Research Article Carvacrol Protects against Hepatic Steatosis in Mice Fed a High-Fat Diet by Enhancing SIRT1-AMPK Signaling

Transcription

1 Hindwi Pulishing Corportion Evidence-Bsed Complementry nd Alterntive Medicine Volume 3, Article ID 9, pges Reserch Article Crvcrol Protects ginst Heptic Stetosis in Mice Fed High-Ft Diet y Enhncing SIRT-AMPK Signling Eunkyung Kim, Youngshim Choi, Jihee Jng, nd Tesun Prk Deprtment of Food nd Nutrition, Yonsei University, 5 Yonsei-ro, Seodemun-gu, Seoul -79, Repulic of Kore Correspondence should e ddressed to Tesun Prk; tsprk@yonsei.c.kr Received 6 Novemer ; Accepted Jnury 3 Acdemic Editor: Jng-Hern Lee Copyright 3 Eunkyung Kim et l. This is n open ccess rticle distriuted under the Cretive Commons Attriution License, which permits unrestricted use, distriution, nd reproduction in ny medium, provided the originl work is properly cited. We investigted the protective effect of crvcrol ginst high-ft-diet-induced heptic stetosis in mice nd the potentil underlying moleculr mechnisms. Mice were fed norml diet, high-ft diet, or crvcrol-supplemented high-ft diet for weeks. Compred to mice fed the high-ft diet, those fed the crvcrol-supplemented diet showed significntly lower heptic lipid levels nd reduced plsm ctivities of lnine minotrnsferse nd sprtte minotrnsferse nd plsm concentrtions of monocyte chemottrctnt protein nd tumor necrosis fctor α. Crvcrol decresed the expression of LXRα, SREBPc, FAS, leptin, nd CD36 genes nd phosphoryltion of S6 kinse protein involved in lipogenesis, wheres it incresed the expression of SIRT nd CPT genes nd phosphoryltion of liver kinse B, AMP-ctivted protein kinse, nd cetyl-coa croxylse proteins involved in ftty cid oxidtion in the liver of mice fed the high-ft diet. These results suggest tht crvcrol prevents HFD-induced heptic stetosis y ctivting SIRT-AMPK signling.. Introduction Simple heptic stetosis, once considered enign, is now eing recognized s condition tht my led to stetoheptitis (heptic stetosis with inflmmtion), firosis, nd ultimtely cirrhosis. The risk fctors ssocited with heptic stetosis re vried nd include dietes mellitus [], hypertension [], ndoesity [3]. Severl studies suggest tht excessiveftccumultionintheliveroccursduetoincresed heptic de novo lipogenesis, impired ftty cid oxidtion, or export of triglycerides. Mounting evidence suggests tht high-ft diet (HFD) cuses enhnced lipogenesis nd impired ftty cid oxidtion y inhiiting AMP-ctivted protein kinse (AMPK) ctivtion through Sirtuin (SIRT), leding to the development of heptic stetosis. The role of dietry cholesterol, with the susequent incresed heptic esterifiction of cholesterol nd its ssocition to heptic triglyceride ccumultion, is new prdigm for heptic stetosis []. Cholesterol is ccumulted in the liver under excess dietry cholesterol intke y disrupting the lnce mong steroid hormone synthesis, cholesterol uptke, nd cholesterol efflux [5]. Accumulted cholesterol is esterified y cyl-coenzyme A:cholesterol cyltrnsferse (ACAT)intheliver,wheresomeofitcnestoredwithin heptocytes in lipid droplets s cholesterol esters. When excess stored cholesterol ester molecules re present in the liver, the moiliztion of heptic triglyceride is limited nd triglyceride secretion is reduced, resulting in the retention of neutrl lipids s lipid droplets within the liver []. Crvcrol [isopropyl-ortho-cresol, C 6 H 3 (OH)(C 3 H 7 )] is predominnt monoterpene phenol which occurs in mny essentil oils of the fmily Lite including Orignum, Sturej, Thymr, Thymus, nd Coridothymus species [6]. Crvcrol is food dditive pproved y the US Food nd Drug Administrtion nd is leglly registered flvoring nd foodstuff in the Council of Europe (). It is reported tht crvcrol ppers to e slowly dsored into the rit intestine fter orl dministrtion [7]. After h, out 3% of.5 g crvcrol ws still in the gstrointestinl trct while 5% ws sored into the intestines in rit [7]. Previous in vitro studies demonstrted positive effects of crvcrol on inflmmtion, cncer, nd oxidnts [8 ]. It ws found to decrese cyclooxygense- expression in humn mcrophge-like U937 cells [8], Bcl/Bx rtio nd poly(adp-riose) polymerse- clevge in rest cncer

2 Evidence-Bsed Complementry nd Alterntive Medicine cells [9], nd lipid peroxidtion induced y rective free rdicls []. Severl rodent studies hve shown tht crvcrol provides protection ginst vrious phrmcologicl properties, including ntidepressnt [], nxiolytic-like [], ntinociceptive [], nd hypotensive [3] ctivities. Furthermore, Aristtile et l. reported tht crvcrol exerted eneficil effect in heptotoxicity through decresed ctivities of plsm lnine minotrnsferse (ALT) nd sprtte minotrnsferse (AST) in d-glctosmine-induced heptotoxic rts [6, ]. Although numer of studies hve een crried out to investigte the iochemicl roles of crvcrol, the protective ctivity of crvcrol ginst heptic stetosis hs never een reported. Therefore, the min ojective of this study ws to investigte the protective effects of crvcrol ginst HFD-induced simple heptic stetosis in mice nd to study potentil moleculr mechnisms, focusing on the expression of genes involved in lipogenesis nd ftty cid oxidtion in the liver.. Experimentl Procedures.. Animl Studies. Mle C57BL/6N mice (5 weeks old) were otined from Orient Bio (Gyeonggi-do, South Kore) nd mintined under h light-drk cycles with free ccess to food nd wter. They were divided into 3 experimentl diet groups (n = 8 per group): norml diet (ND), HFD, nd crvcrol-supplemented diet (CSD). The ND ws purified diet sed on the AIN-76 rodent diet composition. The HFD ws identicl to the ND, except tht g ft/kg (7 g lrd plus 3 g corn oil) nd % cholesterol were dded to it. The CSD ws identicl to the HFD nd contined.% (w/w) crvcrol (Sigm, MO, USA). The experimentl diets were givendliitumforweeksintheformofpellets.at the end of the experiment, ll nimls were nesthetized with ether, lood ws collected in EDTA-coted tues nd centrifuged, nd plsm ws stored t 7 C. Livers were removed, weighed, nd stored t 7 C. All mice were housed in the specific pthogen-free fcility of the Yonsei University,Seoul,Kore.Thisstudywspprovedythe Institutionl Animl Cre nd Use Committee of Yonsei University... Biochemicl Anlysis. Plsm ctivities of ALT nd AST were mesured using commercil kits (Bio-Clinicl System, Gyeonggi-do, South Kore). Heptic lipids were extrcted from whole liver homogentes using modified Folch extrction. Levels of triglycerides, free ftty cids, nd cholesterol in heptic lipid extrcts were mesured using commercil kits (Bio-Clinicl System, Gyeonggi-do, South Kore). For mesurement of heptic cholesteryl esters, lipids were extrcted from frozen liver tissues y thwing nd homogenizing in chloroform (Sigm) : isopropnol (Sigm) : NP (Sigm) (7 : :.). The tissue homogentes were centrifuged (5, g, min, C) nd the resulting superntnts (orgnic phse) were used for the cholesterol ester nlysis. Totl cholesterol nd free cholesterol levels were mesured using commercilly ville kits (ABCAM, Cmridge, UK). The level of cholesteryl esters ws clculted y sutrction of the otined vlues of free cholesterol from totl cholesterol. Plsm levels of tumor necrosis fctor-lph (TNFα) nd monocyte chemottrctnt protein- (MCP) were mesured using ELISA kits (ID Ls, MA, USA)..3. Liver Histology. Liver sections were formlin fixed nd prffin emedded prior to sectioning. All sections were then stined with hemtoxylin (Sigm) nd eosin (Sigm), encoded, nd ssessed for stetosis nd inflmmtion, y n expert liver pthologist linded to the identity of the groups. The grde of stetosis ws scored s = no stetosis; = miniml stetosis; = slight stetosis; 3 = moderte stetosis; = mrked stetosis; 5 = severe stetosis. The grde of loulr inflmmtion ws scored s = no inflmmtory foci; = - inflmmtory foci; = 3- inflmmtory foci; 3 = < inflmmtory foci... Heptic Gene Expression Anlysis. Totl RNA ws isolted from liver tissue y cid gunidinium thiocyntephenol chloroform extrction using Trizol regent (Invitrogen, CA, USA). Four microgrms of totl RNA were reverse trnscried using the Superscript II kit (Invitrogen, CA, USA) ccording to the mnufcturer s recommendtions. Primers usedforpolymersechinrection (PCR) relistedintle. Tq DNA polymerse ws used to mplify trnscried genes using PCR progrm of denturtion step of min t 9 C, followed y 3 cycles of 3 s t 9 C, 3 s t 55 C, nd min t 7 C, then min t 7 C,ndtermintedynelongtion step t 7 C for min. PCR products were size frctionted on % grose gel nd stined with ethidium romide..5. Western Blot Anlysis. Liver tissues of ech mouse were homogenized t C in n extrction uffer contining mmtris-hcl,ph7.,5mmedta,5mmncl,5mm sodium pyrophosphte, 5 mm NF, mm orthovndte, % Triton X-, mm phenylmethnesulfonyl fluoride, μg/ml protinin, μg/ml pepsttin A, nd μg/ml leupeptin.thetissuehomogenteswerecentrifuged(3 g, min, C) nd the resulting superntnts (whole-tissue extrcts) were used for western lot nlysis. The totl protein concentrtions of the whole-tissue extrcts were determined y Brdford ssy (Bio-Rd, CA, USA). Protein smples were seprted with 8% sodium dodecyl sulftepolycrylmide gel electrophoresis, trnsferred onto nitrocellulose memrne (Amershm, Buckinghmshire, UK), nd hyridized with primry ntiodies (diluted : ) overnight t C. The memrne ws then incuted with the pproprite secondry ntiody nd immunorective signls were detected using chemiluminescent detection system (Amershm, Buckinghmshire, UK). The signls were quntifiedusingthequntityonenlysissoftwre(bio-rd,ca, USA). Antiodies to liver kinse B (LKB), phospho-lkb (Ser8), AMP-ctivted protein kinse (AMPK), phospho- AMPK (Thr7), cetyl-coa croxylse (ACC), phospho- ACC (Ser79), S6 kinse (S6K), phospho-s6k (Thr389), interferon regultory fctor 3 (IRF3), phospho-irf3 (Ser396), nd β-ctenin were purchsed from Cell Signling Technology (Cell Signling Technology, MA, USA) nd ntiody to β-ctin ws otined from Snt Cruz Biotechnology (Snt Cruz, CA, USA).

3 Evidence-Bsed Complementry nd Alterntive Medicine 3 Tle : Primer sequences nd PCR conditions. Gene description Primers Sequences (5 3 ) F CAGAACCACCAAAGCGGAAA Sirtuin (SIRT) Liver X receptor R GGCACTTCATGGGGTATAGA (LXRα) F TCCTACACGAGGATCAAGCG R AGTCGCAATGCAAACACCTG SREBPc (SREBPc) F TTGTGGAGCTCAAAGACCTG R TGCAAGAAGCGGATGTAGTC CD36 ntigen (CD36) F ATGACGTGGCAAAGAACAGC R GAAGGCTCAAAGATGGCTCC Lipoprotein lipse (leptin) F CTCCAAGGTTGTCCAGGGTT R AAAACTCCCCACAGAATGGG Ftty cid synthse (FAS) F AGGGGTCGACCTGGTCCTCA R GCCATGCCCAGAGGGTGGTT Crnitine plmitoyltrnsferse I (CPT) F CTCTGCTGGCCGTTGTTGT Sterol regultory element-inding protein- R GGCAAGTTCTGCCTCACGTA (SREBP) F CACAATATCATTGAAAAGCG 3-Hydroxy-3-methylglutryl-CoA reductse R TTTTTCTGATTGGCCAGCTT (HMGCR) F TAAGATTCAACAACTCTGCT R TGTGGCCAGGAGTTTGGTGA Frnesyl diphosphte synthse (FDPS) F ATGGAGATGGGCGAGTTCTT R CCGACCTTTCCCGTCACA Cytochrome P5, fmily 5 (CYP5) F ACGCTGCCTGGCTATTGC R TTGATCTCTCGATGGGCTCTATC Low-density lipoprotein receptor (LDLR) F AGGCTGTGGGCTCCATAGG ATP-inding cssette, su-fmily G, memer 5 R TGCGGTCCAGGGTCATCT (ABCG5) F CGTGGCGGACCAAATGA ATP-inding cssette, su-fmily G, memer 8 R CGCTCGCCACTGGAAATT (ABCG8) F TGCCCACCTTCCACATGTC CytochromeP5,fmily7,sufmilyA, R ATGAAGCCGGCAGTAAGGTAGA polypeptide (CYP7A) F CAGGGAGATGCTCTGTGTTCA CytochromeP5,fmily8,sufmilyA, R AGGCATACATCCCTTCCGTGA polypeptide (CYP8B) F AAGGCTGGCTTCCTGAGCTT Acyl-coenzyme A: cholesterol cyltrnsferse R AACAGCTCATCGGCCTCATC (ACAT) F AGCGAGACAGATGCTCATGC R CAACCAAACCTCCGTCACTG Toll-like receptor (TLR) F GAGCATCCGAATTGCATCAC R TATGGCCACCAAGATCCAGA Toll-like receptor (TLR) F TCGAATCCTGAGCAAACAGC Toll-interleukin receptor domin-contining R CCCGGTAAGGTCCATGCTAT dptor protein (Tirp) F GCTTCCAGGGGATCTGATGT TIR-domin-contining dpter-inducing R AAGCAAGCCTACCACGGACT interferon-β (TRIF) F ATGGATAACCCAGGGCCTT R TTCTGGTCACTGCAGGGGAT Interferon regultory fctor 5 (IRF5) F ACCCGGATCTCAAAGACCAC R TTATTGCATGCCAACTGGGT TNF lph (TNFα) F TGTCTCAGCCTCTTCTCATT R AGATGATCTGAGTGTGAGGG Interleukin et (IL-β) F GTTGACGGACCCCAAAAGAT R TGATACTGCCTGCCTGAAGC Interferon et (IFNβ) F TGGAGCAGCTGAATGGAAAG Glycerldehyde-3-phosphte dehydrogense R GAGCATCTCTTGGATGGCAA (GAPDH) F CCCATGTTTGTGATGGGTGT R GTGATGGCATGGACTGTGGT Anneling temperture ( C) PCR product (p) Sttisticl Anlysis. The men ± SEM of ody weight gin, liver weight, nd plsm nd heptic iochemistries ws determined from 3 independent experiments. Reverse trnscription (RT)-PCR nd Western lot dt were presented s men ± SEM of t lest 3 seprte experiments. All of the nlyses were performed using SPSS sttisticl softwre. Sttisticl nlysis of results ws performed using one-wy nlysis of vrince (one-wy ANOVA test), followed y

4 Evidence-Bsed Complementry nd Alterntive Medicine Duncn s multiple-rnge tests. Sttisticl significnce ws set t P < Results 3.. Crvcrol Reverses HFD-Induced Heptic Stetosis. At week,mlemicefedthecsddisplyedsignificnt reduction in finl ody weight compred with HFD-fed mice (Figure ()). There ws no difference in the food consumption mong groups (dt not shown). CSD-fed mice showed significnt decreses in liver weight (3%, P <.5) compred to HFD-fed mice(figure ()). Heptic triglycerides (37%, P <.5), free ftty cids (57%, P <.5), totl cholesterol (6%, P <.5), nd cholesteryl ester (%, P <.5)levelsweresignificntlyhigherinHFD-fedmicethnin ND-fed mice, wheres CSD-fed mice were completely resistnt to HFD-induced heptic lipid ccumultion (Figures (c) (f)). Histologicl sections of liver tissue from HFD-fed mice showed predominntly lrge lipid-filled vcuoles. Liver sections from CSD-fed mice reveled reduction of lipid ccumultion in the form of lipid droplets, or even smll lipid droplets (Figure ()). The heptic stetosis scores in CSDfed mice were significntly lower thn scores in HFD-fed mice (Figure ()). Evlution of heptic inflmmtion using hemtoxylin nd eosin liver stining reveled no significnt differences etween CSD- nd HFD-fed mice (Figure (c)). As expected, plsm ctivities of ALT (7%, P <.5) nd AST (7%, P <.5)wereothsustntillyelevtedythe HFD,ndtheCSDresultedinsignificntreductionsinthese plsm ctivities (Figure (d)). 3.. Crvcrol Modultes the Expression of Genes Involved in Lipid Metolism. To gin insight into the protective mechnisms of crvcrol ginst heptic stetosis in HFD-fed mice, we exmined heptic mrna levels for genes involved in lipogenesis nd ftty cid oxidtion y RT-PCR nlysis. SIRT nd AMPK re key regultors of oth lipogenesis nd ftty cid oxidtion in the liver. Expression of SIRT nd phosphoryltion of AMPK protein were significntly incresed in the livers of CSD-fed mice compred with HFD-fed mice (Figures 3() nd 3()). Heptic mrna levels of the lipogenic genes, including liver X receptor lph (LXRα),sterol regultory element inding trnscription fctor (SREBPc), ftty cid synthse (FAS), leptin, nd CD36, were lso significntly lower in CSD-fed mice thn in HFD-fed mice (Figure 3()). In ddition, expression of crnitine plmitoyltrnsferse (CPT), reflection of mitochondril β-ftty cid oxidtion cpcity, ws significntly incresed in the liver of CSD-fed mice compred with HFD-fed mice (Figure 3()). We lso exmined the effect of crvcrol on the expression of genes involved in cholesterol homeostsis in the liver. HepticmRNAlevelsofSREBPnditstrgetgeneLDLR, n importnt cholesterol influx trnsporter, were higher in CSD-fed mice thn HFD-fed mice. CSD-fed mice hd incresed mrna levels of genes involved in cholesterol synthesis, including 3-hydroxy-3-methylglutryl-CoA reductse (HMGCR), Frnesyl diphosphte synthse (FDPS), nd Cytochrome P5, fmily 5 (CYP5) in the liver compred with HFD-fed mice. Expression of ACAT ws significntly decresed in the livers of CSD-fed mice compred with HFDfed mice (Figure ()). Expressions of ATP-inding cssette, sufmily G, memers 5 nd 8 (ABCG5, ABCG8) genes involved in cholesterol efflux, Cytochrome P5, fmily 7, sufmily A, polypeptide (CYP7A), nd Cytochrome P5, fmily 8, sufmily A, polypeptide (CYP8B) genes involved in ile cid synthesis, were lso higher in CSD-fed mice compred with HFD-fed mice (Figures () nd ()) Crvcrol Inhiited the Expression of Genes Involved in Inflmmtion. IntheliversofCSD-fedmice,levelsofTolllike receptors nd (TLR, TLR) nd their dptor proteins (Toll-interleukin receptor domin-contining dptor protein (TIRAP) nd TIR domin-contining dpter protein inducing interferon et (TRIF)) were significntly reduced compred with their corresponding levels in HFD-fed mice (Figure 5()). Phosphoryltion of interferon regultory fctor-3 (IRF3) protein, key trnscriptionl fctor in interferon et (IFNβ) induction,ws decresed in the livers ofcsd-fedmicecompredtohfd-fedmice(figure 5()). Significntly, higher levels of trnscription fctor interferon regultory fctor-5 (IRF5) nd proinflmmtory cytokines (interleukin [IL]-β, IFNβ, nd TNFα) were lso found in the livers of CSD-fed mice, s compred to those in HFDfedmice(Figure 5()). Mice tht received crvcrol showed significntly lower plsm concentrtions of MCP ( 67%) nd TNFα ( 35%) in comprison with the vlues for HFD control mice (Figures 5(c) nd 5(d)).. Discussion The.% crvcrol dosge (equivlent to mg/kg ody weight) given to mice in our study ws chosen on the sis of previous reports. In these reports, d-glctosmineinduced heptotoxic rts treted with crvcrol (8 mg/kg ody weight) hd significntly decresed plsm ALT nd AST ctivities, s well s heptic free ftty cid nd cholesterol levels in comprison with sline-treted heptotoxic rts [6, ]. Mice treted with crvcrol ( mg/kg ody weight) showed reduced nociceptive ehviors induced y cetic cid s compred to vehicle-treted controls []. In our preliminry study, crvcrol supplemented to the HFD t.,.5, nd.% levels for 8 dys resulted in dosedependent reduction in the ody weight of mice (dt not shown). On the sis of these results, nimls were fed.% crvcrol for longer period in the present study. Considering tht the LD 5 vlue for single i.g. dministrtion ofcrvcroltortws8mg/kgodyweightinncute toxicity study [5], the.% crvcrol supplemented in the diet (equivlent to mg/kg ody weight) ppers to hve no hrmful effect. The dily crvcrol intke of the mice in our study ( mg/kg ody weight) ws equivlent to n intke of pproximtely 8. mg/kg humn ody weight (86 mg/6 kg person), when clculted on the sis of normliztion to ody surfce re s recommended y Regn-Shw et l. nd the US Food nd Drug Administrtion ( The dily doses of commercil dietry supplements rnge

5 Evidence-Bsed Complementry nd Alterntive Medicine Body weight (g) Liver weight (g) Triglyceride (μmol/g liver) 5 () () (c) 3 FFA (μeq/g liver) 8 6 Totl cholesterol (μmol/g liver) Cholesterol ester (μmol/g liver) (d) (e) (f) Figure : CSD mice re resistnt to HFD-induced liver enlrgement nd heptic lipid levels. () Finl ody weight of mice on ND, HFD, or CSD. () Weights of livers nd (c f) heptic triglyceride, FFA, totl cholesterol, nd cholesterol ester levels. Dt re men ± SEM, n = 8. P <.5. 5 Stetosis score (.u.) () Inflmmtion score (.u.) ALT (IU/L) c (c) (d) () AST (IU/L) Figure : Crvcrol reduced heptic lipid droplet nd ctivities of ALT nd AST. () Hemtoxylin nd eosin stining of representtive liver section (mgnifiction ). () Men stetosis score. (c) Men inflmmtion score. (d) Plsm ALT nd AST ctivities. Dt re men ± SEM, n=8. P <.5.

6 6 Evidence-Bsed Complementry nd Alterntive Medicine SIRT LXRα SREBPc FAS Leptin CD36 CPT GAPDH Reltive mrna expression SIRT LXRα SREBPc FAS Leptin CD36 CPT ND HFD CSD () pampk (Thr7) Totl AMPK.5 pampk (Thr7)/totl AMPK.5 () Figure 3: Enhnced heptic SIRT-AMPK signling in CSD-fed mice. () Heptic mrna expression levels of SIRT, LXRα, SREBPc, FAS, leptin, CD36, nd CPT normlized to GAPDH reltive to ND-fed mice. () Upper, representtive western lot of phospho- nd totl AMPK in livers of ND, HFD, nd CSD-fed mice. Lower, densitometric nlysis of AMPK phosphoryltion expressed s chnge reltive to ech control nd. Dt re shown s the men ± SEM, n=8. P <.5.

7 Evidence-Bsed Complementry nd Alterntive Medicine 7 ND HFD CSD SREBP HMGCR FDPS CYP5 LDLR ABCG5 ABCG8 ACAT GAPDH Reltive mrna expression c c SREBP HMGCR FDPS CYP5 LDLR ABCG5 ABCG8 ACAT ND HFD CSD () CYP7A CYP8B GAPDH GAPDH Reltive mrna expression CYP7A CYP8B ND HFD CSD () Figure : Enhnced heptic cholesterol metolism in CSD-fed mice. ( nd ) Heptic mrna expression levels of SREBP, HMGCR, FDPS, CYP5, LDLR, ABCG5, ABCG8, ACAT, CYP7A, nd CYP8B normlized to GAPDH reltive to ND-fed mice. Dt re shown s the men ± SEM, n=8. P <.5. from 9 to 88 mg crvcrol (.5.8 mg/kg ody weight) for 6kghumn. Severl studies hve demonstrted tht the inctivtion of SIRT-AMPK signling increses lipogenesis nd represses rtes of ftty cid oxidtion in the livers of HFD-fed mice. Inctivtion of SIRT leds to decresed decetyltion of Lys8 nd possily other key lysine residues on LKB. This, in turn, inhiits LKB inding to STE-relted dptor protein nd mouse emryo scffold protein, which inctivtes its kinse ctivity nd leds to the inhiition of AMPK phosphoryltion [6]. Inctivtion of AMPK through S6K ctivtes LXRα, leding to the expression of trget genes such s CD36, leptin, nd FAS, which my contriute to incresed ft ccumultion in the liver. At the sme time, inctivted AMPK increses ACC phosphoryltion, susequently decresing the level of CPT in the liver. The consequence of this my e decrese in ftty cid oxidtion rtes in the liver. In the present study, crvcrol reversed the HFD-induced upregultion of heptic genes involved in lipogenesis (S6K, LXRα, SREBPc, FAS, leptin, nd CD36) nd HFD-induced downregultion of heptic genes involved in ftty cid oxidtion (SIRT, AMPK, nd CPT). Accordingly, chnges in expression of genes involved in lipogenesis nd ftty cid oxidtion my hve contriuted to the reduction of heptic triglyceride nd free ftty cid concentrtions in CSD-fed mice. The cells tht internlize exogenous cholesterol repress endogenous cholesterol iosynthesis nd LDLR expression in response to cholesterol loding. The heptic cholesterol depletion ws ssocited with compenstory mechnisms imed t incresing heptic cholesterol, including upregultion of

8 8 Evidence-Bsed Complementry nd Alterntive Medicine TLR TLR Tirp TRIF IRF5 TNFα IL-β IFNβ GAPDH pirf3 (Ser396) Totl IRF3 pirf3 (Ser369)/totl IRF3 6 () Reltive mrna expression TLR TLR Tirp TRIF IRF5 ND HFD CSD () MCP (pg/ml) (c) 8 6 c TNFα IL-β IFNβ TNFα (pg/ml) (d) c Figure 5: Reduced heptic TLR- nd -medited signling nd plsm levels of inflmmtory mrkers in CSD-fed mice. () Heptic mrna expression levels of TLR, TLR nd relted genes normlized to GAPDH expression reltive to ND-fed mice. () Representtive lots of heptic IRF3 nd phosphorylted IRF3 proteins in totl liver extrcts from the ND-, HFD-, nd CSD-fed mice. Blots were quntified nd the dt re presented s the rtio of phosphorylted IRF3 to ntive protein, with vlues normlized to ND-fed mice. (c nd d) Plsm MCP nd TNFα levels. Vlues re mens ± SEM from 8 nimls, P <.5. HMGCR nd LDLR [5]. In the present study, crvcrol decresed the HFD-induced increse in heptic cholesterol concentrtions nd, simultneously, incresed the mrna expression of heptic HMGCR nd LDLR. The elevted HMGCR nd LDLR mrna levels my e secondry to the reduced heptic cholesterol concentrtions induced y crvcrol supplementtion. Another importnt protective mechnism ginst heptic cholesterol ccumultion is cellulr efflux of cholesterol nd ile cid iosynthesis [7, 8]. In the present study, crvcrol reversed the HFD-induced downregultion of CYP7A nd CYP8B genes involved in ile cid iosynthesis nd ABCG5 nd ABCG8 genes involved in cholesterol efflux in the liver of mice. Therefore, the incresed expression of these genes might contriute to the lower cholesterol concentrtion in the liver of CSD-fed mice. The present study showed tht crvcrol reversed the HFD-inducedincreseinfreecholesterolndcholesterol ester concentrtions in the liver of mice. In the heptocyte, cholesterol exists s free cholesterol nd s cholesterol esters [9]. It hs een suggested tht n increse in the intrheptic free cholesterol concentrtion is rpidly lnced y n increse in the rte of cholesterol esterifiction to prevent excess cellulr free cholesterol ccumultion []. A recent study showed tht the incresed cholesterol ester in lipid droplets could limit the hydrolysis of triglycerides nd decrese heptic triglyceride secretion out of cells, leding to heptic stetosis in the liver of mice fed low-ft diet contining cholesterol []. Therefore, the protective ction of crvcrol ginst heptic stetosis might involve not only enhnced SIRT-AMPK signling, ut lso decresed concentrtion of cholesterol ester. TLRs ply n importnt role in the innte immune system y ctivting inflmmtory pthwys in response to microil gents []. TLR nd initite shred nd distinct signling

9 Evidence-Bsed Complementry nd Alterntive Medicine 9 SIRT AC LKB p ACC p STRAD LKB MO5 p AMPK LDLR ABCG5 ABCG8 Acetyl-CoA HMGCR FDPS CYP5 TRIF TRAF3 TBK IKKi CD TRAM TLR TIRAP MyD88 TIRAP MyD88 IRAK IRAK TRAF6 TRAF6 TLR Acetyl CoA Mlonyl CoA mtor DHCR7 CPT Ftty cid oxidtion p S6K INSIG Cholesterol P P IRF3 IRF3 IRF5 Nucleus Trget genes FAS Leptin CD36 LXRα SREBPc LXRα SCAP SREBP HMGC SREBP Cyp7 Cyp7A Bile cid Nucleus MyD88-independent pthwy IL-6 IFNβ P IRF3 IRF3 P MyD88-dependent pthwy IRF5 TNFα Nucleus Lipogenesis HMGCR Inflmmtion cytokines () Lipogenesis nd ftty cid oxidtion () Cholesterol homeostsis (c) TLR -, -medited signling Figure 6: () Proposed mechnism for the protective effects of crvcrol ginst heptic stetosis in mice. Crvcrol decresed the expression of genes nd phosphoryltion of protein involved in lipogenesis, wheres it incresed the expression of genes nd phosphoryltion of proteins involved in ftty cid oxidtion in the livers of HFD-fed mice. () Schemtic overview of cholesterol homeostsis nd the effects of crvcrol in the livers of HFD-fed mice. Crvcrol lowers cholesterol content y reversing the HFD-induced downregultion of genes involved in cholesterol homeostsis. (c) Schemtic overview of the genes regulted y crvcrol in TLR- nd -signling pthwy. pthwys y recruiting vrious comintions of the Tollinterleukin receptor domin-contining dptor proteins MyD88,TIRAP(Ml),TRIF,ndTRAM.Thesesignling pthwys ctivte the trnscription fctor IRF5, leding to the production of inflmmtory cytokines. TLR lso ctivtes the trnscription fctor IRF3, leding to the production of type I interferons [, ]. TLR- nd -medited signling hs emerged s mjor mechnism involved in regulting inflmmtory responses in mouse models of HFD-induced stetosis [3, ]. Although no infiltrtion of inflmmtory cells ws detected in the livers of CSD- nd HFD-fed mice, the expressions of proinflmmtory cytokines (TNFα,IFNα, nd IL-6) nd their upstrem signling molecules (TLR/, TIRAP, TRIF, TRAF6, nd IRF5) were decresed in CSD-fed mice compred with HFD-fed mice. The HFD-induced elevtions in plsm TNFα nd MCP concentrtions were lso significntly reversed y crvcrol supplementtion. These findings support the recent in vivo studies on the nti-inflmmtory ctivity of crvcrol. Guimres et l. [5] reveled thtcrvcrolsignificntlydecresed TNF-α levels in pleurl lvge nd suppressed the recruitment of leukocytes without ltering the morphologicl profile of these cells. Crvcrol hs een reported to cuse nti-inflmmtory effects y reducing the production of inflmmtory meditors, such s IL-β nd prostnoids, possily through the induction of IL- relese in clssicl inflmmtion mouse model [6]. Our results re in ccordnce with previous studies showingthtttheerlystgeofoesityinducedythehfd, the expression levels of the proinflmmtory cytokines were incresed prior to mcrophge infiltrtion [3, 7]. HFDinduced ftty liver diseses cn progress from simple stetosis to nonlcoholic stetoheptitis (NASH, ftty chnges with inflmmtion nd heptocellulr injury or firosis). It is well estlishedthtmicefedthehfdforweeksshowedsimple stetosis with the sence of necrosis or signs of inflmmtion [8]. Although NASH did not develop in our -week experiment, upregultion of proinflmmtory cytokines nd profirotic genes could hve fcilitted the deteriortion of stetosis to NASH if the experiment hd een conducted for longer durtion. Accordingly, the crvcrol-medited reduction in the expressions of proinflmmtory cytokines nd plsm MCP nd TNFα concentrtions in the livers of HFDfed mice my contriute to decresed infiltrtion of mcrophge into the liver. In conclusion, crvcrol supplementtion (.%) suppressed the HFD-induced increses in liver weight, heptic lipid levels, plsm ctivities of ALT nd AST, nd the stetosis score in mice. The protective ction of crvcrol ginst HFD-induced heptic stetosis in mice ppers to e medited through the downregultion of genes involved in lipogenesis nd upregultion of genes involved in ftty cid oxidtion vi SIRT-AMPK signling. Furthermore, crvcrol supplementtion lso provoked decresed expression of genes involved in TLR-medited signling cscdes nd reduced concentrtions of plsm TNFα nd MCP, which my diminish heptic inflmmtory stress (Figure 6). Conflict of Interests The uthors hve declred no conflict of interests. Acknowledgments This work ws supported y grnt from the Kore Helth R&DProject,MinistryofHelth&Welfre,Repulicof Kore(no.A98),ndytheSRCprogrm(Centerfor

10 Evidence-Bsed Complementry nd Alterntive Medicine Food & Nutritionl Genomics: Grnt no. -99) of the Ntionl Reserch Foundtion (NRF) of Kore funded y the Ministry of Eduction, Science nd Technology. References [] I. A. Leclercq, A. d Silv Moris, B. Schroyen, N. vn Hul, nd A. Geerts, Insulin resistnce in heptocytes nd sinusoidl liver cells: mechnisms nd consequences>, Journl of Heptology, vol.7,no.,pp. 56,7. [] M. J. Brookes nd B. T. Cooper, Hypertension nd ftty liver: guilty y ssocition? Journl of Humn Hypertension,vol., no., pp. 6 7, 7. [3] B.W.SmithndL.A.Adms, Non-lcoholicfttyliverdisese, Criticl Reviews in Clinicl Lortory Sciences,vol.8,no.3,pp. 97 3,. [] H.M.Alger,J.MrkBrown,J.K.Swyeretl., Inhiitionof cyl-coenzyme A: cholesterol cyltrnsferse (ACAT) prevents dietry cholesterol-ssocited stetosis y enhncing heptic triglyceride moiliztion, TheJournlofBiologiclChemistry,vol.85,no.9,pp.67 7,. [5] I. Ts, Consequences of cellulr cholesterol ccumultion: sic concepts nd physiologicl implictions, The Journl of Clinicl Investigtion,vol.,no.7,pp.95 9,. [6] B. Aristtile, K. S. Al-Numir, C. Veermni, nd K. V. Puglendi, Effect of crvcrol on heptic mrker enzymes nd ntioxidnt sttus in d-glctosmine-induced heptotoxicity in rts, Fundmentl nd Clinicl Phrmcology,vol.3,no.6,pp , 9. [7] M. de Vincenzi, A. Stmmti, A. de Vincenzi, nd M. Silno, Constituents of romtic plnts: crvcrol, Fitoterpi, vol. 75, no. 7-8, pp. 8 8,. [8]M.Hott,R.Nkt,M.Ktsukw,K.Hori,S.Tkhshi, nd H. Inoue, Crvcrol, component of thyme oil, ctivtes PPARα nd γ nd suppresses COX- expression, Journl of Lipid Reserch, vol. 5, no., pp. 3 39,. [9] K. M. Arunsree, Anti-prolifertive effects of crvcrol on humn metsttic rest cncer cell line, MDA-MB 3, Phytomedicine,vol.7,no.8-9,pp ,. [] A. G. Guimrães, G. F. Oliveir, M. S. Melo et l., Biossyguided evlution of ntioxidnt nd ntinociceptive ctivities of crvcrol, Bsic nd Clinicl Phrmcology nd Toxicology, vol. 7, no. 6, pp ,. [] F. H. C. Melo, B. A. Mour, D. P. de Sous et l., Antidepressntlike effect of crvcrol (5-Isopropyl--methylphenol) in mice: Involvement of dopminergic system, Fundmentl nd Clinicl Phrmcology,vol.5,no.3,pp ,. [] F.H.C.Melo,E.T.Venâncio, D. P. de Sous et l., Anxiolyticlike effect of Crvcrol (5-isopropyl--methylphenol) in mice: involvement with GABAergic trnsmission, Fundmentl nd Clinicl Phrmcology,vol.,no.,pp.37 3,. [3] Y. Aydin, O. Kutly, S. Ari et l., Hypotensive effects of crvcrol on the lood pressure of normotensive rts, Plnt Medic,vol.73,no.3,pp ,7. [] B.Aristtile,K.S.Al-Numir,C.Veermni,ndK.V.Puglendi, Antihyperlipidemic effect of crvcrol on d-glctosmine-induced heptotoxic rts, JournlofBsicndClinicl Physiology nd Phrmcology,vol.,no.,pp.5 7,9. [5] E. C. Hgn, W. H. Hnsen, O. G. Fitzhugh et l., Food flvourings nd compounds of relted structure. II. Sucute nd chronic toxicity, Food Cosmet Toxicol,vol.5,no.,pp. 57,. [6] F. Ln, J. M. Ccicedo, N. Rudermn, nd Y. Ido, SIRT modultion of the cetyltion sttus, cytosolic locliztion, nd ctivity of LKB: possile role in AMP-ctivted protein kinse ctivtion, The Journl of Biologicl Chemistry,vol.83,no., pp , 8. [7] A. R. Tll, P. Costet, nd N. Wng, Regultion nd mechnisms of mcrophge cholesterol efflux, The Journl of Clinicl Investigtion,vol.,no.7,pp.899 9,. [8] I. Björkhem, Do oxysterols control cholesterol homeostsis? The Journl of Clinicl Investigtion,vol.,no.6,pp.75 73,. [9] B. G. Stone, C. D. Evns, R. J. Fdden, nd D. Schreier, Regultion of heptic cholesterol ester hydrolse nd cyl-coenzyme A: cholesterol cyltrnsferse in the rt, Journl of Lipid Reserch,vol.3,no.,pp.68 69,989. [] A. A. Spector, S. N. Mthur, nd T. L. Kduce, Role of cylcoenzyme A: cholesterol o-cyltrnsferse in cholesterol metolism, Progress in Lipid Reserch,vol.8,no.,pp.3 53,979. [] H. Kumr, T. Kwi, nd S. Akir, Toll-like receptors nd innte immunity, Biochemicl nd Biophysicl Reserch Communictions,vol.388,no.,pp.6 65,9. [] M. Ymmoto, K. Tked, nd S. Akir, TIR domin-contining dptors define the specificity of TLR signling, Moleculr Immunology,vol.,no.,pp ,. [3] S.Prk,Y.Choi,S.J.Um,S.K.Yoon,ndT.Prk, Oleuropein ttenutes heptic stetosis induced y high-ft diet in mice, Journl of Heptology,vol.5,no.5,pp ,. [] C. A. River, L. Gskin, M. Allmn et l., Toll-like receptor- deficiency enhnces non-lcoholic stetoheptitis, BMC Gstroenterology,vol.,rticle5,. [5] A. G. Guimres, M. A. Xvier, M. T. de Sntn et l., Crvcrol ttenutes mechnicl hypernociception nd inflmmtory response, Nunyn-Schmiedeerg s Archives of Phrmcology,vol.385,no.3,pp [6] M. D. Lim, L. J. Quintns-Junior, W. A. de Sntn et l., Antiinflmmtory effects of crvcrol: evidence for key role of interleukin-, EuropenJournlofPhrmcology, vol. 699, no. 3, pp. 7,. [7] A. Ito, T. Sugnmi, Y. Miymoto et l., Role of MAPK phosphtse- in the induction of monocyte chemottrctnt protein- during the course of dipocyte hypertrophy, The Journl of Biologicl Chemistry,vol.8,no.35,pp.55 55,7. [8] Q. M. Anstee nd R. D. Goldin, Mouse models in non-lcoholic ftty liver disese nd stetoheptitis reserch, Interntionl Journl of Experimentl Pthology,vol.87,no.,pp. 6,6.