2017 American Diabetes Association. Published online at

Transcription

1 Patients and cell lines 1018-NT-ES cell line was derived from dermal fibroblasts of a female type 1 diabetes patient via somatic cell nuclear transfer to a human oocyte specifically donated to research under IRB#AAAI1347, and after obtaining informed consent from both the skin cell donor and the oocyte donor (1) iPSC A and E were derived via mrna reprograming from the same fibroblast donor (2). BJ-NT-ES 5 and 6 cell lines were derived from dermal fibroblasts of a male healthy control via somatic cell nuclear transfer, and BJ-iPSC M and O cell lines were obtained via mrna reprograming of the same fibroblasts (1) iPS, 1159-iPS cell lines were generated from dermal fibroblasts using a mrna Reprogramming Kit (Cat. No , Stemgent) and 1023-iPS cell line was generated using retroviral vectors (3) iPSC, 1158-iPSC, 1018-NT-ES, 1018-iPSC A, BJ-NT-ES and BJ-iPSC lines were authenticated using primers (forward: 5 -caccattagcacccaaagct-3 ; reverse: 5 -tgatttcacggaggatggtg-3 ) for unique SNPs in mitochondria (Supplementary Fig. 7A) or genomic DNA (2), and the identity of 1023-iPS and 1018-iPSC E cell lines was verified by STR genotyping (Supplementary Fig. 7B). Cell culture and beta cell differentiation Definitive endoderm stage (day 0-day 4): Cells were cultured for 4 days using STEMdiff Definitive Endoderm Differentiation Kit (Cat. No , STEMCELL Technologies) for definitive endoderm induction. Primitive gut tube stage (day 4-day 6): Media was changed to RPMI 1640 plus GlutaMAX (Cat. No , Life Technology) + 1% (v/v) Penicillin-Streptomycin (PS) (Cat. No , Thermo Fisher Scientific) + 1% (v/v) B-27 Serum-Free Supplement (50x) (Cat. No , Life Technology) + 50 ng/ml FGF7 (Cat. No. 251-KG, R&D System) for 2 days. Posterior foregut stage (day 6-day 8): Cells were then in DMEM plus GlutaMax (DMEM) (Cat. No , Life Technology) with 1% (v/v) PS + 1% (v/v) B M KAAD-Cyclopamine (Cat. No , Stemgent) + 2 M Retinoic acid (Cat. No , Stemgent) M LDN (Cat. No , Stemgent) for 2 days. Pancreatic progenitor stage (day 8-day 11): Media was switched to DMEM + 1% (v/v) PS + 1% (v/v) B ng/ml EGF (Cat. No. 236-EG, R&D System). At this stage, 50 ng/ml FGF10, 1 M ALK5i (Cat. No , Stemgent), 50 ng/ml Exendin-4 (Cat. No. 1933, Tocris), 10 ng/ml BMP4 (Cat. No. 314-BP-010, R&D System), 0.25 M LDN and 50 ng/ml EGF were added individually or in combination to test their capacity to efficiently induce the expression of PDX1 and NKX6.1 in cells as indicated in Supplementary Figure 1. Pancreatic endocrine progenitor stage (day 11-day 20): After derivation PDX1 and NKX6.1 coexpressing cells, they were dissociated into single cells with TrypLE Express and seeded into lowattachment 96 well plates (Cat. No. 7007, Corning) (1 well of 6-well-plate to 50 wells of 96-well-plate) in DMEM + 1% (v/v) PS + 1% (v/v) B M Cyclopamine + 1 µm thyroid hormone (T3) (Cat. No. T6397, SIGMA) + 10 M Alk5i + 10 M Zinc sulfate (Cat. No. Z4750, SIGMA-ALDRICH) + 10 g/ml Heparin (Cat. No. H3149, SIGMA-ALDRICH) for 3D cluster formation. Clusters were transferred into low-attachment 6 well plates (Cat. No , Thermo Fisher Scientific) after 2 days of culture in DMEM medium + 1% (v/v) PS + 1% (v/v) B nm LDN + 1 M T M Alk5i + 10 M Zinc sulfate nm Gamma-secretase inhibitor (DBZ) (Cat. No , EMD Millipore) + 10 g/ml Heparin. Freshly prepared media was changed every other day. Pancreatic beta cell stage (day 20-day 27): Media was switched into DMEM + 1% (v/v) PS + 1% (v/v) B M T M Alk5i + 1 mm N-acetyl cysteine (N-Cys) (Cat. No. A9165-5G, SIGMA- ALDRICH) +10 M Trolox (Cat. No MG, EMD Millipore) + 2 M R428 (Tyrosine kinase receptor AXL inhibitor) (Cat. No. A8329, ApexBio) + 10 M Zinc sulfate + 10 g/ml Heparin and changed every other day till day 27.

2 Static glucose stimulated insulin secretion Krebs Ringer buffer (KRB) was prepared by addition of 129 mm NaCl, 4.8 mm KCl, 2.5 mm CaCl 2, 1.2 mm MgSO 2, 1 mm Na 2 HPO 4, 1.2 mm KH 2 PO 4, 5 mm NaHCO 3, 10 mm HEPES and 0.1% BSA in deionized water and was sterilized using 0.22 m filter. 2 mm and 20 mm glucose solution were prepared in KRB for low glucose and high glucose challenge of sc-beta cell clusters sc-beta cell clusters (~5x10 5 cells) and around 100 IEQ human islets were collected and pre-incubated in 500 l low glucose solution for 1 hour. Clusters were then washed once with low glucose solution and sequentially incubated in 200 µl of low glucose and then high glucose solution for 30 min. Incubation in different level of glucose solutions was repeated once. 130 l supernatant of each condition were collected. Clusters were then dispersed into single cells using TrypLE Express, and cell number was determined. Single cells were centrifuged down and resuspended in 50 µl high salt buffer and sonicated for protein content preparation and DNA measurement with Nano Drop Spectrophotometer ND Protein content and supernatant in 2 mm glucose solution were processed using Mercodia M-Plex ARRAY Chemiluminescent Mercodia Beta Kit, and pictures were taken using Quansys Q-VIEW Imager. The concentrations of proinsulin, insulin, glucagon and C-peptide were analyzed by Quansys Q-VIEW Software and were normalized with DNA concentration. Supernatants containing secreted insulin stimulated by low and high glucose were processed using Mercodia Insulin ELISA kit (Cat. No , Mercodia). Fold changes of insulin secretion before and after glucose stimulation were calculated. Dynamic glucose stimulated insulin secretion 30 clusters were incubated in 2 ml of KRB for 30 minutes and then loaded into the temperature equilibrated microfluidic device mounted on an inverted epifluorescence microscope (Leica DMI 4000B, location). KRB containing 2 mm glucose (10 min), 25 mm glucose (30 min), 2mM glucose (30 min), 30 mm KCl (20 min) and 2 mm glucose (20 min) was then sequentially administered to the clusters. Perifusate samples were collected at the outlet at flow rate of 200 µl/min and every 2 min samples were used to determine insulin concentration by Mercodia Ultrasensitive Human Insulin ELISA kit. Assessment of insulin secretion response to other stimuli Clusters were prewashed for 30 minutes with media containing 1 mm glucose prior to sample collection. Column flow-through from wash step was discarded. Fibroblast clusters were perifused with 2.8 mm and 16.7 mm glucose, and the following, where applicable, 100 μm 3-isobutyl-1-methyl-xanthine (IBMX; Cat. No. I5879-1G, Sigma), 300 μm Tolbutamide (Cat. No. T0891, Sigma), 20 mm L-Arginine (Sigma Cat # A69690) and 20 mm KCl (Fisher Scientific Cat # BP366). Three minute samples of perifusate were collected during each stimulus. Samples were assayed in duplicate for insulin using the Millipore RIA kit RI-13K. Gene expression Total RNA was extracted from the cells at undifferentiated stage (d0), definitive endoderm stage (d4) and pancreatic progenitor stage (d11), beta cell stage (d26) and human islets using a RNeasy Mini Kit (Cat. No , QIAGEN). The total RNA was reverse transcripted into cdna using iscript Reverse Transcription Supermix (Cat. No , Bio-Rad), and the cdna were sequentially used as template with SsoFast EvaGreen Supermix (Cat. No , Bio-Rad) for quantitative realtime PCR. The primers used in PCR are listed in Supplementary Table 2. Immunocytochemistry At definitive endoderm and pancreatic progenitor stages, cells were cultured in 4-well-dishes and was fixed with 4% paraformaldehyde (PFA) (10 min at RT) and permeabilized with cold methanol at -20 C

3 for 20 min, the cells were washed 3 times with PBS after each step. Cells were then blocked for 1 hour with 2% normal donkey serum (Cat. No. D ML, Sigma-Aldrich) at RT. Primary antibodies, as indicated in Supplementary Table 3, were added and incubated overnight at 4 C. Cells were then washed three times with PBS, and then exposed to secondary antibodies listed in Supplementary Table 4 with DNA staining Hoechst for 1 hour. After 3x washes with PBS, the fluorescent staining was visualized and pictures were taken under OLYMPUS 1X73 fluorescent microscope or ZEISS LSM 710 confocal microscope. Calcium imaging Cells were dissociated with TrypLE Express into small clumps and plated on cover glass (Cat. No , Fisher Scientific) for 24 hours. Cells were imaged at 0.3 Hz for a total of 15 min. Cell were perfused with Ringers solution containing 2 mm glucose for 5 min, followed by 5 min 20 mm glucose then 5 min 30 mm KCl. Following acquisition, images were ratioed on a pixel by pixel basis using FIJI software v Changes in intracellular Ca 2+ before and after solution changes were assessed from the pixel intensity of manually drawn regions of interest encompassing cells. Despite cross-talk caused by the overlap of Fura-2 and GFP excitation wavelength, Ca 2+ transients were identifiable in GFP-positive cells with the exceptions of those expressing very high levels of the fluorescent protein. ~100 cells were randomly selected for identifying intracellular Ca 2+ changes. The traces were normalized to the first 4 points of the low glucose period. The area under the curve was measured from 5-275s in low, high glucose and KCl period. The changes in area of high glucose were calculated with respect to the low glucose, and the proportions of responsive cells were determined based on a threshold of a 13% change. Transmission electron microscopic analysis Differentiated 1018-NT-beta clusters were fixed with 2.5% glutaraldehyde in 0.1M Cacodylate buffer (PH 7.2). Samples were then post fixed with 1% OsO4 also in Cacodylate buffer for 1 hour. After dehydration, samples were embedded in Lx-112 (Ladd Research Industries, Inc.). Thin sections were cut on the PT-XL ultramicrotome at 60nm thick. The sections were stained with uranyl acetate and lead citrate. The sections were stained with uranyl acetate and lead citrate and examined under a JEOL JEM EXII electron microscope. Images were captured with an ORCA-HR digital camera (Hamamatsu) and recorded with an AMT Image Capture Engine. Samples were processed and imaged by the Diagnostic Service, Department of Pathology and Cell Biology, Columbia University. Human islets and 1018-NT-beta cell graft were incubated with 2.5% glutaraldehyde and 2% paraformaldehyde in 100 mm cacodylate buffer (ph 7.4) overnight. Samples were then treated with 1% osmium tetroxide in 100 mm cacodylate buffer for 1 h, washed in distilled water four times (10 min/wash), and then treated with 1 2% aqueous uranyl acetate overnight at 4 C in the dark. Samples were then washed and sequentially dehydrated with increasing concentrations of acetone (20, 30, 50, 70, 90, and 100%) for 30 min each, followed by three additional treatments with 100% acetone for 20 min each. Samples were then infiltrated with increasing concentrations of Spurr's resin (25% for 1 h, 50% for 1 h, 75% for 1 h, 100% for 1 h, 100% overnight at room temperature), and then incubated overnight at 70 C in a resin mold. Sections of nm were cut on a Leica ultramicrotome with a diamond knife. Imaging then took place using an FEI Talos F200X operating at 200kV at Columbia Nano initiative. Transplantation and in vivo assay For kidney capsule transplantation of human islets, 1000 IEQ human islets were loaded into sterilized PE50 catheter tubing (Tygon, Cat. No. BC-PE50) and pelleted in a clinical centrifuge at g. After pelleting, the tubing was affixed to a Hamilton syringe and placed under the renal capsule. Cells were slowly ejected under the anterior end of the kidney capsule. Human pancreatic islets were obtained through the NIDDK-funded Integrated Islet Distribution Program (IIDP) on a subscription fee basis ( The islets were procured from non-diabetic deceased donors. Samples of >85%

4 purity-levels were shipped to us within 72hrs after isolation. Once received, the islets were placed in CMRL-supplemented medium (Mediatech, Manassas, VA) supplemented with 10 U/ml heparin, 10% (v/v) FBS, and 100 ng/ml insulin-like growth factor 1 (IGF-1) and cultured overnight at 37 C prior to use in assays. Research consent was available for all research preparations. Institutional Review Board approval was available for all quality assessments performed with human islet preparations. The human C-peptide levels in mouse serum were measured every two weeks in the fed state. Once the human C-peptide levels reached 100 pm or higher, the mouse pancreatic beta cells were destroyed with one high dose (150 mg/kg) Streptozocin (Cat. No. S0130-1G, Sigma-Aldrich). Intraperitoneal glucose tolerance test was performed by fasting overnight and injecting 2 g/kg D-glucose solution. Blood was collected in heparin-coated tube at fed state, fasting and 30 min after glucose injection. Plasma were collected by centrifuging tubes at 2000g for 15 min at 4 C. The supernatants were collected for proinsulin, C-peptide and insulin detection with Mercodia M-Plex ARRAY Chemiluminescent Mercodia Beta Kit. Blood glucose levels was measured at fed state, fasting and every 30 min after glucose injection for 2 hours.

5 Supplementary Table 1. Information on human embryonic stem cell lines and pluripotent stem cell lines derived from type 1 diabetic patients and healthy subjects. ID Diagnosis Age onset Age at study Sex Stem cell line ID Reprogramming method Passage used Quality controls Reference 1018 Type Female 1018-NT-ES SCNT P17-39 Karyotyping, (1) diabetes 1018-iPSC A mrna P22-39 Exome seq, 1018-iPSC E mrna P15-25 stem cell BJ Healthy n/a newborn Male BJ-NT-ES 5 SCNT P21-28 gene (1) control BJ-NT-ES 6 SCNT P23-31 expression, BJ-iPSC M mrna P16-32 DNA BJ-iPSC O mrna P16-36 methylation 1158 Type 1 diabetes 1159 Healthy control 1023 Healthy control INS GFP/W hesc NKX2.1 GFP/W hes C 5 31 Male 1158-iPSC mrna P15-26 Stem cell gene expression n/a 34 Female 1159-iPSC mrna P14-28 Stem cell gene expression n/a 23 Male 1023-iPSC Retrovirus P22-36 Karyotyping, stem cell gene expression n/a n/a n/a Male INS GFP/W hesc n/a P6-23* Obtained from other lab n/a n/a n/a Female NKX2.1 GFP/W hesc n/a P92-95 Obtained from other lab n/a: not applicable SCNT: somatic cell nuclear transfer *after construction with INS-GFP reporter Supplementary Table 2. Primers used for quantitative realtime PCR at different stage during the differentiation. Gene Forward Reverse OCT4 TGGGCTCGAGAAGGATGTG GCATAGTCGCTGCTTGATCG SOX17 GGCGCAGCAGAATCCAGA CCACGACTTGCCCAGCAT FOXA2 GGGAGCGGTGAAGATGGA TCATGTTGCTCACGGAGGAGTA PDX1 CCCTGGGTGACCACTAAACC CACAGCCTCTACCTCGGAAC NKX6.1 ATTCGTTGGGGATGACAGAG CGAGTCCTGCTTCTTCTTGG NGN3 TCTTTTCTCCTTTGGGGCTGG TCTCACGGGTCACTTGGACA SUR1 GTTCCAGCAGAAGCTTCTCG GCTGAAATTCTCCCCGCCTT INS TTCTACACACCCAAGACCCG CAATGCCACGCTTCTGC GLU AAGTTCCCAAAGAGGGCTTG AGCTGCCTTGTACCAGCATT MAFA CTTCAGCAAGGAGGAGGTCA GCTCTGGAGTTGGCACTTCT (3) (4) (5)

6 Supplementary Table 3. Primary antibody list Antibody Species Dilution Company Catalog number SOX17 Goat 1:100 R&D Systems AF1924 FOXA2 Rabbit 1:400 Cell Signaling Technology 3143S PDX1 Goat 1:100 R&D Systems AF2419 NKX6.1 Mouse 1:300 Developmental Studies F55A10 Hybridoma Bank C-peptide Rat 1:100 Developmental Studies GN-ID4 Hybridoma Bank Glucagon Guinea Pig 1:200 Takara M182 MafA Rabbit 1:100 Abcam ab26405 Somatostatin Rabbit 1:1000 Millipore AB5494 Chromogranin A Mouse 1:100 Millipore MAB5268 Synaptophysin Rabbit 1:100 Novus Biologicals NB Ki67 Rabbit 1:200 Abcam ab16667 CK19 Rabbit 1:200 Abcam ab52625 Supplementary Table 4. Secondary antibody list Antibody Dilution Company Catalog number Donkey Anti-Rat 1:500 Jackson ImmunoResearch Alexa Fluor 488 Laboratories Donkey Anti-Rabbit 1:500 Jackson ImmunoResearch DyLight 405 Laboratories Donkey Anti-Mouse 1:500 Jackson ImmunoResearch DyLight 405 Laboratories Donkey Anti-Guinea Pig 1:500 Jackson ImmunoResearch Alexa Fluor 647 Laboratories Donkey Anti-Rabbit 1:500 Life Technologies A Alexa Fluor 555 Donkey Anti-Goat 1:500 Life Technologies A Alexa Fluor 555 Donkey Anti-Mouse 1:500 Life Technologies A Alexa Fluor 488 Donkey Anti-Mouse 1:500 Life Technologies A Alexa Fluor 555 Donkey Anti-Goat 1:500 Life Technologies A Alexa Fluor 488 Donkey Anti-Rabbit 1:500 Life Technologies A Alexa Fluor 488 Goat Anti-Rat Alexa Fluor 555 1:500 Life Technologies A-21434

7 Supplementary Figure 1. Efficient generation of PDX1- and NKX6.1-positive pancreatic progenitor cells from INS GFP/W -hes cells (A) Immunostaining analysis of cells at definitive endoderm stage during differentiation. (B) Flow cytometry quantification of CXCR4- and C-kit-positive cells at definitive endoderm stage. (C) Quantification of PDX1 and NKX6.1 double-positive pancreatic progenitor cells derived from INS GFP/W - hes cells after application of different factor combinations. The Rezania protocol (6) was also used for a comparison of pancreatic progenitor differentiation efficiency during modification of our protocol. Recombinant Human Myostatin (Cat. No , PeproTech) and CHIR (Cat. No. S2924, Selleckchem) were combined for definitive endoderm induction. After definitive endoderm stage, FGF7, Vit C (Cat. No. A4544, Sigma-Aldrich), LDN193189, KAAD-Cyclopamine, Retinoic acid and TPB (α- Amyloid Precursor Protein Modulator, Cat. No. CAS , Calbiochem) were used, and the number of PDX1- and NKX6.1-positive cells were quantified at day 11. (D) Representative flow cytometry quantification of PDX1 and NKX6.1 double positive cells at pancreatic progenitor stage after EGF was added. The further increase in efficiency of differentiation reflects by increasing plating density of ES cells to 100%, and differentiation in a 6-well plate without a further change in the protocol. (E) Immunostaining of PDX1, NKX6.1, C-peptide and NGN3 in cells differentiated in the presence of EGF or EGF plus LDN at pancreatic progenitor stage. DE kit: Definitive endoderm kit; FGF7: Fibroblast growth factor 7; Vit C: L-Ascorbic acid; Cyclo: KAAD-cyclopamine; LDN: LDN193189; RA: Retinoid acid; TPB: PKC Activator V; ALK5i: TGF-β family type I receptor activin receptor-like kinase (ALK5) inhibitor; Ex4: Exendin-4; FGF10: Fibroblast growth factor 10; EGF: Endothelial growth factor. Scale bar: 100 m.

8 Supplementary Figure 2. Efficient generation of C-peptide-positive cells from INS GFP/W -hes cells (A) Flow cytometry quantification of C-peptide, NKX6.1 and Glucagon expressing cells in 3D culture and monolayer culture at the beta cell stage. The numbers indicate the percentage of each population. (B) Generation of insulin-positive clusters indicated by GFP fluorescence and immunostaining analysis for C-peptide, NKX6.1 and Glucagon. Scale bar: 100 m.

9 Supplementary Figure 3. Efficient generation of 1018-NT-beta cells from 1018-NT-ES cells (A) Gene expressions of cells throughout the differentiation from pluripotent stem cells (d0), definitive endoderm (d4), pancreatic progenitor (d11) to beta cell stage (d26). (B) Gene expressions of 1018-NT-beta clusters and human islets.

10 Supplementary Figure NT-beta cell clusters response to glucose (A) Cells affixed to a cover slide for cytosolic calcium imaging. The cells examined at the population level are circled in red. Individual cells examined at the single cell level are circled in yellow. (B) Cytosolic calcium influx signal changes upon glucose stimulation and KCl and (C) upon sequential multiple glucose stimulation and KCl. (D) Electron microscopy of 1018-NT-beta cells. Representative insulin granules are indicated by black arrows and glucagon granules are indicated by red arrows.

11 Supplementary Figure NT-beta cell clusters rescue STZ-induced diabetic mice after transplantation (A, B) Human C-peptide concentrations over time in mice serum after subcutaneous 1018-NT-beta cell transplantation (n=22) and human islets transplantation under the kidney capsule. Each line represents an individual grafted mouse. The mouse used for graft analysis in Fig. 4 was marked with an arrow. (C) Serum human C-peptide concentrations of STZ-treated mice at fasting and 30 min after intraperitoneal glucose injection. (D) Glucose tolerance test of STZ-treated mice without transplantation (n=4), transplanted with 1018-NT-beta cell clusters (n=8), and with human islets (n=3) in fed state, fasting state and min after glucose injection. (E) C-peptide and glucagon staining of mouse pancreas after STZ treatment.

12 Supplementary Figure 6. Characteristics of 1018-NT-beta cell clusters in vivo (A-C) Immunostaining of Glucagon, C-peptide, Ki67 and TUNEL on grafted cells at 1 week after transplantation under the skin. (D) Immunostaining of grafted cells isolated at 2 months after subcutaneous transplantation for alpha cell marker Glucagon, and for beta cell marker C-peptide. Note spontaneous organization into islet-like structures. (E) Grafts with cystic structures in a 6 well plate. (F, G) Cystic cells were stained for Glucagon, C-peptide, CK19 and PDX1. Scale bar: 100 m.

13 Supplementary Figure 7. Cell line authentication (A, B) DNA was extracted from indicated cell lines, and (A) Mitochondria DNA was sequenced using primers (Forward: caccattagcacccaaagct; Reverse: tgatttcacggaggatggtg) to identify the specific SNP. (B) DNA fingerprint analysis was performed by Cell Line GENETICS.

14 Reference: 1. Yamada M, Johannesson B, Sagi I, Burnett LC, Kort DH, Prosser RW, Paull D, Nestor MW, Freeby M, Greenberg E, et al. Human oocytes reprogram adult somatic nuclei of a type 1 diabetic to diploid pluripotent stem cells. Nature. 2014;510(7506): Johannesson B, Sagi I, Gore A, Paull D, Yamada M, Golav-Lev T, LeDuc C, Shen Y, Stern S, Xu N, et al. Comparable frequencies of coding mutations and loss-of-imprinting in human pluripotent cells derived by nuclear transfer and defined factors. Cell stem cell. 2014;in press( 3. Wang L, Meece K, Williams DJ, Lo KA, Zimmer M, Heinrich G, Martin Carli J, Leduc CA, Sun L, Zeltser LM, et al. Differentiation of hypothalamic-like neurons from human pluripotent stem cells. J Clin Invest. 2015;125(2): Micallef SJ, Li X, Schiesser JV, Hirst CE, Yu QC, Lim SM, Nostro MC, Elliott DA, Sarangi F, Harrison LC, et al. INS(GFP/w) human embryonic stem cells facilitate isolation of in vitro derived insulinproducing cells. Diabetologia. 2012;55(3): Goulburn AL, Alden D, Davis RP, Micallef SJ, Ng ES, Yu QC, Lim SM, Soh CL, Elliott DA, Hatzistavrou T, et al. A targeted NKX2.1 human embryonic stem cell reporter line enables identification of human basal forebrain derivatives. Stem Cells. 2011;29(3): Rezania A, Bruin JE, Arora P, Rubin A, Batushansky I, Asadi A, O'Dwyer S, Quiskamp N, Mojibian M, Albrecht T, et al. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nature biotechnology