Inhibition of Serotonin Synthesis Induces Negative Hepatic Lipid Balance
|
|
- Rodney Bradford
- 5 years ago
- Views:
Transcription
1 Originl Article Obesity nd Metbolic Syndrome Dibetes Metb J Published online Apr 5, 8 pissn -679 eissn -687 DIABETES & METABOLISM JOURNAL Inhibition of Serotonin Synthesis Induces Negtive Heptic Lipid Blnce Jun Nmkung,, Ko Eun Shong,, Hyeongseok Kim, Chng-Myung Oh, Sngkyu Prk,, Hil Kim, Grdute School of Medicl Science nd Engineering, Kore Advnced Institute of Science nd Technology, Dejeon, Deprtment of Biochemistry, Yonsei University Wonju College of Medicine, Wonju, Biomedicl Science nd Engineering Interdisciplinry Progrm, Kore Advnced Institute of Science nd Technology, Dejeon, Deprtment of Biochemistry, Ctholic Kwndong University College of Medicine, Gngneung, Kore Bckground: Heptic stetosis is cused by metbolic stress ssocited with positive lipid blnce, such s insulin resistnce nd obesity. Previously we hve shown the nti-obesity effects of inhibiting serotonin synthesis, which eventully improved insulin sensitivity nd heptic stetosis. However, it is not cler whether serotonin hs direct effect on heptic lipid ccumultion. Here, we showed the possibility of direct ction of serotonin on heptic stetosis. Methods: Mice were treted with pr-chlorophenyllnine (PCPA) or LP-5 to inhibit serotonin synthesis nd fed with high ft diet () or high crbohydrte diet (HCD) to induce heptic stetosis. Heptic triglyceride content nd gene expression profiles were nlyzed. Results: Phrmcologicl nd genetic inhibition of serotonin synthesis reduced -induced heptic lipid ccumultion. Furthermore, short-term PCPA tretment prevented HCD-induced heptic stetosis without ffecting glucose tolernce nd browning of subcutneous dipose tissue. Gene expression nlysis reveled tht the expressions of genes involved in de novo lipogenesis nd tricylglycerol synthesis were downregulted by short-term PCPA tretment s well s long-term PCPA tretment. Conclusion: Short-term inhibition of serotonin synthesis prevented heptic lipid ccumultion without ffecting systemic insulin sensitivity nd energy expenditure, suggesting the direct stetogenic effect of serotonin in liver. Keywords: Dibetes mellitus; Ftty liver; Lipogenesis; Obesity; Serotonin INTRODUCTION Nonlcoholic ftty liver disese (NAFLD) is common liver disese nd occurs due to the lipid ccumultion in the liver. It is excerbted from stetosis through stetoheptitis to cirrhosis nd heptocellulr crcinom [,]. NAFLD is closely ssocited with obesity, which induces positive heptic lipid blnce leding to lipid ccumultion nd pthologicl metbolic disturbnces in the liver [-5]. Becuse excessive energy intke leds to positive lipid blnce nd obesity, regultion of systemic energy metbolism is possible therpeutic pproch ginst NAFLD [6-8]. Serotonin (5-hydroxytryptmine) is neurotrnsmitter involved in the regultion of mood, ppetite, nd stress responses in the brin [9]. Recently, peripherl serotonin is emerging s regultor of systemic energy homeostsis. Peripherl serotonin system is functionlly seprted from centrl serotonin system becuse serotonin cnnot cross blood brin brrier (BBB) []. Serum level of serotonin ws elevted in mice fed high ft diet () []. Incresing systemic serotonin ctivity by knock- Corresponding uthors: Sngkyu Prk Deprtment of Biochemistry, Ctholic Kwndong University College of Medicine, Beomil-ro 579beon-gil, Gngneung 56, Kore E-mil: 9prk@cku.c.kr Hil Kim Grdute School of Medicl Science nd Engineering, Kore Advnced Institute of Science nd Technology, 9 Dehk-ro, Yuseong-gu, Dejeon, Kore E-mil: hilkim@kist.edu Received: Nov. 9, 7; Accepted: Feb., 8 This is n Open Access rticle distributed under the terms of the Cretive Commons Attribution Non-Commercil License ( which permits unrestricted non-commercil use, distribution, nd reproduction in ny medium, provided the originl work is properly cited. Copyright 8 Koren Dibetes Assocition pge of
2 Nmkung J, et l. ing out serotonin trnsporter cused severe obesity, insulin resistnce, nd heptic stetosis [,]. Inhibition of serotonin synthesis in periphery reduced obesity by incresing energy expenditure nd decresing energy storge [,5]. Genetic inhibition of tryptophn hydroxylse (Tph), rte-limiting enzyme for serotonin synthesis in periphery, in dipose tissues resulted in the insulin-sensitizing nd nti-obesity effects by incresing energy expenditure []. Thus, peripherl serotonin works s n obesity hormone which leds to positive energy nd lipid blnce. Most of body serotonin is synthesized nd secreted from enterochromffin cells in the gut. Since gut-derived serotonin (GDS) which is relesed from gut is stored in pltelets or metbolized in liver, plsm free serotonin level in peripherl blood is very low. However, considering tht liver is the first orgn encountering GDS vi portl vein nd free serotonin levels in portl blood is reltively higher, liver cn be the trget of GDS. Although inhibition of serotonin synthesis in peripherl tissues reduced heptic lipid ccumultion [5], it hs not been tested if serotonin hs direct effects on liver. In this study, we explored the functionl reltionship between heptic stetosis nd serotonin by using phrmcologicl nd genetic models of serotonin inhibition nd hve shown tht serotonin hs direct effects on heptic lipid ccumultion. METHODS Animl experiments The experimentl protocol for this study ws pproved by the Institutionl Animl Cre nd Use Committee t the Kore Advnced Institute of Science nd Technology (KA-9). Tph floxed (Tph fl/fl ) mice [6] were crossed with Adiponectin-Cre mice [7] to generte ft-specific Tph-knockout (Tph FKO). 5-Hydroxytryptmine receptor A (Htr) knockout (KO) mice (B6.9X-Htr tmjul/j ) were purchsed from the Jckson Lbortory (Br Hrbor, ME, USA). Sequences of primers used in mouse genotyping re given in Tble. C57BL/6J mice were purchsed from the Chrles River Jpn (Yokohm, Jpn). Mice were housed on -hour light-drk cycle in climte controlled specific pthogen-free brrier fcility. Diet nd wter were provided d libitum. At 8 or weeks of ge, mice were fed stndrd chow diet (), (6% ft clories), or high crbohydrte diet (HCD, 7% crbohydrte clories). Animl diets used in this study were purchsed from Reserch Diets (New Brunswick, NJ, USA). Pr-chlorophenyllnine (PCPA, Sigm-Aldrich, St. Louis, MO, USA) ws dissolved in phosphte-buffered sline (PBS). PBS or mg/kg PCPA ws dily dministered by intrperitonel injection. LP-5 (Dlton Phrm Services, Toronto, ON, Cnd) ws dissolved in polyethylene glycol (Sigm-Aldrich) nd 5% dextrose (:6 v/v). or mg/kg LP-5 ws dministered dily by orl gvge. Histologicl nlysis Preprtion of tissue sections nd H&E stining were performed s previously described [8,9]. Liver tissues nd inguinl white dipose tissues were hrvested, fixed in % (w/v) prformldehyde nd embedded in prffin. Five-µm-thick tissue sections were deprffinized, rehydrted, nd stined with H&E. Quntifiction of heptic triglyceride levels Liver tissues were homogenized using FstPrep- (MP Biomedicls, Snt An, CA, USA) in 5% nonyl phenoxypolyethoxylethnol (NP-; Sigm-Aldrich). Aliquot of homogentes were used for mesurement of protein concentrtions Tble. Sequences of primers used in mouse genotyping Mouse Primers (5 to ) Product size, bp Tph fl/fl Adiponectin-Cre Htr KO GGATCCTAACCGAGTGTTCC GCACACCACCAACTCTTTCC TGCCATGTGAGTCTGCCTTT AACCAGCGTTTTCGTTCTGC TGGATGTGGAATGTGTGCGAG AACAGCTATGCAGAAATGAAGTT GGCTGACTGCGTAGAATAAAGG Tph fl/fl, tryptophn hydroxylse floxed; Htr, 5-hydroxytryptmine receptor A; KO, knockout. Wild type: 5 Floxed: 5 Cre+: 7 Wild type: Knockout: pge of Dibetes Metb J 8 Forthcoming. Posted online 8
3 Direct effects of serotonin on heptic stetosis with BCA Protein Assy Kit (Thermo Fisher Scientific, Wlthm, MA, USA). The remining homogentes were heted to 95 C for 5 minutes nd cooled t room temperture; this cycle ws repeted to solubilize ll heptic ft. After centrifugtion, superntnts were used for mesurement of heptic triglyceride (TG) levels. Triglyceride Regent (Sigm-Aldrich) or PBS ws dded, nd smples were incubted t 7 C for minutes to hydrolyze heptic TG into glycerol. Smples were then incubted with Free Glycerol Regent (Sigm-Aldrich) t 7 C for 5 minutes for colorimetric ssy of hydrolyzed TG levels. Differences in bsorbnce t 5 nm for hydrolyzed or non-hydrolyzed TG were quntified using glycerol stndrd. Heptic TG contents were normlized by protein mounts of liver tissues. Glucose nd insulin tolernce tests For the glucose tolernce test, overnight-fsted mice were intrperitonelly injected with g/kg D-glucose (Sigm-Aldrich) in PBS. For the insulin tolernce test,.75 U/kg humn insulin (Humulin R; Lilly, Indinpolis, IN, USA) ws intrperitonelly injected into mice fter fsting for 6 hours. Blood smples were then obtined from the til vein t, 5,, 5, 6, 9, nd minutes fter injection. Glucose concentrtions were mesured using Gluco DR Plus glucometer (Allmedicus, Anyng, Kore). Tble. Sequences of primers used in quntittive rel-time polymerse chin rection Gene Forwrd primer (5 to ) Reverse primer (5 to ) Acc CAGTAACCTGGTGAAGCTGGA GCCAGACATGCTGGATCTCAT Acly CCCTCTTCAGCCGACATACC CTGCTTGTGATCCCCAGTGA Actb GGTACCACCATGTACCCAGG GAAAGGGTGTAAAACGCAGC Agpt GCGCAATGTCGAGAACATGA TCATTCCAAGCAGGTCGAGG Apob TACTTCCACCCACAGTCCCCT CCTTAGAAGCCTTGGGCACAT Cd6 TGGCCAAGCTATTGCGACAT ACACAGCGTAGATAGACCTGC Cpt AGCTCGCACATTACAAGGACA CCAGCACAAAGTTGCAGGAC Dgt GGATCTGAGGTGCCATCGTC ATCAGCATCACCACACACCA Dgt CATCATCGTGGTGGGAGGTG TGGGAACCAGATCAGCTCCAT Fsn AAGCGGTCTGGAAAGCTGAA AGGCTGGGTTGATACCTCCA Gpm CCACAGAGCTGGGAAAGGTT GTGCCTTGTGTGCGTTTCAT Lpin CATACAAAGGCAGCCACACG CGGGGTTCAGTCCCTTGTAG Me GACCCGCATCTCAACAAGGA CAGGAGATACCTGTCGAAGTCA Mlxipl AAGTTGCTATGCCGGGACAA ATGACAGCCTCAGGTTTCCG Mogt TTGACCCATGGTGCCAGTTT GTGGCAAGGCTACTCCCATT Mttp TGCTTCCGTTAAAGGTCACACA CTTGCGGTTTTCCTTTGCCC Nrh GCAGGACCAGCTCCAAGTAG CCCTTCTCAGTCTGCTCCAC Pprg GGTGTGATCTTAACTGCCGGA GCCCAAACCTGATGGCATTG Pprgc GCCCAGGTACGACAGCTATG ACGGCGCTCTTCAATTGCTT Scd AGAGTCAGGAGGGCAGGTTT GAACTGGAGATCTCTTGGAGCA Srebpc GGAGCCATGGATTGCACATT GGCCCGGGAAGTCACTGT Acc, cetyl-coa crboxylse lph; Acly, ATP citrte lyse; Actb, ctin bet; Agpt, -cylglycerol--phosphte O-cyltrnsferse ; Apob, polipoprotein B; Cpt, crnitine plmitoyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Fsn, ftty cid synthse; Gpm, glycerol--phosphte cyltrnsferse; Lpin, lipin ; Me, mlic enzyme ; Mlxipl, MLX intercting protein-like (ChREBP, crbohydrte response element binding protein); Mogt, monocylglycerol O-cyltrnsferse ; Mttp, microsoml triglyceride trnsfer protein; Nrh, nucler receptor subfmily, group H, member (LXR, liver X receptor); Pprg, peroxisome prolifertor ctivted receptor gmm; Pprgc, Pprg coctivtor lph; Scd, steroyl-coa desturse ; Srebpc, sterol regultory element binding trnscription fctor c. Dibetes Metb J 8 Forthcoming. Posted online 8 pge of
4 Nmkung J, et l. Quntittive reverse trnscription polymerse chin rection nlysis TRIzol regent (Ambion, Crlsbrd, CA, USA) ws used for totl RNA extrction from hrvested tissues. To eliminte genomic DNA, RNA ws treted with TURBO DNse (Ambion). Complementry DNA ws generted with Superscript III Reverse Trnscriptse (Invitrogen, Crlsbd, CA, USA) from μg of totl RNA. Rel-time quntittive reverse trnscription polymerse chin rection ws performed with Fst SYBR Green Mster Mix (Applied Biosystems, Foster City, CA, USA) nd ViiA 7 rel-time PCR system (Applied Biosystems) ccording to the mnufcturer s instructions. Expressionl profiles were quntified bsed on the reltive delt delt Ct (threshold cycle) method [] with β-ctin s reference gene. The sequences of primers re given in Tble. Sttisticl nlysis Dt re presented s the men±stndrd error of men. The vlues were compred using Student t-test or one-wy nlysis of vrince. Differences with P vlues of less thn.5 were considered sttisticlly significnt. RESULTS Serotonin inhibition protects ginst -induced heptic stetosis In order to determine the effects of serotonin inhibition on diet-induced heptic stetosis, we used severl models of sero- PCPA LP-5 5 LP-5 TG (mg/g protein), 8 PCPA b A Tph fl/fl WT Tph FKO Htr KO TG (mg/g protein) 5 Tph fl/fl Tph FKO WT Htr KO c C D TG (mg/g protein) 6 TG (mg/g protein) B E Fig.. Serotonin inhibition protected ginst high ft diet ()-induced heptic stetosis. Eight-week-old mice were fed stndrd chow diet () or for weeks with vehicle, pr-chlorophenyllnine (PCPA), or LP-5 tretment. (A) H&E stining of liver sections from - or -fed mice with vehicle or PCPA tretment. (B) Quntifiction of heptic triglyceride (TG) levels in PCPA-treted mice (n=6). (C-E) H&E stining of liver sections (left) nd quntifiction of heptic TG levels (right) from -fed mice treted with LP-5 (C), ft-specific Tph-knockout (Tph FKO) mice (D), nd 5-hydroxytryptmine receptor A (Htr) knockout (KO) mice (E) (n=6). Representtive imges re shown. Scle brs, 5 μm. Tph fl/fl, tryptophn hydroxylse floxed. P<.5, b P<., c P<.. pge of Dibetes Metb J 8 Forthcoming. Posted online 8
5 Direct effects of serotonin on heptic stetosis tonin inhibition on. Phrmcologiclly, serotonin synthesis cn be blocked by Tph inhibitor, PCPA, or LP-5, which trgets the rte-limiting step of serotonin synthesis. Firstly, we exmined the livers of mice fed n nd treted with PCPA. Histologicl nlysis reveled tht -induced heptic stetosis ws blocked by PCPA tretment (Fig. A). Accordingly, heptic TG content ws significntly decresed by PCPA tretment (Fig. B). PCPA cn cross BBB nd is known to increse food intke by inhibiting serotonin production in the brin []. To further confirm the effects of peripherl serotonin inhibition, we investigted the effect of LP- 5, peripherl Tph inhibitor which cnnot cross the BBB, on heptic stetosis []. Similr to the results with PCPA, LP-5 lso decresed -induced heptic TG ccumultion (Fig. C). We lso tested Tph FKO nd Htr KO mice, which exhibit incresed energy expenditure on []. Heptic TG content ws decresed in the liver of both Tph FKO nd Htr KO mice (Fig. D nd E). Thus, inhibition of peripherl serotonin either by decresed synthesis or reduced ctivity, protects from -induced heptic stetosis. PCPA blocks positive heptic lipid blnce on Heptic stetosis results from positive heptic lipid blnce, which occurs through integrtion of mjor five components: de novo lipogenesis, TG synthesis, ftty cid (FA) uptke, FA oxidtion, nd very low density lipoprotein (VLDL) secretion [,]. Ech component is gin determined by the mount of substrte, llosteric regultion by metbolites, nd mount nd ctivity of enzymes of their pthwys. To identify the components regulted by serotonin, we investigted gene expression profiles of enzymes involved in heptic lipid metbolism. PCPA decresed the expression of most genes relted to de novo lipogenesis, TG synthesis, nd FA uptke (Fig. A-C). Thus, PCPA blocks the induction of positive heptic lipid blnce by. In contrst, the expression of genes involved in FA oxidtion nd VLDL secretion ws not chnged by PCPA tretment (Fig. D nd E). Becuse most genes in the ffected pthwy were downregulted, we hypothesized tht these chnges my reflect the regultion of upstrem trnscription fctors. Indeed, PCPA tretment decresed the expression of lipogenic trnscription fctors such s Pprg (peroxisome prolifertor ctivted receptor gmm), Nrh (Lxrα; nucler receptor subfmily, group H, member [LXR, liver X receptor]), nd Pprgc (Pprg coctivtor lph) (Fig. F). Short-term intervention of PCPA protects ginst heptic stetosis independently from energy expenditure nd insulin sensitivity The llevition of -induced heptic stetosis by PCPA could be lrgely ttributed to the decresed flux of stetogenic substrtes from dipose tissues resulting from the incresed energy expenditure in dipose tissues [,5]. In this cse, most of gene expressions in liver of mice fed with were supposed to be similr with those of mice fed with. However, some of the gene expressions were downregulted by PCPA even in liver of mice fed with. These dt strongly suggested the direct ction of serotonin on liver where severl serotonin receptors re expressed []. In order to determine the direct effects of serotonin on heptic stetosis regrdless of systemic insulin resistnce nd energy expenditure, we employed short-term intervention with n HCD nd PCPA for weeks. Notbly, the short-term HCD hd no effect on glucose tolernce (Fig. A) or insulin sensitivity (Fig. B), nd shortterm PCPA tretment did not induce beige dipogenesis in inguinl white dipose tissue (Fig. C), which is the chrcteristic of long-term intervention with PCPA []. Similr to the model, the HCD induced heptic TG ccumultion, nd PCPA decresed heptic stetosis, resulting in decresed heptic TG content (Fig. D nd E). Short-term intervention of PCPA decreses de novo lipogenesis nd TG synthesis We hve shown tht the inhibition of heptic lipid ccumultion by PCPA ws not entirely ttributed to the incresed energy expenditure in dipose tissues but to the inhibition of direct ction of serotonin on liver. In order to know more precise mechnism of serotonin on heptic lipid ccumultion, we checked gene expression profiles of lipid metbolism in the livers of PCPA-treted mice. Among components of heptic lipid blnce, genes of de novo lipogenesis nd TG synthesis were upregulted by HCD, which were reversed by PCPA (Fig. A nd B), similr to the results in -fed PCPA-treted mice. However, there were no chnges in genes encoding components of FA uptke, FA oxidtion, nd VLDL secretion (Fig. C-E). Becuse lipogenic genes were downregulted, we lso investigted upstrem trnscription fctors. Expression levels of Pprg, Srebpc (sterol regultory element binding trnscription fctor c), nd Mlxipl (MLX intercting protein-like [Chrebp, crbohydrte response element binding protein]), which re lipogenic trnscription fctors, were significntly decresed Dibetes Metb J 8 Forthcoming. Posted online 8 pge 5 of
6 Nmkung J, et l. Reltive expression Reltive expression..5 Acc Gpm b b b Fsn Agpt..5 Acly b Lpin Me c Mogt b Scd Dgt A..5 PCPA Dgt B. Cd6 Cpt Mttp Apob Reltive expression..5 Reltive expression Reltive expression C D Pprg Pprgc Srebpc Mlxipl Nrh 8. 6 b b E Reltive expression..5 b F Fig.. Pr-chlorophenyllnine (PCPA) tretment suppressed the positive heptic lipid blnce. Eight-week-old mice were fed stndrd chow diet () or high ft diet () for weeks nd treted with vehicle or PCPA tretment. Heptic expressionl profiles of genes relted to de novo lipogenesis (A), triglyceride synthesis (B), ftty cid (FA) uptke (C), FA oxidtion (D), very low density lipoprotein secretion (E), nd trnscription fctors (F) were ssessed by quntittive reverse trnscription polymerse chin rection (n=6). Acc, cetyl-coa crboxylse lph; Fsn, ftty cid synthse; Acly, ATP citrte lyse; Me, mlic enzyme ; Scd, steroyl-coa desturse ; Gpm, glycerol--phosphte cyltrnsferse; Agpt, -cylglycerol--phosphte O-cyltrnsferse ; Lpin, lipin ; Mogt, monocylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Cpt, crnitine plmitoyltrnsferse ; Mttp, microsoml triglyceride trnsfer protein; Apob, polipoprotein B; Pprg, peroxisome prolifertor ctivted receptor gmm; Pprgc, Pprg coctivtor lph; Srebpc, sterol regultory element binding trnscription fctor c; Mlxipl, MLX intercting protein-like (ChREBP, crbohydrte response element binding protein); Nrh, nucler receptor subfmily, group H, member (LXR, liver X receptor). P<.5, b P<., c P<.. pge 6 of Dibetes Metb J 8 Forthcoming. Posted online 8
7 Direct effects of serotonin on heptic stetosis Glucose (mg/dl) HCD HCD+PCPA PCPA Time (min) A Glucose (% of initil) HCD HCD+PCPA C Time (min) B PCPA TG (mg/g protein) 8 6 HCD HCD+PCPA E D Fig.. Short-term tretment with pr-chlorophenyllnine (PCPA) in the context of high crbohydrte diet (HCD) protected ginst heptic stetosis independently from energy expenditure nd insulin sensitivity. Twelve-week-old mice were fed stndrd chow diet () or HCD for weeks nd treted with vehicle or PCPA tretment. Intrperitonel glucose tolernce tests (A) nd insulin tolernce tests (B) were performed (n=). (C) H&E stining of inguinl white dipose tissue sections from HCD-fed mice with vehicle or PCPA tretment. (D) H&E stining of liver sections from - or HCD-fed mice with vehicle or PCPA tretment. (E) Quntifiction of heptic triglyceride levels in PCPA-treted mice (n=6). Representtive imges re shown. Scle brs, 5 μm. P<.5. (Fig. F). Collectively, these dt suggested tht PCPA induced negtive heptic lipid blnce by decresing de novo lipogenesis nd TG synthesis vi downregultion of lipogenic trnscription fctors independently from insulin sensitivity nd energy expenditure. Dibetes Metb J 8 Forthcoming. Posted online 8 pge 7 of
8 Nmkung J, et l. Reltive expression...5 Acc Fsn...5 Acly..5 Me Scd HCD HCD+PCPA A Reltive expression Gpm...5 Agpt b...5 Lpin...5 Mogt..5 Dgt..5 Dgt B Cd6 Cpt Apob. Mttp Reltive expression..5 Reltive expression..5 Reltive expression C D E Reltive expression..5 Pprg Pprgc Srebpc Mlxipl Nrh F Fig.. Pr-chlorophenyllnine (PCPA) tretment suppressed the positive heptic lipid blnce vi downregultion of Pprg, Srebpc, nd Mlxipl. Twelve-week-old mice were fed stndrd chow diet () or high crbohydrte diet (HCD) for weeks with vehicle or PCPA tretment. Heptic expressionl profiles of genes relted to de novo lipogenesis (A), triglyceride synthesis (B), ftty cid (FA) uptke (C), FA oxidtion (D), very low density lipoprotein secretion (E), nd trnscription fctors (F) were ssessed by quntittive reverse trnscription polymerse chin rection (n=6). Acc, cetyl-coa crboxylse lph; Fsn, ftty cid synthse; Acly, ATP citrte lyse; Me, mlic enzyme ; Scd, steroyl-coa desturse ; Gpm, glycerol--phosphte cyltrnsferse; Agpt, -cylglycerol--phosphte O-cyltrnsferse ; Lpin, lipin ; Mogt, monocylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Dgt, dicylglycerol O-cyltrnsferse ; Cpt, crnitine plmitoyltrnsferse ; Apob, polipoprotein B; Mttp, microsoml triglyceride trnsfer protein; Pprg, peroxisome prolifertor ctivted receptor gmm; Pprgc, Pprg coctivtor lph; Srebpc, sterol regultory element binding trnscription fctor c; Mlxipl, MLX intercting protein-like (ChREBP, crbohydrte response element binding protein); Nrh, nucler receptor subfmily, group H, member (LXR, liver X receptor). P<.5, b P<.. pge 8 of Dibetes Metb J 8 Forthcoming. Posted online 8
9 Direct effects of serotonin on heptic stetosis DISCUSSION, HCD, nd ethnol intke re known to induce ftty liver both in humn nd rodent. These metbolic stresses induce positive lipid blnce in the liver either by incresing de novo lipogenesis nd FA uptke or decresing FA oxidtion nd VLDL secretion. The ltertion of lipid blnce cn be induced by insulin resistnce which induces upregultion of lipogenic gene expressions nd incresed the flux of stetogenic substrtes, free FAs on liver []. In this study, we found tht phrmcologicl or genetic inhibition of serotonin production llevited heptic stetosis nd decresed heptic TG ccumultion in - or HCD-induced heptic stetosis models. PCPA is known to irreversibly inhibit Tph, the rte-limiting enzyme in serotonin synthesis, nd led to systemic serotonin depletion [5-7]. Serotonin is known to exert its norexigenic effects vi Htrc in the centrl nervous system [8]. Thus intrcrnil injection of PCPA increses food intke nd obesity []. In contrst, intrperitonel injection of PCPA exerts ntiobesity effects independently from food intke []. Thus, peripherl serotonin system is functionlly s well s ntomiclly seprted from centrl serotonin system on metbolism. We found tht both systemic inhibition of serotonin production by PCPA nd selective inhibition of peripherl serotonin production by LP-5 suppressed -induced heptic ftty chnges. Therefore, peripherl serotonin is thought be involved in diet-induced heptic stetosis. Gene expression profiles of heptic lipid metbolism showed tht PCPA suppressed the -induced positive heptic lipid blnce by downregultion of genes involved in de novo lipogenesis, TG synthesis, nd FA uptke, s in previous study of white dipose tissue []. Becuse insulin resistnce increses heptic stetosis [9] nd PCPA meliortes insulin resistnce in the context of n [], the nti-stetotic effects of PCPA my reflect both the direct effects of decresed serotonin to heptic serotonin receptors nd the indirect effects on other orgns, such s dipose tissue nd skeletl muscle. To identify the direct effects of serotonin, we used short-term intervention with PCPA with n HCD. Similr to the results in the -fed model, PCPA could prevent HCD-induced heptic stetosis. This mechnism ws independent from energy expenditure nd insulin sensitivity. Thus, serotonin could directly regulte heptic lipid metbolism. We found decresed expressions of genes ssocited with de novo lipogenesis nd TG synthesis by short-term intervention with PCPA, including downregultion of Mlxipl (crbohydrte-responsive element-binding protein), mjor lipogenic trnscription fctor tht functions in response to high glucose [], s well s lipogenic Srebpc nd Pprg []. Together with other reports tht serotonin incresed ft content in primry heptocytes [,], our dt strongly suggested tht serotonin cn be direct lipogenic stimulus in the liver vi regultion of lipogenic trnscription fctors, s hs been observed in dipose tissue. Although custive serotonin receptor nd its signling pthwy re not identified, we show the direct ction of serotonin on heptic lipid metbolism. Models of serotonin inhibition showed nti-stetogenic effects on diet-induced heptic stetosis (Fig. ), but these re sum of direct effects from decresed heptic serotonin ction nd indirect effects from incresed energy expenditure nd enhnced insulin sensitivity. We tried to distinguish those two mechnisms, nd found tht short-term intervention of PCPA tretment on HCD didn t chnge energy expenditure nd insulin sensitivity. Thus we firstly identified direct effects of serotonin inhibition on liver in vivo. Additionl studies using liver-specific serotonin receptor knockout re required to elucidte the detiled mechnism how serotonin signling is ssocited with diet-induced heptic stetosis. Selective modultion of serotonin pthwy might introduce new therpeutic pproch ginst heptic stetosis. CONFLICTS OF INTEREST No potentil conflict of interest relevnt to this rticle ws reported. ACKNOWLEDGMENTS We thnk ll the members of the Integrted Lb of Metbolism, Obesity, nd Dibetes (imod) t KAIST for their helpful discussions nd technicl support. This work ws supported by grnt from the Koren Dibetes Assocition (grnt number: 7S- to Jun Nmkung) nd grnts from the Ntionl Reserch Foundtion of Kore (NRF) funded by Ministry of Science, ICT & Future Plnning (grnt numbers: NRF-MA9 D86 to Hil Kim nd NRF-6RCB688 to Jun Nmkung). REFERENCES. Frrell GC, Lrter CZ. Nonlcoholic ftty liver disese: from Dibetes Metb J 8 Forthcoming. Posted online 8 pge 9 of
10 Nmkung J, et l. stetosis to cirrhosis. Heptology 6;( Suppl ):S99-.. Bffy G, Brunt EM, Cldwell SH. Heptocellulr crcinom in non-lcoholic ftty liver disese: n emerging mence. J Heptol ;56:8-9.. Adms LA, Wters OR, Knuimn MW, Elliott RR, Olynyk JK. NAFLD s risk fctor for the development of dibetes nd the metbolic syndrome: n eleven-yer follow-up study. Am J Gstroenterol 9;: Kwno Y, Cohen DE. Mechnisms of heptic triglyceride ccumultion in non-lcoholic ftty liver disese. J Gstroenterol ;8:-. 5. Tchernof A, Despres JP. Pthophysiology of humn viscerl obesity: n updte. Physiol Rev ;9: Glgni J, Rvussin E. Energy metbolism, fuel selection nd body weight regultion. Int J Obes (Lond) 8; Suppl 7:S Golbi P, Bush H, Younossi ZM. Tretment strtegies for nonlcoholic ftty liver disese nd nonlcoholic stetoheptitis. Clin Liver Dis 7;: Smuel VT, Shulmn GI. Nonlcoholic ftty liver disese s nexus of metbolic nd heptic diseses. Cell Metb 8;7: Berger M, Gry JA, Roth BL. The expnded biology of serotonin. Annu Rev Med 9;6: Wtnbe H, Rose MT, Aso H. Role of peripherl serotonin in glucose nd lipid metbolism. Curr Opin Lipidol ;: Kim HJ, Kim JH, Noh S, Hur HJ, Sung MJ, Hwng JT, Prk JH, Yng HJ, Kim MS, Kwon DY, Yoon SH. Metbolomic nlysis of livers nd serum from high-ft diet induced obese mice. J Proteome Res ;:7-.. Chen X, Mrgolis KJ, Gershon MD, Schwrtz GJ, Sze JY. Reduced serotonin reuptke trnsporter (SERT) function cuses insulin resistnce nd heptic stetosis independent of food intke. PLoS One ;7:e5.. Uceyler N, Schutt M, Plm F, Vogel C, Meier M, Schmitt A, Lesch KP, Mossner R, Sommer C. Lck of the serotonin trnsporter in mice reduces locomotor ctivity nd leds to genderdependent lte onset obesity. Int J Obes (Lond) ;:7-.. Oh CM, Nmkung J, Go Y, Shong KE, Kim K, Kim H, Prk BY, Lee HW, Jeon YH, Song J, Shong M, Ydv VK, Krsenty G, Kjimur S, Lee IK, Prk S, Kim H. Regultion of systemic energy homeostsis by serotonin in dipose tissues. Nt Commun 5;6: Crne JD, Plnivel R, Mottillo EP, Bujk AL, Wng H, Ford RJ, Collins A, Blumer RM, Fullerton MD, Ybut JM, Kim JJ, Ghi JE, Hmz SM, Morrison KM, Schertzer JD, Dyck JR, Khn WI, Steinberg GR. Inhibiting peripherl serotonin synthesis reduces obesity nd metbolic dysfunction by promoting brown dipose tissue thermogenesis. Nt Med 5;: Ydv VK, Ryu JH, Sud N, Tnk KF, Gingrich JA, Schutz G, Glorieux FH, Ching CY, Zjc JD, Insogn KL, Mnn JJ, Hen R, Ducy P, Krsenty G. Lrp5 controls bone formtion by inhibiting serotonin synthesis in the duodenum. Cell 8;5: Eguchi J, Wng X, Yu S, Kershw EE, Chiu PC, Dushy J, Estll JL, Klein U, Mrtos-Flier E, Rosen ED. Trnscriptionl control of dipose lipid hndling by IRF. Cell Metb ;: Fischer AH, Jcobson KA, Rose J, Zeller R. Cutting sections of prffin-embedded tissues. CSH Protoc 8;8:pdb. prot Fischer AH, Jcobson KA, Rose J, Zeller R. Hemtoxylin nd eosin stining of issue nd cell sections. CSH Protoc 8;8: pdb.prot986.. Livk KJ, Schmittgen TD. Anlysis of reltive gene expression dt using rel-time quntittive PCR nd the (-delt delt C (T)) Method. Methods ;5:-8.. Breisch ST, Zemln FP, Hoebel BG. Hyperphgi nd obesity following serotonin depletion by intrventriculr p-chlorophenyllnine. Science 976;9:8-5.. Liu Q, Yng Q, Sun W, Vogel P, Heydorn W, Yu XQ, Hu Z, Yu W, Jons B, Pined R, Clderon-Gy V, Germnn M, O Neill E, Brommge R, Cullinn E, Pltt K, Wilson A, Powell D, Snds A, Zmbrowicz B, Shi ZC. Discovery nd chrcteriztion of novel tryptophn hydroxylse inhibitors tht selectively inhibit serotonin synthesis in the gstrointestinl trct. J Phrmcol Exp Ther 8;5: Mrchesini G, Pett S, Dlle Grve R. Diet, weight loss, nd liver helth in nonlcoholic ftty liver disese: pthophysiology, evidence, nd prctice. Heptology 6;6:-.. Sumr G, Sumr O, Kim JK, Krsenty G. Gut-derived serotonin is multifunctionl determinnt to fsting dpttion. Cell Metb ;6: Koe BK, Weissmn A. P-chlorophenyllnine: specific depletor of brin serotonin. J Phrmcol Exp Ther 966;5: Snders-Bush E, Sulser F. P-chloromphetmine: in vivo investigtions on the mechnism of ction of the selective depletion of cerebrl serotonin. J Phrmcol Exp Ther 97;75:9-6. pge of Dibetes Metb J 8 Forthcoming. Posted online 8
11 Direct effects of serotonin on heptic stetosis 7. Engelmn K, Lovenberg W, Sjoerdsm A. Inhibition of serotonin synthesis by pr-chlorophenyllnine in ptients with the crcinoid syndrome. N Engl J Med 967;77: Nonogki K, Strck AM, Dllmn MF, Tecott LH. Leptin-independent hyperphgi nd type dibetes in mice with mutted serotonin 5-HTC receptor gene. Nt Med 998;: Browning JD, Horton JD. Moleculr meditors of heptic stetosis nd liver injury. J Clin Invest ;:7-5.. Postic C, Dentin R, Denechud PD, Girrd J. ChREBP, trnscriptionl regultor of glucose nd lipid metbolism. Annu Rev Nutr 7;7: Pettinelli P, Videl LA. Up-regultion of PPAR-gmm mrna expression in the liver of obese ptients: n dditionl reinforcing lipogenic mechnism to SREBP-c induction. J Clin Endocrinol Metb ;96:-.. Rozenblit-Susn S, Chpnik N, Froy O. Metbolic effect of fluvoxmine in mouse peripherl tissues. Mol Cell Endocrinol 6;:-.. Osw Y, Knmori H, Seki E, Hoshi M, Ohtki H, Ysud Y, Ito H, Suetsugu A, Ngki M, Moriwki H, Sito K, Seishim M. L-tryptophn-medited enhncement of susceptibility to nonlcoholic ftty liver disese is dependent on the mmmlin trget of rpmycin. J Biol Chem ;86:8-8. Dibetes Metb J 8 Forthcoming. Posted online 8 pge of
* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationCompound K attenuates glucose intolerance and hepatic steatosis through AMPK-dependent pathways in type 2 diabetic OLETF rats
ORIGINAL ARTICLE Koren J Intern Med 218;33:347-355 Compound K ttenutes glucose intolernce nd heptic stetosis through AMPK-dependent pthwys in type 2 dibetic OLETF rts Yoo-Cheol Hwng 1, D-Hee Oh 1, Moon
More informationCyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK
3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationRegulating Hypothalamus Gene Expression in Food Intake: Dietary Composition or Calorie Density?
Originl rticle Obesity nd Metbolic Syndrome Dibetes Metb J 7;4:-7 https://doi.org/.493/dmj.7.4.. pissn 33-679 eissn 33-687 DIETES & METOLISM JOURNL Regulting Hypothlmus Gene Expression in Food Intke: Dietry
More informationSUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis
SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song
More informationDietary fat source alters hepatic gene expression profile and determines the type of liver pathology in rats overfed via total enteral nutrition
Physiol Genomics 44: 173 189, 212. First published September 18, 212; doi:1.1152/physiolgenomics.69.212. Dietry ft source lters heptic gene expression profile nd determines the type of liver pthology in
More informationDOI /mnfr
3 Mol. Nutr. Food Res. 15, 59, 3 35 DOI 1.1/mnfr.1399 RESEARCH ARTICLE Ursolic cid improves lipid nd glucose metolism in high-ft-fed C57BL/6J mice y ctivting peroxisome prolifertor-ctivted receptor lph
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationNorthern blot analysis
Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C 5 2 4 1 um C 5 2 4 1 um Angus dipocytes expressed SCD higher thn Wgyu dipocyte
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationEffects of Weight Reduction on Serum Vaspin Concentrations in Obese Subjects: Modification by Insulin Resistance
nture publishing group rticles Effects of Weight Reduction on Serum Vspin Concentrtions in Obese Subjects: Modifiction by Insulin Resistnce Hye M. Chng 1, He J. Lee 1, Hye S. Prk 1, Je H. Kng 2, Kyung
More informationOriginal Article INTRODUCTION. Diabetes Metab J 2011;35: pissn eissn
Originl rticle Dibetes Metb J 2011;35:489-496 http://dx.doi.org/10.4093/dmj.2011.35.5.489 pissn 2233-6079 eissn 2233-6087 D I E T E S & M E T O L I S M J O U R N L Dietry Olete Hs eneficil Effects on Every
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationEffects of Rosiglitazone on Inflammation in Otsuka Long-Evans Tokushima Fatty Rats
Originl Article Koren Dibetes J 21;34:191-199 doi: 1.493/kdj.21.34.3.191 pissn 1976-918 eissn 293-265 Effects of Rosiglitzone on Inflmmtion in Otsuk Long-Evns Tokushim Ftty Rts Jin Woo Lee 1, Il Seong
More informationEffect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows
Ksetsrt J. (Nt. Sci.) 37 : 145-149 (2003) Effect of Orl Administrtion of Propylene Glycol on Serum Glucose Concentrtions in Periprturient Diry Cows Theer Rukkwmsuk, Nrongpol Petploi, Ing-orn Preechnvinit,
More informationSESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator?
SESSIONE I: RELATORI Ghrelin: from oroxigenic signl to metbolic mster regultor? Prof. Rocco Brzzoni Professore ssocito di Medicin Intern Università degli Studi di Trieste Ghrelin: d segnle oressizznte
More informationInduction of peroxisomal lipid metabolism in mice fed a high-fat diet
MOLECULAR MEDICINE REPORTS 4: 1157-1162, 2011 Induction of peroxisoml lipid metbolism in mice fed high-ft diet SACHI KOZAWA 1,4, AYAKO HONDA 1, NAOMI KAJIWARA 1, YASUHIKO TAKEMOTO 1, TOMOKO NAGASE 1, HIDEKI
More informationCombined high-fat diet and sustained high sucrose consumption promotes NAFLD in a murine model
ORIGINAL ARTICLE July-August, Vol. 14 No. 4, 215: 54-546 Combined high-ft diet nd sustined high sucrose consumption promotes NAFLD in murine model Gonzlo Torres-Villlobos,*, Nshl Hmdn-Pérez,* Armndo R.
More informationThe Effects of Small Sized Rice Bowl on Carbohydrate Intake and Dietary Patterns in Women with Type 2 Diabetes
Originl Article doi: 10.4093/kdj.2010.34.3.166 pissn 1976-9180 eissn 2093-2650 The Effects of Smll Sized Rice Bowl on Crbohydrte Intke nd Dietry Ptterns in Women with Type 2 Dibetes Hee-Jung Ahn 1, *,
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationThe nuclear receptor FXR, but not LXR, up-regulates bile acid transporter expression in non-alcoholic fatty liver disease
ORIGINAL ARTICLE July-August, Vol. 14 No. 4, 2015: 487-493 The nucler receptor FXR, but not LXR, up-regultes bile cid trnsporter expression in non-lcoholic ftty liver disese Nncy E. Aguilr-Olivos, Dniel
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationEffects of 6-Month Sitagliptin Treatment on Insulin and Glucagon Responses in Korean Patients with Type 2 Diabetes Mellitus
Originl Article Others Dibetes Metb J 215;39:335-341 http://dx.doi.org/1.493/dmj.215.39.4.335 pissn 2233-679 eissn 2233-687 DIABETES & METABOLISM JOURNAL Effects of 6-Month Sitgliptin Tretment on Insulin
More informationMyricetin Ameliorates Defective Post-Receptor Insulin Signaling via b-endorphin Signaling in the Skeletal Muscles of Fructose-Fed Rats
ecam Advnce Access published Mrch 3, 2010 ecam 2010;Pge 1 of 9 doi:10.1093/ecm/neq017 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi b-endorphin Signling in the Skeletl Muscles
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationSupporting Information. In Situ Supramolecular Assembly and Modular Modification of Hyaluronic Acid Hydrogels for 3D Cellular Engineering
Supporting Informtion In Situ Suprmoleculr Assemly nd Modulr Modifiction of Hyluronic Acid Hydrogels for 3D Cellulr Engineering Kyeng Min Prk,, Jeong-A Yng,, Hyunte Jung, c Junseok Yeom, Ji Sun Prk, d
More informationA. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5
Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationRole of Nrf2 in the alteration of cholesterol and bile acid metabolism-related gene expression by dietary cholesterol in high fat-fed mice
Originl Article JCBN Journl 0912-0009 1880-5086 the Kyoto, jcbn13-92 10.3164/jcbn.13-92 Originl Society Jpn of Article Clinicl for Free Biochemistry Rdicl Reserch nd Nutrition Jpn Role of Nrf2 in the ltertion
More informationMyricetin Ameliorates Defective Post-Receptor Insulin Signaling via
Evidence-Bsed Complementry nd Alterntive Medicine Volume 211, Article ID 15752, 9 pges doi:1.193/ecm/neq17 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi β-endorphin Signling in
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationSerum nesfatin-1 levels are decreased in pregnant women newly diagnosed with gestational diabetes
originl rticle Serum nesftin-1 levels re decresed in pregnnt women newly dignosed with gesttionl dibetes Esr Nur Ademoglu 1, Suheyl Gorr 2, Muge Keskin 3, Ayse Crlioglu 4, Rifki Ucler 5, Husmettin Erdmr
More informationOriginal Article INTRODUCTION. Korean Diabetes J 2010;34: doi: /kdj pissn eissn
Originl Article doi: 1.493/kdj.21.34.6.34 pissn 1976-918 eissn 293-265 The Smll Rice Bowl-Bsed Mel Pln ws Effective t Reducing Dietry Energy Intke, Body Weight, nd Blood Glucose Levels in Koren Women with
More informationEffect on Glycemic, Blood Pressure, and Lipid Control according to Education Types
Originl Article http://dx.doi.org/10.4093/dmj.2011.35.6.580 pissn 2233-6079 eissn 2233-6087 D I A B E T E S & M E T A B O L I S M J O U R N A L Effect on Glycemic, Blood Pressure, nd Lipid Control ccording
More informationMetformin Prevents Alcohol-Induced Liver Injury in the Mouse: Critical Role of Plasminogen Activator Inhibitor-1
GASTROENTEROLOGY 26;13:299 2112 Metformin Prevents AlcoholInduced Liver Injury in the Mouse: Criticl Role of Plsminogen Activtor Inhibitor1 INA BERGHEIM,* LUPING GUO,* MOLLY ANNE DAVIS,* JASON C. LAMBERT,*
More informationBritish Journal of Nutrition
(11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationThe RUTHERFORD-2 trial in heterozygous FH: Results and implications
The RUTHERFORD-2 tril in heterozygous FH: Results nd implictions Slide deck kindly supplied s n eductionl resource by Professor Derick Rl MD PhD Crbohydrte & Lipid Metbolism Reserch Unit University of
More informationGlucagon-Like Peptide-1 Increases Mitochondrial Biogenesis and Function in INS-1 Rat Insulinoma Cells
Brief Report Endocrinol Met 215;3:216-22 http://dx.doi.org/1.383/enm.215.3.2.216 pissn 293-596X eissn 293-5978 Glucgon-Like Peptide-1 Increses Mitochondril Biogenesis nd Function in INS-1 Rt Insulinom
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationInhibition of adipocyte differentiation in 3T3-L1 cell line by quercetin or isorhamnetin
Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2012 Inhibition of dipocyte differentition in 3T3-L1 cell line by quercetin or isorhmnetin Din Gbriel Crvjl-Aldz Louisin Stte
More informationJournal of Hainan Medical University 2017; 23(2): Journal of Hainan Medical University.
Journl of Hinn Medicl University 2017; 23(2): 151-155 151 Journl of Hinn Medicl University http://www.hnykdxxb.com Reltionship between DEXA bone minerl density mesurement results nd serum cytokines s well
More informationResearch Article Carvacrol Protects against Hepatic Steatosis in Mice Fed a High-Fat Diet by Enhancing SIRT1-AMPK Signaling
Hindwi Pulishing Corportion Evidence-Bsed Complementry nd Alterntive Medicine Volume 3, Article ID 9, pges http://dx.doi.org/.55/3/9 Reserch Article Crvcrol Protects ginst Heptic Stetosis in Mice Fed High-Ft
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationobesità nel bambino: epidemiologia e prevenzione
Obesità, Nutrizione e Stili di vit. Trento 31 Mrzo 27 obesità nel bmbino: epidemiologi e prevenzione Cludio Mffeis Diprtimento Mterno Infntile e Biologi-Genetic Sezione di Peditri - Università di Veron
More informationThe Effects of High Fat Diet and Resveratrol on Mitochondrial Activity of Brown Adipocytes
Originl Article Endocrinol Metb 216;31:328-335 http://dx.doi.org/1.383/enm.216.31.2.328 pissn 293-596X eissn 293-5978 The Effects of High Ft Diet nd Resvertrol on Mitochondril Activity of Brown Adipocytes
More informationRelationship between serum irisin, glycemic indices, and renal function in type 2 diabetic patients
J Renl Inj Prev. 2017; 6(2): 88-92. http://journlrip.com Journl of Renl Injury Prevention DOI: 10.15171/jrip.2017.17 Reltionship between serum irisin, glycemic indices, nd renl function in type 2 dibetic
More informationThe effects of Momordica charantia on obesity and lipid profiles of mice fed a high-fat diet
Nutrition Reserch nd Prctice 2015;9(5):489-495 c2015 The Koren Nutrition Society nd the Koren Society of Community Nutrition http://e-nrp.org The effects of Momordic chrnti on obesity nd lipid profiles
More informationPotential of plant-derived antimicrobials for controlling zoonotic and food-borne diseases
Potentil of plnt-derived ntimicrobils for controlling zoonotic nd food-borne diseses Kumr Venkitnrynn, DVM, MVSc, MS, Ph.D. Professor of Microbiology Grdute Progrms Chir Deprtment of Animl Science University
More informationphosphatase isoenzyme activity: estimation of
J Clin Pthol 1988;41:202-206 Quntittive method for determining serum lkline phosphtse isoenzyme ctivity: estimtion of intestinl component M J PEAKE, M PEJAKOVIC, G H WHITE From the Deprtment ofbiochemistry
More informationA Comparison of Serum Magnesium Level in Pregnant Women with and without Gestational Diabetes Mellitus (GDM)
Brief Report J Bbol Univ Med Sci Vol 18, Issu 12; Dec 2016. P:71-75 A Comprison of Serum Mgnesium Level in Pregnnt Women with nd without Gesttionl Dibetes Mellitus (GDM) Z. Bouzri (MD) 1, F. Elmi(MD) 2,
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationDose-dependent effect of daptomycin on the artificial prolongation of prothrombin time in coagulation abnormalities: in vitro verification
Hshimoto et l. BMC Phrmcology nd Toxicology (2017) 18:74 DOI 10.1186/s40360-017-0180-3 RESEARCH ARTICLE Open Access Dose-dependent effect of dptomycin on the rtificil prolongtion of prothrombin time in
More informationSupplementary Online Content
Supplementry Online Content Zulmn DM, Pl Chee C, Ezeji-Okoye SC, et l. Effect of n intensive outptient progrm to ugment primry cre for high-need Veterns Affirs ptients: rndomized clinicl tril. JAMA Intern
More informationMiglitol increases energy expenditure by upregulating uncoupling protein 1 of brown adipose tissue and reduces obesity in dietary-induced obese mice
Sugimoto et l. Nutrition & Metbolism 4, :4 RESERCH Open ccess Miglitol increses energy expenditure by upregulting uncoupling protein of brown dipose tissue nd reduces obesity in dietry-induced obese mice
More informationEffect of Endotoxin on Pyruvate Kinase Activity in Mouse Liver
INFECTION AND IMMUNITY, Aug. 1971, p. 138-142 Copyright 1971 Americn Society for Microbiology Vol. 4, No. 2 Prinzted in U.S.A. Effect of Endotoxin on Pyruvte Kinse Activity in Mouse Liver IRVIN S. SNYDER,
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationEffect of Sitagliptin and Glimepiride on Glucose Homeostasis and camp Levels in Peripheral Tissues of HFD/STZ Diabetic Rats
Americn Journl of Biomedicl Reserch, 2014, Vol. 2, No. 3, 52-60 Avilble online t http://pubs.sciepub.com/jbr/2/3/3 Science nd Eduction Publishing DOI:10.12691/jbr-2-3-3 Effect of Sitgliptin nd Glimepiride
More informationRandomized Controlled Trial to Improve Adiposity, Inflammation, and Insulin Resistance in Obese African-American and Latino Youth
nture publishing group rticles Rndomized Controlled Tril to Improve Adiposity, Inflmmtion, nd Insulin Resistnce in Obese -Americn nd Ltino Youth Rebecc E. Hsson 1, Tnj C. Adm 1, Jimie N. Dvis 1, Louise
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationHypoglycemic Activity of Polygala erioptera (Whole Plant) in Normal and Alloxan Induced Diabetic Rats
Asin Journl of Chemistry Vol. 20, No. 1 (2008), 107-112 Hypoglycemic Activity of Polygl eriopter (Whole Plnt) in Norml nd Alloxn Induced Dibetic Rts G. SAMMAIAH* nd R.S. SRIVASTAVA Deprtment of Phrmceutics,
More informationDiabetes mellitus secondary to pancreatic diseases (type 3c): The effect of smoking on the exocrine endocrine interactions of the pancreas
764062DVR0010.1177/1479164118764062Dibetes & Vsculr Disese ReserchŚliwińsk-Mossoń et l. reserch-rticle2018 Originl Article Dibetes mellitus secondry to pncretic diseses (type 3c): The effect of smoking
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationMolecular Pharmacology Fast Forward. Published on June 1, 2010 as DOI: /mol
Moleculr Phrmcology Fst Forwrd. Published on June 1, 2010 s DOI: 10.1124/mol.110.065508 Moleculr Phrmcology This rticle hs not Fst been Forwrd. copyedited nd Published formtted. The on finl June version
More informationUlinastatin reduces urinary sepsis related inflammation by upregulating IL 10 and downregulating TNF α levels
MOLECULAR MEDICINE REPORTS 8: 29-34, 2013 Ulinsttin reduces urinry sepsis relted inflmmtion by upregulting IL 10 nd downregulting TNF α levels XIAN CHEN 1*, YI WANG 1*, HONGMEI LUO 2, ZHIGANG LUO 1, LISHA
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationIntroduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010
Introduction Lnce Bumgrd Associte Professor Ntive of southwest Minnesot BS: U of Minnesot MS: U of Minnesot Advisor: Brin Crooker Thesis: Effects of genetic selection for milk yield on somtotropin prmeters
More informationMetabolomics Reveals How Cucumber (Cucumis. sativus) Reprograms Metabolites to Cope with. Silver Nanoparticle-Induced Oxidative Stress
1 Supporting Informtion for 2 3 4 5 Metbolomics Revels How Cucumber (Cucumis stivus) Reprogrms Metbolites to Cope with Silver Nnoprticle-Induced xidtive Stress 6 7 8 Huiling Zhng, Wencho Du, Jose R. Perlt-Vide
More informationResearch Article Protective Effect of Short-Term Genistein Supplementation on the Early Stage in Diabetes-Induced Renal Damage
Meditors of Inflmmtion Volume 2013, rticle ID 510212, 14 pges http://dx.doi.org/10.1155/2013/510212 Reserch rticle Protective Effect of Short-Term Genistein Supplementtion on the Erly Stge in Dibetes-Induced
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationFat intake in patients newly diagnosed with type 2 diabetes: a 4-year follow-up study in general practice
Originl ppers Ft intke in ptients newly dignosed with type 2 dibetes: 4-yer follow-up study in generl prctice Floris A vn de Lr, Eloy H vn de Lisdonk, Peter L B J Lucssen, J M H Tigchelr, Sski Meyboom,
More informationThe role of insulin and glucose in goose primary hepatocyte triglyceride accumulation
1553 The Journl of Experimentl Biology 212, 1553-1558 Pulished y The Compny of Biologists 2009 doi:10.1242/je.022210 The role of insulin nd glucose in goose primry heptocyte triglyceride ccumultion Chunchun
More informationCauses and prevention of tamoxifen-induced accumulation. of triacylglycerol in rat liver
1 Cuses nd prevention of tmoxifen-induced ccumultion of tricylglycerol in rt liver Oddrun Anit Gudrndsen 1*, Therese Hlvorsen Rost 1, Rolf Kristin Berge Institute of Medicine, Section of Medicl Biochemistry,
More informationKinetics of the inflammatory response induced by free fatty acid accumulation in hepatocytes
Kinetics of the inflmmtory response., 214; 13 (1): 113-12 ORIGINAL ARTICLE Jnury-Februry, Vol. 13 No. 1, 214: 113-12 113 Kinetics of the inflmmtory response induced by free ftty cid ccumultion in heptocytes
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationSargassum coreanum extract alleviates hyperglycemia and improves insulin resistance in db/db diabetic mice
Nutrition Reserch nd Prctice 2015;9(5):472-479 c2015 The Koren Nutrition Society nd the Koren Society of Community Nutrition http://e-nrp.org Srgssum corenum extrct llevites hyperglycemi nd improves insulin
More informationEffects of blueberries on migration, invasion, proliferation, the cell cycle and apoptosis in hepatocellular carcinoma cells
BIOMEDICAL REPORTS 5: 579-584, 2016 Effects of blueberries on migrtion, invsion, prolifertion, the cell cycle nd poptosis in heptocellulr crcinom cells WEI ZHAN 1*, XIN LIAO 2*, LEI YU 3, TIAN TIAN 3,
More informationMartinez-Rubio et al. BMC Genomics 2014, 15:462
Mrtinez-Rubio et l. BMC Genomics 2014, 15:462 RESEARCH ARTICLE Open Access Effects of functionl feeds on the lipid composition, trnscriptomic responses nd pthology in hert of Atlntic slmon (Slmo slr L.)
More informationSmall Rice Bowl-Based Meal Plan for Energy and Marcronutrient Intake in Korean Men with Type 2 Diabetes: A Pilot Study
Originl Article doi: 1.493/dmj.11.35.3.73 pissn 33-679 eissn 33-687 D I A B E T E S & M E T A B O L I S M J O U R N A L Smll Rice Bowl-Bsed Mel Pln for Energy nd Mrcronutrient Intke in Koren Men with Type
More informationCase Report INTRODUCTION CASE REPORT. pissn eissn X
pissn 2287-2728 eissn 2287-285X Cse Report Clinicl nd Moleculr Heptology 2018;24:424-429 Complete cure of dvnced heptocellulr crcinom with right drenl glnd metstsis nd portl vein thrombosis by multiple
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationStudy on the association between PI3K/AKT/mTOR signaling pathway gene polymorphism and susceptibility to gastric
JBUON 2017; 22(6): 1488-1493 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mil: editoril_office@jbuon.com ORIGINAL ARTICLE Study on the ssocition between PI3K/AKT/mTOR signling pthwy gene polymorphism
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationProtective effect of rosuvastatin treatment by regulating oxidized low-density lipoprotein expression in a rat model of liver fibrosis
BIOMEDICAL REPORTS 5: 311-316, 2016 Protective effect of rosuvsttin tretment by regulting oxidized low-density lipoprotein expression in rt model of liver fibrosis SHUIPING YU 1, XUELING ZHOU 1, BINGZONG
More informationBritish Journal of Nutrition
British Journl of Nutrition (215), 113, 1862 1875 q The Authors 215 doi:1.117/s7114515121x Anormlities in myo-inositol metolism ssocited with type 2 dietes in mice fed high-ft diet: enefits of dietry myo-inositol
More informationProtective effect of tea polyphenols against paracetamol-induced hepatotoxicity in mice is significanly correlated with cytochrome P450 suppression
Online Submissions: wjg.wjgnet.com World J Gstroenterol 2009 pril 21; 15(15): 1829-1835 wjg@wjgnet.com World Journl of Gstroenterology ISSN 1007-9327 doi:10.3748/wjg.15.1829 2009 The WJG Press nd Bishideng.
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More information