Inhibition of Serotonin Synthesis Induces Negative Hepatic Lipid Balance

Transcription

1 Originl Article Obesity nd Metbolic Syndrome Dibetes Metb J Published online Apr 5, 8 pissn -679 eissn -687 DIABETES & METABOLISM JOURNAL Inhibition of Serotonin Synthesis Induces Negtive Heptic Lipid Blnce Jun Nmkung,, Ko Eun Shong,, Hyeongseok Kim, Chng-Myung Oh, Sngkyu Prk,, Hil Kim, Grdute School of Medicl Science nd Engineering, Kore Advnced Institute of Science nd Technology, Dejeon, Deprtment of Biochemistry, Yonsei University Wonju College of Medicine, Wonju, Biomedicl Science nd Engineering Interdisciplinry Progrm, Kore Advnced Institute of Science nd Technology, Dejeon, Deprtment of Biochemistry, Ctholic Kwndong University College of Medicine, Gngneung, Kore Bckground: Heptic stetosis is cused by metbolic stress ssocited with positive lipid blnce, such s insulin resistnce nd obesity. Previously we hve shown the nti-obesity effects of inhibiting serotonin synthesis, which eventully improved insulin sensitivity nd heptic stetosis. However, it is not cler whether serotonin hs direct effect on heptic lipid ccumultion. Here, we showed the possibility of direct ction of serotonin on heptic stetosis. Methods: Mice were treted with pr-chlorophenyllnine (PCPA) or LP-5 to inhibit serotonin synthesis nd fed with high ft diet () or high crbohydrte diet (HCD) to induce heptic stetosis. Heptic triglyceride content nd gene expression profiles were nlyzed. Results: Phrmcologicl nd genetic inhibition of serotonin synthesis reduced -induced heptic lipid ccumultion. Furthermore, short-term PCPA tretment prevented HCD-induced heptic stetosis without ffecting glucose tolernce nd browning of subcutneous dipose tissue. Gene expression nlysis reveled tht the expressions of genes involved in de novo lipogenesis nd tricylglycerol synthesis were downregulted by short-term PCPA tretment s well s long-term PCPA tretment. Conclusion: Short-term inhibition of serotonin synthesis prevented heptic lipid ccumultion without ffecting systemic insulin sensitivity nd energy expenditure, suggesting the direct stetogenic effect of serotonin in liver. Keywords: Dibetes mellitus; Ftty liver; Lipogenesis; Obesity; Serotonin INTRODUCTION Nonlcoholic ftty liver disese (NAFLD) is common liver disese nd occurs due to the lipid ccumultion in the liver. It is excerbted from stetosis through stetoheptitis to cirrhosis nd heptocellulr crcinom [,]. NAFLD is closely ssocited with obesity, which induces positive heptic lipid blnce leding to lipid ccumultion nd pthologicl metbolic disturbnces in the liver [-5]. Becuse excessive energy intke leds to positive lipid blnce nd obesity, regultion of systemic energy metbolism is possible therpeutic pproch ginst NAFLD [6-8]. Serotonin (5-hydroxytryptmine) is neurotrnsmitter involved in the regultion of mood, ppetite, nd stress responses in the brin [9]. Recently, peripherl serotonin is emerging s regultor of systemic energy homeostsis. Peripherl serotonin system is functionlly seprted from centrl serotonin system becuse serotonin cnnot cross blood brin brrier (BBB) []. Serum level of serotonin ws elevted in mice fed high ft diet () []. Incresing systemic serotonin ctivity by knock- Corresponding uthors: Sngkyu Prk Deprtment of Biochemistry, Ctholic Kwndong University College of Medicine, Beomil-ro 579beon-gil, Gngneung 56, Kore E-mil: 9prk@cku.c.kr Hil Kim Grdute School of Medicl Science nd Engineering, Kore Advnced Institute of Science nd Technology, 9 Dehk-ro, Yuseong-gu, Dejeon, Kore E-mil: hilkim@kist.edu Received: Nov. 9, 7; Accepted: Feb., 8 This is n Open Access rticle distributed under the terms of the Cretive Commons Attribution Non-Commercil License ( which permits unrestricted non-commercil use, distribution, nd reproduction in ny medium, provided the originl work is properly cited. Copyright 8 Koren Dibetes Assocition pge of

2 Nmkung J, et l. ing out serotonin trnsporter cused severe obesity, insulin resistnce, nd heptic stetosis [,]. Inhibition of serotonin synthesis in periphery reduced obesity by incresing energy expenditure nd decresing energy storge [,5]. Genetic inhibition of tryptophn hydroxylse (Tph), rte-limiting enzyme for serotonin synthesis in periphery, in dipose tissues resulted in the insulin-sensitizing nd nti-obesity effects by incresing energy expenditure []. Thus, peripherl serotonin works s n obesity hormone which leds to positive energy nd lipid blnce. Most of body serotonin is synthesized nd secreted from enterochromffin cells in the gut. Since gut-derived serotonin (GDS) which is relesed from gut is stored in pltelets or metbolized in liver, plsm free serotonin level in peripherl blood is very low. However, considering tht liver is the first orgn encountering GDS vi portl vein nd free serotonin levels in portl blood is reltively higher, liver cn be the trget of GDS. Although inhibition of serotonin synthesis in peripherl tissues reduced heptic lipid ccumultion [5], it hs not been tested if serotonin hs direct effects on liver. In this study, we explored the functionl reltionship between heptic stetosis nd serotonin by using phrmcologicl nd genetic models of serotonin inhibition nd hve shown tht serotonin hs direct effects on heptic lipid ccumultion. METHODS Animl experiments The experimentl protocol for this study ws pproved by the Institutionl Animl Cre nd Use Committee t the Kore Advnced Institute of Science nd Technology (KA-9). Tph floxed (Tph fl/fl ) mice [6] were crossed with Adiponectin-Cre mice [7] to generte ft-specific Tph-knockout (Tph FKO). 5-Hydroxytryptmine receptor A (Htr) knockout (KO) mice (B6.9X-Htr tmjul/j ) were purchsed from the Jckson Lbortory (Br Hrbor, ME, USA). Sequences of primers used in mouse genotyping re given in Tble. C57BL/6J mice were purchsed from the Chrles River Jpn (Yokohm, Jpn). Mice were housed on -hour light-drk cycle in climte controlled specific pthogen-free brrier fcility. Diet nd wter were provided d libitum. At 8 or weeks of ge, mice were fed stndrd chow diet (), (6% ft clories), or high crbohydrte diet (HCD, 7% crbohydrte clories). Animl diets used in this study were purchsed from Reserch Diets (New Brunswick, NJ, USA). Pr-chlorophenyllnine (PCPA, Sigm-Aldrich, St. Louis, MO, USA) ws dissolved in phosphte-buffered sline (PBS). PBS or mg/kg PCPA ws dily dministered by intrperitonel injection. LP-5 (Dlton Phrm Services, Toronto, ON, Cnd) ws dissolved in polyethylene glycol (Sigm-Aldrich) nd 5% dextrose (:6 v/v). or mg/kg LP-5 ws dministered dily by orl gvge. Histologicl nlysis Preprtion of tissue sections nd H&E stining were performed s previously described [8,9]. Liver tissues nd inguinl white dipose tissues were hrvested, fixed in % (w/v) prformldehyde nd embedded in prffin. Five-µm-thick tissue sections were deprffinized, rehydrted, nd stined with H&E. Quntifiction of heptic triglyceride levels Liver tissues were homogenized using FstPrep- (MP Biomedicls, Snt An, CA, USA) in 5% nonyl phenoxypolyethoxylethnol (NP-; Sigm-Aldrich). Aliquot of homogentes were used for mesurement of protein concentrtions Tble. Sequences of primers used in mouse genotyping Mouse Primers (5 to ) Product size, bp Tph fl/fl Adiponectin-Cre Htr KO GGATCCTAACCGAGTGTTCC GCACACCACCAACTCTTTCC TGCCATGTGAGTCTGCCTTT AACCAGCGTTTTCGTTCTGC TGGATGTGGAATGTGTGCGAG AACAGCTATGCAGAAATGAAGTT GGCTGACTGCGTAGAATAAAGG Tph fl/fl, tryptophn hydroxylse floxed; Htr, 5-hydroxytryptmine receptor A; KO, knockout. Wild type: 5 Floxed: 5 Cre+: 7 Wild type: Knockout: pge of Dibetes Metb J 8 Forthcoming. Posted online 8

3 Direct effects of serotonin on heptic stetosis with BCA Protein Assy Kit (Thermo Fisher Scientific, Wlthm, MA, USA). The remining homogentes were heted to 95 C for 5 minutes nd cooled t room temperture; this cycle ws repeted to solubilize ll heptic ft. After centrifugtion, superntnts were used for mesurement of heptic triglyceride (TG) levels. Triglyceride Regent (Sigm-Aldrich) or PBS ws dded, nd smples were incubted t 7 C for minutes to hydrolyze heptic TG into glycerol. Smples were then incubted with Free Glycerol Regent (Sigm-Aldrich) t 7 C for 5 minutes for colorimetric ssy of hydrolyzed TG levels. Differences in bsorbnce t 5 nm for hydrolyzed or non-hydrolyzed TG were quntified using glycerol stndrd. Heptic TG contents were normlized by protein mounts of liver tissues. Glucose nd insulin tolernce tests For the glucose tolernce test, overnight-fsted mice were intrperitonelly injected with g/kg D-glucose (Sigm-Aldrich) in PBS. For the insulin tolernce test,.75 U/kg humn insulin (Humulin R; Lilly, Indinpolis, IN, USA) ws intrperitonelly injected into mice fter fsting for 6 hours. Blood smples were then obtined from the til vein t, 5,, 5, 6, 9, nd minutes fter injection. Glucose concentrtions were mesured using Gluco DR Plus glucometer (Allmedicus, Anyng, Kore). Tble. Sequences of primers used in quntittive rel-time polymerse chin rection Gene Forwrd primer (5 to ) Reverse primer (5 to ) Acc CAGTAACCTGGTGAAGCTGGA GCCAGACATGCTGGATCTCAT Acly CCCTCTTCAGCCGACATACC CTGCTTGTGATCCCCAGTGA Actb GGTACCACCATGTACCCAGG GAAAGGGTGTAAAACGCAGC Agpt GCGCAATGTCGAGAACATGA TCATTCCAAGCAGGTCGAGG Apob TACTTCCACCCACAGTCCCCT CCTTAGAAGCCTTGGGCACAT Cd6 TGGCCAAGCTATTGCGACAT ACACAGCGTAGATAGACCTGC Cpt AGCTCGCACATTACAAGGACA CCAGCACAAAGTTGCAGGAC Dgt GGATCTGAGGTGCCATCGTC ATCAGCATCACCACACACCA Dgt CATCATCGTGGTGGGAGGTG TGGGAACCAGATCAGCTCCAT Fsn AAGCGGTCTGGAAAGCTGAA AGGCTGGGTTGATACCTCCA Gpm CCACAGAGCTGGGAAAGGTT GTGCCTTGTGTGCGTTTCAT Lpin CATACAAAGGCAGCCACACG CGGGGTTCAGTCCCTTGTAG Me GACCCGCATCTCAACAAGGA CAGGAGATACCTGTCGAAGTCA Mlxipl AAGTTGCTATGCCGGGACAA ATGACAGCCTCAGGTTTCCG Mogt TTGACCCATGGTGCCAGTTT GTGGCAAGGCTACTCCCATT Mttp TGCTTCCGTTAAAGGTCACACA CTTGCGGTTTTCCTTTGCCC Nrh GCAGGACCAGCTCCAAGTAG CCCTTCTCAGTCTGCTCCAC Pprg GGTGTGATCTTAACTGCCGGA GCCCAAACCTGATGGCATTG Pprgc GCCCAGGTACGACAGCTATG ACGGCGCTCTTCAATTGCTT Scd AGAGTCAGGAGGGCAGGTTT GAACTGGAGATCTCTTGGAGCA Srebpc GGAGCCATGGATTGCACATT GGCCCGGGAAGTCACTGT Acc, cetyl-coa crboxylse lph; Acly, ATP citrte lyse; Actb, ctin bet; Agpt, -cylglycerol--phosphte O-cyltrnsferse ; Apob, polipoprotein B; Cpt, crnitine plmitoyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Fsn, ftty cid synthse; Gpm, glycerol--phosphte cyltrnsferse; Lpin, lipin ; Me, mlic enzyme ; Mlxipl, MLX intercting protein-like (ChREBP, crbohydrte response element binding protein); Mogt, monocylglycerol O-cyltrnsferse ; Mttp, microsoml triglyceride trnsfer protein; Nrh, nucler receptor subfmily, group H, member (LXR, liver X receptor); Pprg, peroxisome prolifertor ctivted receptor gmm; Pprgc, Pprg coctivtor lph; Scd, steroyl-coa desturse ; Srebpc, sterol regultory element binding trnscription fctor c. Dibetes Metb J 8 Forthcoming. Posted online 8 pge of

4 Nmkung J, et l. Quntittive reverse trnscription polymerse chin rection nlysis TRIzol regent (Ambion, Crlsbrd, CA, USA) ws used for totl RNA extrction from hrvested tissues. To eliminte genomic DNA, RNA ws treted with TURBO DNse (Ambion). Complementry DNA ws generted with Superscript III Reverse Trnscriptse (Invitrogen, Crlsbd, CA, USA) from μg of totl RNA. Rel-time quntittive reverse trnscription polymerse chin rection ws performed with Fst SYBR Green Mster Mix (Applied Biosystems, Foster City, CA, USA) nd ViiA 7 rel-time PCR system (Applied Biosystems) ccording to the mnufcturer s instructions. Expressionl profiles were quntified bsed on the reltive delt delt Ct (threshold cycle) method [] with β-ctin s reference gene. The sequences of primers re given in Tble. Sttisticl nlysis Dt re presented s the men±stndrd error of men. The vlues were compred using Student t-test or one-wy nlysis of vrince. Differences with P vlues of less thn.5 were considered sttisticlly significnt. RESULTS Serotonin inhibition protects ginst -induced heptic stetosis In order to determine the effects of serotonin inhibition on diet-induced heptic stetosis, we used severl models of sero- PCPA LP-5 5 LP-5 TG (mg/g protein), 8 PCPA b A Tph fl/fl WT Tph FKO Htr KO TG (mg/g protein) 5 Tph fl/fl Tph FKO WT Htr KO c C D TG (mg/g protein) 6 TG (mg/g protein) B E Fig.. Serotonin inhibition protected ginst high ft diet ()-induced heptic stetosis. Eight-week-old mice were fed stndrd chow diet () or for weeks with vehicle, pr-chlorophenyllnine (PCPA), or LP-5 tretment. (A) H&E stining of liver sections from - or -fed mice with vehicle or PCPA tretment. (B) Quntifiction of heptic triglyceride (TG) levels in PCPA-treted mice (n=6). (C-E) H&E stining of liver sections (left) nd quntifiction of heptic TG levels (right) from -fed mice treted with LP-5 (C), ft-specific Tph-knockout (Tph FKO) mice (D), nd 5-hydroxytryptmine receptor A (Htr) knockout (KO) mice (E) (n=6). Representtive imges re shown. Scle brs, 5 μm. Tph fl/fl, tryptophn hydroxylse floxed. P<.5, b P<., c P<.. pge of Dibetes Metb J 8 Forthcoming. Posted online 8

5 Direct effects of serotonin on heptic stetosis tonin inhibition on. Phrmcologiclly, serotonin synthesis cn be blocked by Tph inhibitor, PCPA, or LP-5, which trgets the rte-limiting step of serotonin synthesis. Firstly, we exmined the livers of mice fed n nd treted with PCPA. Histologicl nlysis reveled tht -induced heptic stetosis ws blocked by PCPA tretment (Fig. A). Accordingly, heptic TG content ws significntly decresed by PCPA tretment (Fig. B). PCPA cn cross BBB nd is known to increse food intke by inhibiting serotonin production in the brin []. To further confirm the effects of peripherl serotonin inhibition, we investigted the effect of LP- 5, peripherl Tph inhibitor which cnnot cross the BBB, on heptic stetosis []. Similr to the results with PCPA, LP-5 lso decresed -induced heptic TG ccumultion (Fig. C). We lso tested Tph FKO nd Htr KO mice, which exhibit incresed energy expenditure on []. Heptic TG content ws decresed in the liver of both Tph FKO nd Htr KO mice (Fig. D nd E). Thus, inhibition of peripherl serotonin either by decresed synthesis or reduced ctivity, protects from -induced heptic stetosis. PCPA blocks positive heptic lipid blnce on Heptic stetosis results from positive heptic lipid blnce, which occurs through integrtion of mjor five components: de novo lipogenesis, TG synthesis, ftty cid (FA) uptke, FA oxidtion, nd very low density lipoprotein (VLDL) secretion [,]. Ech component is gin determined by the mount of substrte, llosteric regultion by metbolites, nd mount nd ctivity of enzymes of their pthwys. To identify the components regulted by serotonin, we investigted gene expression profiles of enzymes involved in heptic lipid metbolism. PCPA decresed the expression of most genes relted to de novo lipogenesis, TG synthesis, nd FA uptke (Fig. A-C). Thus, PCPA blocks the induction of positive heptic lipid blnce by. In contrst, the expression of genes involved in FA oxidtion nd VLDL secretion ws not chnged by PCPA tretment (Fig. D nd E). Becuse most genes in the ffected pthwy were downregulted, we hypothesized tht these chnges my reflect the regultion of upstrem trnscription fctors. Indeed, PCPA tretment decresed the expression of lipogenic trnscription fctors such s Pprg (peroxisome prolifertor ctivted receptor gmm), Nrh (Lxrα; nucler receptor subfmily, group H, member [LXR, liver X receptor]), nd Pprgc (Pprg coctivtor lph) (Fig. F). Short-term intervention of PCPA protects ginst heptic stetosis independently from energy expenditure nd insulin sensitivity The llevition of -induced heptic stetosis by PCPA could be lrgely ttributed to the decresed flux of stetogenic substrtes from dipose tissues resulting from the incresed energy expenditure in dipose tissues [,5]. In this cse, most of gene expressions in liver of mice fed with were supposed to be similr with those of mice fed with. However, some of the gene expressions were downregulted by PCPA even in liver of mice fed with. These dt strongly suggested the direct ction of serotonin on liver where severl serotonin receptors re expressed []. In order to determine the direct effects of serotonin on heptic stetosis regrdless of systemic insulin resistnce nd energy expenditure, we employed short-term intervention with n HCD nd PCPA for weeks. Notbly, the short-term HCD hd no effect on glucose tolernce (Fig. A) or insulin sensitivity (Fig. B), nd shortterm PCPA tretment did not induce beige dipogenesis in inguinl white dipose tissue (Fig. C), which is the chrcteristic of long-term intervention with PCPA []. Similr to the model, the HCD induced heptic TG ccumultion, nd PCPA decresed heptic stetosis, resulting in decresed heptic TG content (Fig. D nd E). Short-term intervention of PCPA decreses de novo lipogenesis nd TG synthesis We hve shown tht the inhibition of heptic lipid ccumultion by PCPA ws not entirely ttributed to the incresed energy expenditure in dipose tissues but to the inhibition of direct ction of serotonin on liver. In order to know more precise mechnism of serotonin on heptic lipid ccumultion, we checked gene expression profiles of lipid metbolism in the livers of PCPA-treted mice. Among components of heptic lipid blnce, genes of de novo lipogenesis nd TG synthesis were upregulted by HCD, which were reversed by PCPA (Fig. A nd B), similr to the results in -fed PCPA-treted mice. However, there were no chnges in genes encoding components of FA uptke, FA oxidtion, nd VLDL secretion (Fig. C-E). Becuse lipogenic genes were downregulted, we lso investigted upstrem trnscription fctors. Expression levels of Pprg, Srebpc (sterol regultory element binding trnscription fctor c), nd Mlxipl (MLX intercting protein-like [Chrebp, crbohydrte response element binding protein]), which re lipogenic trnscription fctors, were significntly decresed Dibetes Metb J 8 Forthcoming. Posted online 8 pge 5 of

6 Nmkung J, et l. Reltive expression Reltive expression..5 Acc Gpm b b b Fsn Agpt..5 Acly b Lpin Me c Mogt b Scd Dgt A..5 PCPA Dgt B. Cd6 Cpt Mttp Apob Reltive expression..5 Reltive expression Reltive expression C D Pprg Pprgc Srebpc Mlxipl Nrh 8. 6 b b E Reltive expression..5 b F Fig.. Pr-chlorophenyllnine (PCPA) tretment suppressed the positive heptic lipid blnce. Eight-week-old mice were fed stndrd chow diet () or high ft diet () for weeks nd treted with vehicle or PCPA tretment. Heptic expressionl profiles of genes relted to de novo lipogenesis (A), triglyceride synthesis (B), ftty cid (FA) uptke (C), FA oxidtion (D), very low density lipoprotein secretion (E), nd trnscription fctors (F) were ssessed by quntittive reverse trnscription polymerse chin rection (n=6). Acc, cetyl-coa crboxylse lph; Fsn, ftty cid synthse; Acly, ATP citrte lyse; Me, mlic enzyme ; Scd, steroyl-coa desturse ; Gpm, glycerol--phosphte cyltrnsferse; Agpt, -cylglycerol--phosphte O-cyltrnsferse ; Lpin, lipin ; Mogt, monocylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Cpt, crnitine plmitoyltrnsferse ; Mttp, microsoml triglyceride trnsfer protein; Apob, polipoprotein B; Pprg, peroxisome prolifertor ctivted receptor gmm; Pprgc, Pprg coctivtor lph; Srebpc, sterol regultory element binding trnscription fctor c; Mlxipl, MLX intercting protein-like (ChREBP, crbohydrte response element binding protein); Nrh, nucler receptor subfmily, group H, member (LXR, liver X receptor). P<.5, b P<., c P<.. pge 6 of Dibetes Metb J 8 Forthcoming. Posted online 8

7 Direct effects of serotonin on heptic stetosis Glucose (mg/dl) HCD HCD+PCPA PCPA Time (min) A Glucose (% of initil) HCD HCD+PCPA C Time (min) B PCPA TG (mg/g protein) 8 6 HCD HCD+PCPA E D Fig.. Short-term tretment with pr-chlorophenyllnine (PCPA) in the context of high crbohydrte diet (HCD) protected ginst heptic stetosis independently from energy expenditure nd insulin sensitivity. Twelve-week-old mice were fed stndrd chow diet () or HCD for weeks nd treted with vehicle or PCPA tretment. Intrperitonel glucose tolernce tests (A) nd insulin tolernce tests (B) were performed (n=). (C) H&E stining of inguinl white dipose tissue sections from HCD-fed mice with vehicle or PCPA tretment. (D) H&E stining of liver sections from - or HCD-fed mice with vehicle or PCPA tretment. (E) Quntifiction of heptic triglyceride levels in PCPA-treted mice (n=6). Representtive imges re shown. Scle brs, 5 μm. P<.5. (Fig. F). Collectively, these dt suggested tht PCPA induced negtive heptic lipid blnce by decresing de novo lipogenesis nd TG synthesis vi downregultion of lipogenic trnscription fctors independently from insulin sensitivity nd energy expenditure. Dibetes Metb J 8 Forthcoming. Posted online 8 pge 7 of

8 Nmkung J, et l. Reltive expression...5 Acc Fsn...5 Acly..5 Me Scd HCD HCD+PCPA A Reltive expression Gpm...5 Agpt b...5 Lpin...5 Mogt..5 Dgt..5 Dgt B Cd6 Cpt Apob. Mttp Reltive expression..5 Reltive expression..5 Reltive expression C D E Reltive expression..5 Pprg Pprgc Srebpc Mlxipl Nrh F Fig.. Pr-chlorophenyllnine (PCPA) tretment suppressed the positive heptic lipid blnce vi downregultion of Pprg, Srebpc, nd Mlxipl. Twelve-week-old mice were fed stndrd chow diet () or high crbohydrte diet (HCD) for weeks with vehicle or PCPA tretment. Heptic expressionl profiles of genes relted to de novo lipogenesis (A), triglyceride synthesis (B), ftty cid (FA) uptke (C), FA oxidtion (D), very low density lipoprotein secretion (E), nd trnscription fctors (F) were ssessed by quntittive reverse trnscription polymerse chin rection (n=6). Acc, cetyl-coa crboxylse lph; Fsn, ftty cid synthse; Acly, ATP citrte lyse; Me, mlic enzyme ; Scd, steroyl-coa desturse ; Gpm, glycerol--phosphte cyltrnsferse; Agpt, -cylglycerol--phosphte O-cyltrnsferse ; Lpin, lipin ; Mogt, monocylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Cpt, crnitine plmitoyltrnsferse ; Apob, polipoprotein B; Mttp, microsoml triglyceride trnsfer protein; Pprg, peroxisome prolifertor ctivted receptor gmm; Pprgc, Pprg coctivtor lph; Srebpc, sterol regultory element binding trnscription fctor c; Mlxipl, MLX intercting protein-like (ChREBP, crbohydrte response element binding protein); Nrh, nucler receptor subfmily, group H, member (LXR, liver X receptor). P<.5, b P<.. pge 8 of Dibetes Metb J 8 Forthcoming. Posted online 8

9 Direct effects of serotonin on heptic stetosis DISCUSSION, HCD, nd ethnol intke re known to induce ftty liver both in humn nd rodent. These metbolic stresses induce positive lipid blnce in the liver either by incresing de novo lipogenesis nd FA uptke or decresing FA oxidtion nd VLDL secretion. The ltertion of lipid blnce cn be induced by insulin resistnce which induces upregultion of lipogenic gene expressions nd incresed the flux of stetogenic substrtes, free FAs on liver []. In this study, we found tht phrmcologicl or genetic inhibition of serotonin production llevited heptic stetosis nd decresed heptic TG ccumultion in - or HCD-induced heptic stetosis models. PCPA is known to irreversibly inhibit Tph, the rte-limiting enzyme in serotonin synthesis, nd led to systemic serotonin depletion [5-7]. Serotonin is known to exert its norexigenic effects vi Htrc in the centrl nervous system [8]. Thus intrcrnil injection of PCPA increses food intke nd obesity []. In contrst, intrperitonel injection of PCPA exerts ntiobesity effects independently from food intke []. Thus, peripherl serotonin system is functionlly s well s ntomiclly seprted from centrl serotonin system on metbolism. We found tht both systemic inhibition of serotonin production by PCPA nd selective inhibition of peripherl serotonin production by LP-5 suppressed -induced heptic ftty chnges. Therefore, peripherl serotonin is thought be involved in diet-induced heptic stetosis. Gene expression profiles of heptic lipid metbolism showed tht PCPA suppressed the -induced positive heptic lipid blnce by downregultion of genes involved in de novo lipogenesis, TG synthesis, nd FA uptke, s in previous study of white dipose tissue []. Becuse insulin resistnce increses heptic stetosis [9] nd PCPA meliortes insulin resistnce in the context of n [], the nti-stetotic effects of PCPA my reflect both the direct effects of decresed serotonin to heptic serotonin receptors nd the indirect effects on other orgns, such s dipose tissue nd skeletl muscle. To identify the direct effects of serotonin, we used short-term intervention with PCPA with n HCD. Similr to the results in the -fed model, PCPA could prevent HCD-induced heptic stetosis. This mechnism ws independent from energy expenditure nd insulin sensitivity. Thus, serotonin could directly regulte heptic lipid metbolism. We found decresed expressions of genes ssocited with de novo lipogenesis nd TG synthesis by short-term intervention with PCPA, including downregultion of Mlxipl (crbohydrte-responsive element-binding protein), mjor lipogenic trnscription fctor tht functions in response to high glucose [], s well s lipogenic Srebpc nd Pprg []. Together with other reports tht serotonin incresed ft content in primry heptocytes [,], our dt strongly suggested tht serotonin cn be direct lipogenic stimulus in the liver vi regultion of lipogenic trnscription fctors, s hs been observed in dipose tissue. Although custive serotonin receptor nd its signling pthwy re not identified, we show the direct ction of serotonin on heptic lipid metbolism. Models of serotonin inhibition showed nti-stetogenic effects on diet-induced heptic stetosis (Fig. ), but these re sum of direct effects from decresed heptic serotonin ction nd indirect effects from incresed energy expenditure nd enhnced insulin sensitivity. We tried to distinguish those two mechnisms, nd found tht short-term intervention of PCPA tretment on HCD didn t chnge energy expenditure nd insulin sensitivity. Thus we firstly identified direct effects of serotonin inhibition on liver in vivo. Additionl studies using liver-specific serotonin receptor knockout re required to elucidte the detiled mechnism how serotonin signling is ssocited with diet-induced heptic stetosis. Selective modultion of serotonin pthwy might introduce new therpeutic pproch ginst heptic stetosis. CONFLICTS OF INTEREST No potentil conflict of interest relevnt to this rticle ws reported. ACKNOWLEDGMENTS We thnk ll the members of the Integrted Lb of Metbolism, Obesity, nd Dibetes (imod) t KAIST for their helpful discussions nd technicl support. This work ws supported by grnt from the Koren Dibetes Assocition (grnt number: 7S- to Jun Nmkung) nd grnts from the Ntionl Reserch Foundtion of Kore (NRF) funded by Ministry of Science, ICT & Future Plnning (grnt numbers: NRF-MA9 D86 to Hil Kim nd NRF-6RCB688 to Jun Nmkung). REFERENCES. Frrell GC, Lrter CZ. Nonlcoholic ftty liver disese: from Dibetes Metb J 8 Forthcoming. Posted online 8 pge 9 of

10 Nmkung J, et l. stetosis to cirrhosis. Heptology 6;( Suppl ):S99-.. Bffy G, Brunt EM, Cldwell SH. Heptocellulr crcinom in non-lcoholic ftty liver disese: n emerging mence. J Heptol ;56:8-9.. Adms LA, Wters OR, Knuimn MW, Elliott RR, Olynyk JK. NAFLD s risk fctor for the development of dibetes nd the metbolic syndrome: n eleven-yer follow-up study. Am J Gstroenterol 9;: Kwno Y, Cohen DE. Mechnisms of heptic triglyceride ccumultion in non-lcoholic ftty liver disese. J Gstroenterol ;8:-. 5. Tchernof A, Despres JP. Pthophysiology of humn viscerl obesity: n updte. Physiol Rev ;9: Glgni J, Rvussin E. Energy metbolism, fuel selection nd body weight regultion. Int J Obes (Lond) 8; Suppl 7:S Golbi P, Bush H, Younossi ZM. Tretment strtegies for nonlcoholic ftty liver disese nd nonlcoholic stetoheptitis. Clin Liver Dis 7;: Smuel VT, Shulmn GI. Nonlcoholic ftty liver disese s nexus of metbolic nd heptic diseses. Cell Metb 8;7: Berger M, Gry JA, Roth BL. The expnded biology of serotonin. Annu Rev Med 9;6: Wtnbe H, Rose MT, Aso H. Role of peripherl serotonin in glucose nd lipid metbolism. Curr Opin Lipidol ;: Kim HJ, Kim JH, Noh S, Hur HJ, Sung MJ, Hwng JT, Prk JH, Yng HJ, Kim MS, Kwon DY, Yoon SH. Metbolomic nlysis of livers nd serum from high-ft diet induced obese mice. J Proteome Res ;:7-.. Chen X, Mrgolis KJ, Gershon MD, Schwrtz GJ, Sze JY. Reduced serotonin reuptke trnsporter (SERT) function cuses insulin resistnce nd heptic stetosis independent of food intke. PLoS One ;7:e5.. Uceyler N, Schutt M, Plm F, Vogel C, Meier M, Schmitt A, Lesch KP, Mossner R, Sommer C. Lck of the serotonin trnsporter in mice reduces locomotor ctivity nd leds to genderdependent lte onset obesity. Int J Obes (Lond) ;:7-.. Oh CM, Nmkung J, Go Y, Shong KE, Kim K, Kim H, Prk BY, Lee HW, Jeon YH, Song J, Shong M, Ydv VK, Krsenty G, Kjimur S, Lee IK, Prk S, Kim H. Regultion of systemic energy homeostsis by serotonin in dipose tissues. Nt Commun 5;6: Crne JD, Plnivel R, Mottillo EP, Bujk AL, Wng H, Ford RJ, Collins A, Blumer RM, Fullerton MD, Ybut JM, Kim JJ, Ghi JE, Hmz SM, Morrison KM, Schertzer JD, Dyck JR, Khn WI, Steinberg GR. Inhibiting peripherl serotonin synthesis reduces obesity nd metbolic dysfunction by promoting brown dipose tissue thermogenesis. Nt Med 5;: Ydv VK, Ryu JH, Sud N, Tnk KF, Gingrich JA, Schutz G, Glorieux FH, Ching CY, Zjc JD, Insogn KL, Mnn JJ, Hen R, Ducy P, Krsenty G. Lrp5 controls bone formtion by inhibiting serotonin synthesis in the duodenum. Cell 8;5: Eguchi J, Wng X, Yu S, Kershw EE, Chiu PC, Dushy J, Estll JL, Klein U, Mrtos-Flier E, Rosen ED. Trnscriptionl control of dipose lipid hndling by IRF. Cell Metb ;: Fischer AH, Jcobson KA, Rose J, Zeller R. Cutting sections of prffin-embedded tissues. CSH Protoc 8;8:pdb. prot Fischer AH, Jcobson KA, Rose J, Zeller R. Hemtoxylin nd eosin stining of issue nd cell sections. CSH Protoc 8;8: pdb.prot986.. Livk KJ, Schmittgen TD. Anlysis of reltive gene expression dt using rel-time quntittive PCR nd the (-delt delt C (T)) Method. Methods ;5:-8.. Breisch ST, Zemln FP, Hoebel BG. Hyperphgi nd obesity following serotonin depletion by intrventriculr p-chlorophenyllnine. Science 976;9:8-5.. Liu Q, Yng Q, Sun W, Vogel P, Heydorn W, Yu XQ, Hu Z, Yu W, Jons B, Pined R, Clderon-Gy V, Germnn M, O Neill E, Brommge R, Cullinn E, Pltt K, Wilson A, Powell D, Snds A, Zmbrowicz B, Shi ZC. Discovery nd chrcteriztion of novel tryptophn hydroxylse inhibitors tht selectively inhibit serotonin synthesis in the gstrointestinl trct. J Phrmcol Exp Ther 8;5: Mrchesini G, Pett S, Dlle Grve R. Diet, weight loss, nd liver helth in nonlcoholic ftty liver disese: pthophysiology, evidence, nd prctice. Heptology 6;6:-.. Sumr G, Sumr O, Kim JK, Krsenty G. Gut-derived serotonin is multifunctionl determinnt to fsting dpttion. Cell Metb ;6: Koe BK, Weissmn A. P-chlorophenyllnine: specific depletor of brin serotonin. J Phrmcol Exp Ther 966;5: Snders-Bush E, Sulser F. P-chloromphetmine: in vivo investigtions on the mechnism of ction of the selective depletion of cerebrl serotonin. J Phrmcol Exp Ther 97;75:9-6. pge of Dibetes Metb J 8 Forthcoming. Posted online 8

11 Direct effects of serotonin on heptic stetosis 7. Engelmn K, Lovenberg W, Sjoerdsm A. Inhibition of serotonin synthesis by pr-chlorophenyllnine in ptients with the crcinoid syndrome. N Engl J Med 967;77: Nonogki K, Strck AM, Dllmn MF, Tecott LH. Leptin-independent hyperphgi nd type dibetes in mice with mutted serotonin 5-HTC receptor gene. Nt Med 998;: Browning JD, Horton JD. Moleculr meditors of heptic stetosis nd liver injury. J Clin Invest ;:7-5.. Postic C, Dentin R, Denechud PD, Girrd J. ChREBP, trnscriptionl regultor of glucose nd lipid metbolism. Annu Rev Nutr 7;7: Pettinelli P, Videl LA. Up-regultion of PPAR-gmm mrna expression in the liver of obese ptients: n dditionl reinforcing lipogenic mechnism to SREBP-c induction. J Clin Endocrinol Metb ;96:-.. Rozenblit-Susn S, Chpnik N, Froy O. Metbolic effect of fluvoxmine in mouse peripherl tissues. Mol Cell Endocrinol 6;:-.. Osw Y, Knmori H, Seki E, Hoshi M, Ohtki H, Ysud Y, Ito H, Suetsugu A, Ngki M, Moriwki H, Sito K, Seishim M. L-tryptophn-medited enhncement of susceptibility to nonlcoholic ftty liver disese is dependent on the mmmlin trget of rpmycin. J Biol Chem ;86:8-8. Dibetes Metb J 8 Forthcoming. Posted online 8 pge of