3c): The effect of smoking
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationPrognostic significance of pretreatment serum levels of albumin, LDH and total bilirubin in patients with nonmetastatic
Crcinogenesis, 2015, Vol. 36, No. 2, 243 248 doi:10.1093/crcin/bgu247 Advnce Access publiction December 18, 2014 Originl Mnuscript originl mnuscript Prognostic significnce of pretretment serum levels of
More informationProtective effect of rosuvastatin treatment by regulating oxidized low-density lipoprotein expression in a rat model of liver fibrosis
BIOMEDICAL REPORTS 5: 311-316, 2016 Protective effect of rosuvsttin tretment by regulting oxidized low-density lipoprotein expression in rt model of liver fibrosis SHUIPING YU 1, XUELING ZHOU 1, BINGZONG
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,
DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,
More informationRandomized Controlled Trial to Improve Adiposity, Inflammation, and Insulin Resistance in Obese African-American and Latino Youth
nture publishing group rticles Rndomized Controlled Tril to Improve Adiposity, Inflmmtion, nd Insulin Resistnce in Obese -Americn nd Ltino Youth Rebecc E. Hsson 1, Tnj C. Adm 1, Jimie N. Dvis 1, Louise
More informationCyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK
3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α
More informationThe nuclear receptor FXR, but not LXR, up-regulates bile acid transporter expression in non-alcoholic fatty liver disease
ORIGINAL ARTICLE July-August, Vol. 14 No. 4, 2015: 487-493 The nucler receptor FXR, but not LXR, up-regultes bile cid trnsporter expression in non-lcoholic ftty liver disese Nncy E. Aguilr-Olivos, Dniel
More informationGDF11 Protects against Endothelial Injury and Reduces Atherosclerotic Lesion Formation in Apolipoprotein E-Null Mice
originl rticle The Americn Society of Gene & Cell Therpy Protects ginst Endothelil Injury nd Reduces Atherosclerotic Lesion Formtion in Apolipoprotein E-Null Mice Wen Mei, Gungd Xing, Yixing Li 2, Hun
More informationXII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV
XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationEffect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows
Ksetsrt J. (Nt. Sci.) 37 : 145-149 (2003) Effect of Orl Administrtion of Propylene Glycol on Serum Glucose Concentrtions in Periprturient Diry Cows Theer Rukkwmsuk, Nrongpol Petploi, Ing-orn Preechnvinit,
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationDIETARY FOOD FORTIFIED WITH OROTIC ACID AND LIVER FUNCTION
MAKARA, SAINS, VOL. 15, NO. 2, NOVEMBER 211: 11-15 DIETARY FOOD FORTIFIED WITH OROTIC ACID AND LIVER FUNCTION Yohnes Bung Deprtment of Chemistry, Fculty of Science nd Engineering, Nus Cendn University,
More informationActivation of Skeletal Muscle Casein Kinase 11 by Insulin is not Diminished in Subjects with Insulin Resistance
Activtion of Skeletl Muscle Csein Kinse 11 by Insulin is not Diminished in Subjects with Insulin Resistnce Ryo Med, Itmr Rz, Frncesco Zurlo, nd Jmes Sommercorn Clinicl Dibetes nd Nutrition Section, Ntionl
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationCME/SAM. Study on Hyperuricemia in HBV-Associated Glomerulonephritis
AJCP / Originl Article Study on Hyperuricemi in HBV-Associted Glomerulonephritis Yongze Zhung, MD, PhD, 1 Yingho Yu, MD, PhD, 2 Yingfng Hung, MD, 3 nd Xiorong Zhong, MD 1 From the 1 Deprtment of Nephrology,
More informationThyroid hormone attenuates and augments hepatic gene expression
Proc. Ntl Acd. Sci. USA Vol. 78, No. 8, pp. 4733-4737, August 1981 Biochemistry Thyroid hormone ttenutes nd ugments heptic gene expression t pretrnsltionl level (triiodothyronine/heptic mrna/two-dimensionl
More informationThe potential future of targeted radionuclide therapy: implications for occupational exposure? P. Covens
The potentil future of trgeted rdionuclide therpy: implictions for occuptionl exposure? Introduction: Trgeted Rdionuclide Therpy (TRT) Systemic tretment Molecule lbelled with rdionuclide delivers toxic
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationJournal of Hainan Medical University 2017; 23(2): Journal of Hainan Medical University.
Journl of Hinn Medicl University 2017; 23(2): 151-155 151 Journl of Hinn Medicl University http://www.hnykdxxb.com Reltionship between DEXA bone minerl density mesurement results nd serum cytokines s well
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationMartinez-Rubio et al. BMC Genomics 2014, 15:462
Mrtinez-Rubio et l. BMC Genomics 2014, 15:462 RESEARCH ARTICLE Open Access Effects of functionl feeds on the lipid composition, trnscriptomic responses nd pthology in hert of Atlntic slmon (Slmo slr L.)
More information