2017 American Diabetes Association. Published online at
|
|
- Daniela Lawrence
- 5 years ago
- Views:
Transcription
1 Patients and cell lines 1018-NT-ES cell line was derived from dermal fibroblasts of a female type 1 diabetes patient via somatic cell nuclear transfer to a human oocyte specifically donated to research under IRB#AAAI1347, and after obtaining informed consent from both the skin cell donor and the oocyte donor (1) iPSC A and E were derived via mrna reprograming from the same fibroblast donor (2). BJ-NT-ES 5 and 6 cell lines were derived from dermal fibroblasts of a male healthy control via somatic cell nuclear transfer, and BJ-iPSC M and O cell lines were obtained via mrna reprograming of the same fibroblasts (1) iPS, 1159-iPS cell lines were generated from dermal fibroblasts using a mrna Reprogramming Kit (Cat. No , Stemgent) and 1023-iPS cell line was generated using retroviral vectors (3) iPSC, 1158-iPSC, 1018-NT-ES, 1018-iPSC A, BJ-NT-ES and BJ-iPSC lines were authenticated using primers (forward: 5 -caccattagcacccaaagct-3 ; reverse: 5 -tgatttcacggaggatggtg-3 ) for unique SNPs in mitochondria (Supplementary Fig. 7A) or genomic DNA (2), and the identity of 1023-iPS and 1018-iPSC E cell lines was verified by STR genotyping (Supplementary Fig. 7B). Cell culture and beta cell differentiation Definitive endoderm stage (day 0-day 4): Cells were cultured for 4 days using STEMdiff Definitive Endoderm Differentiation Kit (Cat. No , STEMCELL Technologies) for definitive endoderm induction. Primitive gut tube stage (day 4-day 6): Media was changed to RPMI 1640 plus GlutaMAX (Cat. No , Life Technology) + 1% (v/v) Penicillin-Streptomycin (PS) (Cat. No , Thermo Fisher Scientific) + 1% (v/v) B-27 Serum-Free Supplement (50x) (Cat. No , Life Technology) + 50 ng/ml FGF7 (Cat. No. 251-KG, R&D System) for 2 days. Posterior foregut stage (day 6-day 8): Cells were then in DMEM plus GlutaMax (DMEM) (Cat. No , Life Technology) with 1% (v/v) PS + 1% (v/v) B M KAAD-Cyclopamine (Cat. No , Stemgent) + 2 M Retinoic acid (Cat. No , Stemgent) M LDN (Cat. No , Stemgent) for 2 days. Pancreatic progenitor stage (day 8-day 11): Media was switched to DMEM + 1% (v/v) PS + 1% (v/v) B ng/ml EGF (Cat. No. 236-EG, R&D System). At this stage, 50 ng/ml FGF10, 1 M ALK5i (Cat. No , Stemgent), 50 ng/ml Exendin-4 (Cat. No. 1933, Tocris), 10 ng/ml BMP4 (Cat. No. 314-BP-010, R&D System), 0.25 M LDN and 50 ng/ml EGF were added individually or in combination to test their capacity to efficiently induce the expression of PDX1 and NKX6.1 in cells as indicated in Supplementary Figure 1. Pancreatic endocrine progenitor stage (day 11-day 20): After derivation PDX1 and NKX6.1 coexpressing cells, they were dissociated into single cells with TrypLE Express and seeded into lowattachment 96 well plates (Cat. No. 7007, Corning) (1 well of 6-well-plate to 50 wells of 96-well-plate) in DMEM + 1% (v/v) PS + 1% (v/v) B M Cyclopamine + 1 µm thyroid hormone (T3) (Cat. No. T6397, SIGMA) + 10 M Alk5i + 10 M Zinc sulfate (Cat. No. Z4750, SIGMA-ALDRICH) + 10 g/ml Heparin (Cat. No. H3149, SIGMA-ALDRICH) for 3D cluster formation. Clusters were transferred into low-attachment 6 well plates (Cat. No , Thermo Fisher Scientific) after 2 days of culture in DMEM medium + 1% (v/v) PS + 1% (v/v) B nm LDN + 1 M T M Alk5i + 10 M Zinc sulfate nm Gamma-secretase inhibitor (DBZ) (Cat. No , EMD Millipore) + 10 g/ml Heparin. Freshly prepared media was changed every other day. Pancreatic beta cell stage (day 20-day 27): Media was switched into DMEM + 1% (v/v) PS + 1% (v/v) B M T M Alk5i + 1 mm N-acetyl cysteine (N-Cys) (Cat. No. A9165-5G, SIGMA- ALDRICH) +10 M Trolox (Cat. No MG, EMD Millipore) + 2 M R428 (Tyrosine kinase receptor AXL inhibitor) (Cat. No. A8329, ApexBio) + 10 M Zinc sulfate + 10 g/ml Heparin and changed every other day till day 27.
2 Static glucose stimulated insulin secretion Krebs Ringer buffer (KRB) was prepared by addition of 129 mm NaCl, 4.8 mm KCl, 2.5 mm CaCl 2, 1.2 mm MgSO 2, 1 mm Na 2 HPO 4, 1.2 mm KH 2 PO 4, 5 mm NaHCO 3, 10 mm HEPES and 0.1% BSA in deionized water and was sterilized using 0.22 m filter. 2 mm and 20 mm glucose solution were prepared in KRB for low glucose and high glucose challenge of sc-beta cell clusters sc-beta cell clusters (~5x10 5 cells) and around 100 IEQ human islets were collected and pre-incubated in 500 l low glucose solution for 1 hour. Clusters were then washed once with low glucose solution and sequentially incubated in 200 µl of low glucose and then high glucose solution for 30 min. Incubation in different level of glucose solutions was repeated once. 130 l supernatant of each condition were collected. Clusters were then dispersed into single cells using TrypLE Express, and cell number was determined. Single cells were centrifuged down and resuspended in 50 µl high salt buffer and sonicated for protein content preparation and DNA measurement with Nano Drop Spectrophotometer ND Protein content and supernatant in 2 mm glucose solution were processed using Mercodia M-Plex ARRAY Chemiluminescent Mercodia Beta Kit, and pictures were taken using Quansys Q-VIEW Imager. The concentrations of proinsulin, insulin, glucagon and C-peptide were analyzed by Quansys Q-VIEW Software and were normalized with DNA concentration. Supernatants containing secreted insulin stimulated by low and high glucose were processed using Mercodia Insulin ELISA kit (Cat. No , Mercodia). Fold changes of insulin secretion before and after glucose stimulation were calculated. Dynamic glucose stimulated insulin secretion 30 clusters were incubated in 2 ml of KRB for 30 minutes and then loaded into the temperature equilibrated microfluidic device mounted on an inverted epifluorescence microscope (Leica DMI 4000B, location). KRB containing 2 mm glucose (10 min), 25 mm glucose (30 min), 2mM glucose (30 min), 30 mm KCl (20 min) and 2 mm glucose (20 min) was then sequentially administered to the clusters. Perifusate samples were collected at the outlet at flow rate of 200 µl/min and every 2 min samples were used to determine insulin concentration by Mercodia Ultrasensitive Human Insulin ELISA kit. Assessment of insulin secretion response to other stimuli Clusters were prewashed for 30 minutes with media containing 1 mm glucose prior to sample collection. Column flow-through from wash step was discarded. Fibroblast clusters were perifused with 2.8 mm and 16.7 mm glucose, and the following, where applicable, 100 μm 3-isobutyl-1-methyl-xanthine (IBMX; Cat. No. I5879-1G, Sigma), 300 μm Tolbutamide (Cat. No. T0891, Sigma), 20 mm L-Arginine (Sigma Cat # A69690) and 20 mm KCl (Fisher Scientific Cat # BP366). Three minute samples of perifusate were collected during each stimulus. Samples were assayed in duplicate for insulin using the Millipore RIA kit RI-13K. Gene expression Total RNA was extracted from the cells at undifferentiated stage (d0), definitive endoderm stage (d4) and pancreatic progenitor stage (d11), beta cell stage (d26) and human islets using a RNeasy Mini Kit (Cat. No , QIAGEN). The total RNA was reverse transcripted into cdna using iscript Reverse Transcription Supermix (Cat. No , Bio-Rad), and the cdna were sequentially used as template with SsoFast EvaGreen Supermix (Cat. No , Bio-Rad) for quantitative realtime PCR. The primers used in PCR are listed in Supplementary Table 2. Immunocytochemistry At definitive endoderm and pancreatic progenitor stages, cells were cultured in 4-well-dishes and was fixed with 4% paraformaldehyde (PFA) (10 min at RT) and permeabilized with cold methanol at -20 C
3 for 20 min, the cells were washed 3 times with PBS after each step. Cells were then blocked for 1 hour with 2% normal donkey serum (Cat. No. D ML, Sigma-Aldrich) at RT. Primary antibodies, as indicated in Supplementary Table 3, were added and incubated overnight at 4 C. Cells were then washed three times with PBS, and then exposed to secondary antibodies listed in Supplementary Table 4 with DNA staining Hoechst for 1 hour. After 3x washes with PBS, the fluorescent staining was visualized and pictures were taken under OLYMPUS 1X73 fluorescent microscope or ZEISS LSM 710 confocal microscope. Calcium imaging Cells were dissociated with TrypLE Express into small clumps and plated on cover glass (Cat. No , Fisher Scientific) for 24 hours. Cells were imaged at 0.3 Hz for a total of 15 min. Cell were perfused with Ringers solution containing 2 mm glucose for 5 min, followed by 5 min 20 mm glucose then 5 min 30 mm KCl. Following acquisition, images were ratioed on a pixel by pixel basis using FIJI software v Changes in intracellular Ca 2+ before and after solution changes were assessed from the pixel intensity of manually drawn regions of interest encompassing cells. Despite cross-talk caused by the overlap of Fura-2 and GFP excitation wavelength, Ca 2+ transients were identifiable in GFP-positive cells with the exceptions of those expressing very high levels of the fluorescent protein. ~100 cells were randomly selected for identifying intracellular Ca 2+ changes. The traces were normalized to the first 4 points of the low glucose period. The area under the curve was measured from 5-275s in low, high glucose and KCl period. The changes in area of high glucose were calculated with respect to the low glucose, and the proportions of responsive cells were determined based on a threshold of a 13% change. Transmission electron microscopic analysis Differentiated 1018-NT-beta clusters were fixed with 2.5% glutaraldehyde in 0.1M Cacodylate buffer (PH 7.2). Samples were then post fixed with 1% OsO4 also in Cacodylate buffer for 1 hour. After dehydration, samples were embedded in Lx-112 (Ladd Research Industries, Inc.). Thin sections were cut on the PT-XL ultramicrotome at 60nm thick. The sections were stained with uranyl acetate and lead citrate. The sections were stained with uranyl acetate and lead citrate and examined under a JEOL JEM EXII electron microscope. Images were captured with an ORCA-HR digital camera (Hamamatsu) and recorded with an AMT Image Capture Engine. Samples were processed and imaged by the Diagnostic Service, Department of Pathology and Cell Biology, Columbia University. Human islets and 1018-NT-beta cell graft were incubated with 2.5% glutaraldehyde and 2% paraformaldehyde in 100 mm cacodylate buffer (ph 7.4) overnight. Samples were then treated with 1% osmium tetroxide in 100 mm cacodylate buffer for 1 h, washed in distilled water four times (10 min/wash), and then treated with 1 2% aqueous uranyl acetate overnight at 4 C in the dark. Samples were then washed and sequentially dehydrated with increasing concentrations of acetone (20, 30, 50, 70, 90, and 100%) for 30 min each, followed by three additional treatments with 100% acetone for 20 min each. Samples were then infiltrated with increasing concentrations of Spurr's resin (25% for 1 h, 50% for 1 h, 75% for 1 h, 100% for 1 h, 100% overnight at room temperature), and then incubated overnight at 70 C in a resin mold. Sections of nm were cut on a Leica ultramicrotome with a diamond knife. Imaging then took place using an FEI Talos F200X operating at 200kV at Columbia Nano initiative. Transplantation and in vivo assay For kidney capsule transplantation of human islets, 1000 IEQ human islets were loaded into sterilized PE50 catheter tubing (Tygon, Cat. No. BC-PE50) and pelleted in a clinical centrifuge at g. After pelleting, the tubing was affixed to a Hamilton syringe and placed under the renal capsule. Cells were slowly ejected under the anterior end of the kidney capsule. Human pancreatic islets were obtained through the NIDDK-funded Integrated Islet Distribution Program (IIDP) on a subscription fee basis ( The islets were procured from non-diabetic deceased donors. Samples of >85%
4 purity-levels were shipped to us within 72hrs after isolation. Once received, the islets were placed in CMRL-supplemented medium (Mediatech, Manassas, VA) supplemented with 10 U/ml heparin, 10% (v/v) FBS, and 100 ng/ml insulin-like growth factor 1 (IGF-1) and cultured overnight at 37 C prior to use in assays. Research consent was available for all research preparations. Institutional Review Board approval was available for all quality assessments performed with human islet preparations. The human C-peptide levels in mouse serum were measured every two weeks in the fed state. Once the human C-peptide levels reached 100 pm or higher, the mouse pancreatic beta cells were destroyed with one high dose (150 mg/kg) Streptozocin (Cat. No. S0130-1G, Sigma-Aldrich). Intraperitoneal glucose tolerance test was performed by fasting overnight and injecting 2 g/kg D-glucose solution. Blood was collected in heparin-coated tube at fed state, fasting and 30 min after glucose injection. Plasma were collected by centrifuging tubes at 2000g for 15 min at 4 C. The supernatants were collected for proinsulin, C-peptide and insulin detection with Mercodia M-Plex ARRAY Chemiluminescent Mercodia Beta Kit. Blood glucose levels was measured at fed state, fasting and every 30 min after glucose injection for 2 hours.
5 Supplementary Table 1. Information on human embryonic stem cell lines and pluripotent stem cell lines derived from type 1 diabetic patients and healthy subjects. ID Diagnosis Age onset Age at study Sex Stem cell line ID Reprogramming method Passage used Quality controls Reference 1018 Type Female 1018-NT-ES SCNT P17-39 Karyotyping, (1) diabetes 1018-iPSC A mrna P22-39 Exome seq, 1018-iPSC E mrna P15-25 stem cell BJ Healthy n/a newborn Male BJ-NT-ES 5 SCNT P21-28 gene (1) control BJ-NT-ES 6 SCNT P23-31 expression, BJ-iPSC M mrna P16-32 DNA BJ-iPSC O mrna P16-36 methylation 1158 Type 1 diabetes 1159 Healthy control 1023 Healthy control INS GFP/W hesc NKX2.1 GFP/W hes C 5 31 Male 1158-iPSC mrna P15-26 Stem cell gene expression n/a 34 Female 1159-iPSC mrna P14-28 Stem cell gene expression n/a 23 Male 1023-iPSC Retrovirus P22-36 Karyotyping, stem cell gene expression n/a n/a n/a Male INS GFP/W hesc n/a P6-23* Obtained from other lab n/a n/a n/a Female NKX2.1 GFP/W hesc n/a P92-95 Obtained from other lab n/a: not applicable SCNT: somatic cell nuclear transfer *after construction with INS-GFP reporter Supplementary Table 2. Primers used for quantitative realtime PCR at different stage during the differentiation. Gene Forward Reverse OCT4 TGGGCTCGAGAAGGATGTG GCATAGTCGCTGCTTGATCG SOX17 GGCGCAGCAGAATCCAGA CCACGACTTGCCCAGCAT FOXA2 GGGAGCGGTGAAGATGGA TCATGTTGCTCACGGAGGAGTA PDX1 CCCTGGGTGACCACTAAACC CACAGCCTCTACCTCGGAAC NKX6.1 ATTCGTTGGGGATGACAGAG CGAGTCCTGCTTCTTCTTGG NGN3 TCTTTTCTCCTTTGGGGCTGG TCTCACGGGTCACTTGGACA SUR1 GTTCCAGCAGAAGCTTCTCG GCTGAAATTCTCCCCGCCTT INS TTCTACACACCCAAGACCCG CAATGCCACGCTTCTGC GLU AAGTTCCCAAAGAGGGCTTG AGCTGCCTTGTACCAGCATT MAFA CTTCAGCAAGGAGGAGGTCA GCTCTGGAGTTGGCACTTCT (3) (4) (5)
6 Supplementary Table 3. Primary antibody list Antibody Species Dilution Company Catalog number SOX17 Goat 1:100 R&D Systems AF1924 FOXA2 Rabbit 1:400 Cell Signaling Technology 3143S PDX1 Goat 1:100 R&D Systems AF2419 NKX6.1 Mouse 1:300 Developmental Studies F55A10 Hybridoma Bank C-peptide Rat 1:100 Developmental Studies GN-ID4 Hybridoma Bank Glucagon Guinea Pig 1:200 Takara M182 MafA Rabbit 1:100 Abcam ab26405 Somatostatin Rabbit 1:1000 Millipore AB5494 Chromogranin A Mouse 1:100 Millipore MAB5268 Synaptophysin Rabbit 1:100 Novus Biologicals NB Ki67 Rabbit 1:200 Abcam ab16667 CK19 Rabbit 1:200 Abcam ab52625 Supplementary Table 4. Secondary antibody list Antibody Dilution Company Catalog number Donkey Anti-Rat 1:500 Jackson ImmunoResearch Alexa Fluor 488 Laboratories Donkey Anti-Rabbit 1:500 Jackson ImmunoResearch DyLight 405 Laboratories Donkey Anti-Mouse 1:500 Jackson ImmunoResearch DyLight 405 Laboratories Donkey Anti-Guinea Pig 1:500 Jackson ImmunoResearch Alexa Fluor 647 Laboratories Donkey Anti-Rabbit 1:500 Life Technologies A Alexa Fluor 555 Donkey Anti-Goat 1:500 Life Technologies A Alexa Fluor 555 Donkey Anti-Mouse 1:500 Life Technologies A Alexa Fluor 488 Donkey Anti-Mouse 1:500 Life Technologies A Alexa Fluor 555 Donkey Anti-Goat 1:500 Life Technologies A Alexa Fluor 488 Donkey Anti-Rabbit 1:500 Life Technologies A Alexa Fluor 488 Goat Anti-Rat Alexa Fluor 555 1:500 Life Technologies A-21434
7 Supplementary Figure 1. Efficient generation of PDX1- and NKX6.1-positive pancreatic progenitor cells from INS GFP/W -hes cells (A) Immunostaining analysis of cells at definitive endoderm stage during differentiation. (B) Flow cytometry quantification of CXCR4- and C-kit-positive cells at definitive endoderm stage. (C) Quantification of PDX1 and NKX6.1 double-positive pancreatic progenitor cells derived from INS GFP/W - hes cells after application of different factor combinations. The Rezania protocol (6) was also used for a comparison of pancreatic progenitor differentiation efficiency during modification of our protocol. Recombinant Human Myostatin (Cat. No , PeproTech) and CHIR (Cat. No. S2924, Selleckchem) were combined for definitive endoderm induction. After definitive endoderm stage, FGF7, Vit C (Cat. No. A4544, Sigma-Aldrich), LDN193189, KAAD-Cyclopamine, Retinoic acid and TPB (α- Amyloid Precursor Protein Modulator, Cat. No. CAS , Calbiochem) were used, and the number of PDX1- and NKX6.1-positive cells were quantified at day 11. (D) Representative flow cytometry quantification of PDX1 and NKX6.1 double positive cells at pancreatic progenitor stage after EGF was added. The further increase in efficiency of differentiation reflects by increasing plating density of ES cells to 100%, and differentiation in a 6-well plate without a further change in the protocol. (E) Immunostaining of PDX1, NKX6.1, C-peptide and NGN3 in cells differentiated in the presence of EGF or EGF plus LDN at pancreatic progenitor stage. DE kit: Definitive endoderm kit; FGF7: Fibroblast growth factor 7; Vit C: L-Ascorbic acid; Cyclo: KAAD-cyclopamine; LDN: LDN193189; RA: Retinoid acid; TPB: PKC Activator V; ALK5i: TGF-β family type I receptor activin receptor-like kinase (ALK5) inhibitor; Ex4: Exendin-4; FGF10: Fibroblast growth factor 10; EGF: Endothelial growth factor. Scale bar: 100 m.
8 Supplementary Figure 2. Efficient generation of C-peptide-positive cells from INS GFP/W -hes cells (A) Flow cytometry quantification of C-peptide, NKX6.1 and Glucagon expressing cells in 3D culture and monolayer culture at the beta cell stage. The numbers indicate the percentage of each population. (B) Generation of insulin-positive clusters indicated by GFP fluorescence and immunostaining analysis for C-peptide, NKX6.1 and Glucagon. Scale bar: 100 m.
9 Supplementary Figure 3. Efficient generation of 1018-NT-beta cells from 1018-NT-ES cells (A) Gene expressions of cells throughout the differentiation from pluripotent stem cells (d0), definitive endoderm (d4), pancreatic progenitor (d11) to beta cell stage (d26). (B) Gene expressions of 1018-NT-beta clusters and human islets.
10 Supplementary Figure NT-beta cell clusters response to glucose (A) Cells affixed to a cover slide for cytosolic calcium imaging. The cells examined at the population level are circled in red. Individual cells examined at the single cell level are circled in yellow. (B) Cytosolic calcium influx signal changes upon glucose stimulation and KCl and (C) upon sequential multiple glucose stimulation and KCl. (D) Electron microscopy of 1018-NT-beta cells. Representative insulin granules are indicated by black arrows and glucagon granules are indicated by red arrows.
11 Supplementary Figure NT-beta cell clusters rescue STZ-induced diabetic mice after transplantation (A, B) Human C-peptide concentrations over time in mice serum after subcutaneous 1018-NT-beta cell transplantation (n=22) and human islets transplantation under the kidney capsule. Each line represents an individual grafted mouse. The mouse used for graft analysis in Fig. 4 was marked with an arrow. (C) Serum human C-peptide concentrations of STZ-treated mice at fasting and 30 min after intraperitoneal glucose injection. (D) Glucose tolerance test of STZ-treated mice without transplantation (n=4), transplanted with 1018-NT-beta cell clusters (n=8), and with human islets (n=3) in fed state, fasting state and min after glucose injection. (E) C-peptide and glucagon staining of mouse pancreas after STZ treatment.
12 Supplementary Figure 6. Characteristics of 1018-NT-beta cell clusters in vivo (A-C) Immunostaining of Glucagon, C-peptide, Ki67 and TUNEL on grafted cells at 1 week after transplantation under the skin. (D) Immunostaining of grafted cells isolated at 2 months after subcutaneous transplantation for alpha cell marker Glucagon, and for beta cell marker C-peptide. Note spontaneous organization into islet-like structures. (E) Grafts with cystic structures in a 6 well plate. (F, G) Cystic cells were stained for Glucagon, C-peptide, CK19 and PDX1. Scale bar: 100 m.
13 Supplementary Figure 7. Cell line authentication (A, B) DNA was extracted from indicated cell lines, and (A) Mitochondria DNA was sequenced using primers (Forward: caccattagcacccaaagct; Reverse: tgatttcacggaggatggtg) to identify the specific SNP. (B) DNA fingerprint analysis was performed by Cell Line GENETICS.
14 Reference: 1. Yamada M, Johannesson B, Sagi I, Burnett LC, Kort DH, Prosser RW, Paull D, Nestor MW, Freeby M, Greenberg E, et al. Human oocytes reprogram adult somatic nuclei of a type 1 diabetic to diploid pluripotent stem cells. Nature. 2014;510(7506): Johannesson B, Sagi I, Gore A, Paull D, Yamada M, Golav-Lev T, LeDuc C, Shen Y, Stern S, Xu N, et al. Comparable frequencies of coding mutations and loss-of-imprinting in human pluripotent cells derived by nuclear transfer and defined factors. Cell stem cell. 2014;in press( 3. Wang L, Meece K, Williams DJ, Lo KA, Zimmer M, Heinrich G, Martin Carli J, Leduc CA, Sun L, Zeltser LM, et al. Differentiation of hypothalamic-like neurons from human pluripotent stem cells. J Clin Invest. 2015;125(2): Micallef SJ, Li X, Schiesser JV, Hirst CE, Yu QC, Lim SM, Nostro MC, Elliott DA, Sarangi F, Harrison LC, et al. INS(GFP/w) human embryonic stem cells facilitate isolation of in vitro derived insulinproducing cells. Diabetologia. 2012;55(3): Goulburn AL, Alden D, Davis RP, Micallef SJ, Ng ES, Yu QC, Lim SM, Soh CL, Elliott DA, Hatzistavrou T, et al. A targeted NKX2.1 human embryonic stem cell reporter line enables identification of human basal forebrain derivatives. Stem Cells. 2011;29(3): Rezania A, Bruin JE, Arora P, Rubin A, Batushansky I, Asadi A, O'Dwyer S, Quiskamp N, Mojibian M, Albrecht T, et al. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nature biotechnology
SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationTransplantation of Human Pancreatic Endoderm Cells Reverses Diabetes. Post Transplantation in a Prevascularized Subcutaneous Site
Stem Cell Reports, Volume 8 Supplemental Information Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes Post Transplantation in a Prevascularized Subcutaneous Site Andrew R. Pepper, Rena
More informationMaking Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes
University of British Columbia Departments of Surgery and Cellular & Physiological Sciences Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes 2016 International Conference
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationHuman Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Introduction Kit Components Cat. # # of vials Reagent Quantity Storage
Human Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Catalog #5901 Introduction Human pluripotent stem cells (hpsc), including embryonic stem cells (ESC) and induced pluripotent stem
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,
More informationAvrahami et al., Suppression of p57kip2 allows successful replication of adult human -cells
Avrahami et al., Suppression of p57kip2 allows successful replication of adult human -cells Legends to Supplementary Figures Supplementary Figure 1. A. Suppression of p57 Kip2 in human islets does not
More informationSUPPLEMENTARY DATA. Supplementary experimental procedures
Supplementary experimental procedures Glucose tolerance, insulin secretion and insulin tolerance tests Glucose tolerance test (GTT) and glucose stimulated insulin secretion (GSIS) was measured in over-night
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationErzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
More informationCell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue
Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue Kevin Docherty University of Aberdeen ELRIG Drug Discovery 2016 ACC Liverpool 14 th October 2016 Autoimmune destruction
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSupplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
More informationSupplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11463 %Sox17(+) 9 8 7 6 5 4 3 2 1 %Sox17(+) #Sox17(+) d2 d4 d6 d8 d1 d12 d14 d18 25 2 15 1 5 Number of Sox17(+) cells X 1 Supplementary Figure 1: Expression of
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationStage 5: Immature endocrine Stage 4 cells were cultured for seven days in DM-F12 medium supplemented with 1% B27 and 1 µm ALK5 inhibitor.
Supplemental Data Research Design and Methods Differentiation of Human ES Cells Stage 1: Mesoendoderm 60-70% confluent adherent cultures of undifferentiated H1 cells plated on 1:30 Matrigel coated surfaces
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationMouse sperm extraction:
Mouse sperm extraction: This method of extraction is used for acrosome reaction assays, immunocytochemistry and biochemical assays. Collect two cauda epidydimus from one male, cut them 5 times and place
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationSupplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,
More informationTable S1. qpcr primer list.
Table S1. qpr primer list. Genes Forward primer Reverse primer NANOG AAATGGGAAGAATAGA GGTTAGTGGGTTA PAX6 TTTTGTTGGGAAATG TGGTTAAATTTAG ASL1 AAGATGAAAGAAAG GGAGTTTGATTAA NHLH GTGGATAGATATTT ATATTTTGGAATTT
More informationModulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis
icell Skeletal Myoblasts Application Protocol Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis Introduction The skeletal muscle is one of the
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationControlled induction of human pancreatic progenitors produces functional beta-like cells in vitro.
Manuscript EMBO-2015-91058 Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro. Holger A Russ, Audrey V Parent, Jennifer J Ringler, Thomas G Hennings, Gopika
More informationAnnexin V-PE Apoptosis Detection Kit
Annexin V-PE Apoptosis Detection Kit Catalog Number KA0716 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationMesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of
Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular Chondrocytes by Paracrine Secretion Lei Xu, Yuxi Wu, Zhimiao Xiong, Yan Zhou, Zhaoyang Ye *, Wen-Song Tan * State Key Laboratory of
More informationSUPPLEMENTARY MATERIAL. Sample preparation for light microscopy
SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationThe role of decellularized matrix in directing differentiation of pancreatic progenitor cells in pancreatic endocrine cell fate
The role of decellularized matrix in directing differentiation of pancreatic progenitor cells in pancreatic endocrine cell fate SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA
More informationSUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
More informationImmature organoids appear after hours.
THE ESSENTIALS OF LIFE SCIENCE RESEARCH GLOBALLY DELIVERED Allison Ruchinskas, B.S., and James Clinton, Ph.D. ATCC Cell Systems, Gaithersburg, MD INTRODUCTION Figure 1. Mouse small intestinal organoid
More informationFig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses
Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationPRODUCT INFORMATION & MANUAL
PRODUCT INFORMATION & MANUAL Mitochondrial Extraction Kit NBP2-29448 Research use only. Not for diagnostic or therapeutic procedures www.novusbio.com P: 303.760.1950 P: 888.506.6887 F: 303.730.1966 technical@novusbio.com
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationIslet Assay Using the Agilent Seahorse XF24 Islet Capture Microplate
Islet Assay Using the Agilent Seahorse XF24 Islet Capture Microplate Technical Overview Introduction Agilent Seahorse XF Analyzers are most commonly used with an adherent monolayer of cells attached to
More information3D differentiation enhances the efficiency of differentiation of human induced pluripotent stem cells to insulin producing cells
University of Iowa Iowa Research Online Theses and Dissertations Fall 2014 3D differentiation enhances the efficiency of differentiation of human induced pluripotent stem cells to insulin producing cells
More informationPrimary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham
Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from
More informationHIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury
J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa
More informationGeneration of Insulin-Producing Islet-Like Clusters from Human Embryonic Stem Cells
EMBRYONIC STEM CELLS Generation of Insulin-Producing Islet-Like Clusters from Human Embryonic Stem Cells JIANJIE JIANG, a MELINDA AU, a KUANGHUI LU, a ALANA ESHPETER, b GREGORY KORBUTT, b GREG FISK, a
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationImpact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki
More informationSupplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
More informationSupplemental Materials, Nishimura et al, Page1 of 22 1
Supplemental Materials, Nishimura et al, Page of 5 Quantitative assessment of Pdx promoter activity in vivo using a secreted luciferase reporter system 6 7 8 9 Wataru Nishimura, Koki Eto, Atsushi Miki,
More informationSupplementary Material and Methods
Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.
Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded
More informationMPB333:Molecular Endocrinology of Obesity and Diabetes
MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and
More informationSupporting Information
Supporting Information Soltani et al. 10.1073/pnas.1102715108 SI Experimental Procedures Evaluation of Mice and Drug Administration. IPGTT, insulin tolerance test, and glucagon tolerance test were performed
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationSupporting Information File S2
Pulli et al. Measuring Myeloperoxidase Activity in Biological Samples Page 1 of 6 Supporting Information File S2 Step-by-Step Protocol Reagents: Sucrose (Sigma, S3089) CaCl 2 (Sigma, C5770) Heparin Sodium
More informationIslet Oxygen Consumption Assay using the XF24 Islet Capture Microplate Shirihai Lab and Seahorse Bioscience Aug
1 Islet Oxygen Consumption Assay using the XF24 Islet Capture Microplate Shirihai Lab and Seahorse Bioscience Aug 6 2009 XF Analyzers are most commonly used with an adherent monolayer of cells attached
More informationGladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSecondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
More informationIn vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationGlucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon
Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationBone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationAMPK Phosphorylation Assay Kit
AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationRayBio Annexin V-Cy5 Apoptosis Detection Kit
RayBio Annexin V-Cy5 Apoptosis Detection Kit User Manual Version 1.0 Mar 20, 2014 (Cat#: 68C5-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationIn vitro differentiation optimization Flow Cytometry
In vitro differentiation optimization The effect of various basal media formulations were examined during stages 3 4 of the differentiation protocol. For these studies, conditions were as described for
More informationwere isolated from the freshly drawn blood of healthy donors and ACS patients using the
Supplemental Figure 1. Quality control of CD4 + T-cell purification. CD4 + T cells were isolated from the freshly drawn blood of healthy donors and ACS patients using the RosetteSep CD4 + T Cell Enrichment
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
More informationDuctal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids
Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationSupplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationTotal Phosphatidic Acid Assay Kit
Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor
More informationTitle Modified Western blotting for insulin and other diabetes-associated peptide hormones
Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationMouse primary keratinocytes preparation
Mouse primary keratinocytes preparation 1. Fill a 150 X 25 mm petri dish with ice. Put newborn mice (2 3 days old) in the petri dish and insert it in an ice bucket. Leave the mice in the ice bucket for
More informationStriatal Neuron Medium Kit
Striatal Neuron Medium Kit Product Information What are included in the Striatal Neuron Medium Kit (ax0333): 2x 250 ml Striatal Neuron Basal Medium (Store at 4 o C upon receipt) 2x 7.5 ml Striatal Neuron
More informationMagCapture Exosome Isolation Kit PS Q&A
MagCapture Exosome Isolation Kit PS Q&A Specifications and performance P.1 Comparison of the conventional method P.2 Operation methods and composition P.4 Amount of starting sample P.5 Analysis after exosomes
More informationSupplementary Figure 1. Method development.
Supplementary Figure 1 Method development. Titration experiments to determine standard antibody:lysate concentration. Lysates (~2 mg of total proteins) were prepared from cells expressing FLAG- tagged
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationSupplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
More informationSupplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSUPPORTING ONLINE MATERIAL
SUPPORTING ONLINE MATERIAL SUPPORTING ONLINE TEXT Efficiency of SCNT Alive fetuses at mid-gestation The rate of viable (beating heart) embryos at day 12.5-14.5 dpc was assessed after sacrifice of foster
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationAMPK Assay. Require: Sigma (1L, $18.30) A4206 Aluminum foil
AMPK Assay Require: Acetone Sigma (1L, $18.30) A4206 Aluminum foil Ammonium sulfate Fisher BP212R-1 AMP Sigma A1752 ATP Sigma A6144 (alt. use A7699) Beta-mercaptoethanol Sigma M6250 (alt. use M7154) Bio-Rad
More information