SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps, Chiara Cianciaruso, Jaime Santo-Domingo, Miriella Pasquier, Gabriele Galliverti, Lorenzo Piemonti, Ekaterine Berishvili, Olivier Burri, Andreas Wiederkehr, Jeffrey A. Hubbell, Steinunn Baekkeskov

2 a Human islet cells, 7 days, No ARA-C Hu islets cells, 7 days, ARA-C 3 µm b Hu islets cells, 7 days, ARA-C 3 µm Beta-actin DAPI Human islet cells, 7 days, No ARA-C c Human islet cell monolayer purity Percentage endocrine cells 100% 80% 60% 40% 20% 0% No ARA-C + ARA-C Figure S1. ARA-C-mediates elimination of fibroblast-like cells from human islet monolayers during culture for seven days on collagen IV-coated coverslips in neuronal medium. (a) Transmitted light images showing human islet cells on collagen IV-coated coverslips treated or not with ARA-C (3 μm). Arrows indicate regions of fibroblast-like cells. (b) Confocal images of human islet cells treated or not with ARA-C (3 μm) and immunostained for β-actin and insulin. Nuclei were stained with DAPI. Arrows indicate regions of fibroblastlike cells. (c) Quantification of islet cell purity. Beta cells, constituting the majority of endocrine cells in the culture were identified based on insulin expression, while non-beta endocrine cells were identified by characteristic morphology similar to beta cells, easily distinguished from the much larger fibroblast-like cells. Mean ± SEM (n = 6 random image fields per condition). Statistical analysis by Student s t-test (** p < 0.01).

3 b Rat islet cell monolayer proliferation eu of total endocrine cells ro na Is le tb lm as edi u al m m ed iu m Percentage Ki67 positive Glucagon Somatostatin Ki67 Rat islet cell monolayer - Neuronal Medium 15% 10% 5% N 0% ** Human islet cell monolayer - Neuronal Medium Whole rat islet GAD65 DAPI d c Glucagon Somatostatin Ki67 a Rat islet cell monolayer Rat islet cell monolayer Calnexin GAD65 DAPI DAPI e Figure S2. Islet cell monolayer proliferation. (a) A representative confocal image of rat islet cells cultured for seven days on laminin-coated coverslips in neuronal medium and immunostained for insulin, glucagon, somatostatin and Ki67. (b) Quantification of the percentage of Ki67+ rat islet cells when cultured in neuronal medium compared to islet basal medium. Mean ± SEM. (n = 10 random image fields). Statistical analysis by Student s t-test ( p < 0.001). (c) A representative confocal image of adult human islet cells from an 18-yearold donor, cultured for seven days on collagen IV-coated coverslips in neuronal medium and immunostained for insulin, glucagon, somatostatin and Ki67. (d,e) Representative confocal microscopy images of (d) a whole rat islet and (e) a rat islet cell monolayer immunostained for insulin, the neuroendocrine protein GAD65, or calnexin. Nuclei are stained by DAPI.

4 a b c Islet Basal Medium Islet Basal Medium YC3.6cyto d e f Neuronal Medium Neuronal Medium YC3.6cyto Cyt Ca 2+ (R 530/475 nm) Cyt Ca 2+ (R 530/475 nm) mm 2.5 mm 16.7 mm Glucose 100 µm Diazoxide 35 mm KCL 16.7 mm Glucose 5 min 100 µm Diazoxide 35 mm KCL 5 min Area Under Curve / min Area Under Curve / min Islet Basal Medium Neuronal Medium mm Glucose 16.7 mm Glucose 100 µm Diazoxide 35 mm KCl 2.5 mm Glucose 16.7 mm Glucose 100 µm Diazoxide 35 mm KCl Figure S3. Comparison of calcium-responsive glucose sensing in rat islet cell monolayers cultured in islet basal medium (a-c) or neuronal medium (d-f). Cells were transduced with adenovirus to express Cameleon cytosolic Ca2+ sensor YC3.6cyto under the control of the rat insulin promoter. (a,d) Representative images of localization of YC3.6cyto in the cytosol of beta cells from islet cell monolayers cultured on laminin-coated glass in either (a) islet basal medium or (d) neuronal medium. (b,e) Representative Ca 2+ imaging experiments in primary rat beta cells cultured on laminin-coated glass in either (b) islet basal medium or (e) neuronal medium, showing simultaneously-recorded Ca 2+ traces from several beta-cells in a single field-of-view. (c,f) Quantification of the Ca 2+ signaling during each phase of the experiment in primary rat beta cells cultured on laminin-coated glass in either (c) islet basal medium or (f) neuronal medium. Mean ± SD (n = 3 independent experiments, 9-26 cells analyzed per experiment). Statistical analysis by two-way ANOVA ( p < 0.001, Tukey s post-hoc pairwise comparisons).

5 a Confocal STED Confocal 1 2 Confocal STED 1 2 c Fluorescence Intensity (a.u.) b STED Actin Fibril Profile Confocal STED distance (µm) Figure S4. Confocal and STED super-resolution microscopy of the actin cytoskeleton in rat islet cell monolayers. (a) Representative images of rat islet cells stained with Alexa Fluor 488 phalloidin show high resolution structure of the beta cell cortical actin network. (b) Increased magnification of the bounded regions shown in the lower panels of (a). (c) Transverse fluorescence intensity profile measured across a group of actin filaments shown in (b) captured by STED and compared to confocal images.

6 2 µm 1 µm Figure S5. TEM of rat islets. Representative TEM images of whole rat islets used to measure the diameter of insulin granules in Figure 5C.

7 Human islet monolayer Acetylated tubulin Pericentrin a Acetylated tubulin Pericentrin Human islet monolayer Acetylated tubulin Pericentrin b Figure S6. Confocal microscopy of primary cilia in human beta cells. (a) Left panel shows confocal analyses of primary human islet cells immunostained for insulin, the cilia marker acetylated alpha tubulin and the centrosomal protein pericentrin. Right panel, an increased magnification of the boxed region in the left panel, shows the localization of pericentrin at the base of a primary cilium originating from an insulinexpressing beta cell. (b) Three dimensional projections reconstructed from z-stacks obtained with confocal acquisitions of human islets cells immunostained for insulin, acetylated alpha tubulin and pericentrin. Arrows indicate individual cilia protruding from the apical side of human beta cells.

8 Rat islet cells in 5.5 mm glucose 100 µm Rat islet cells in 11 mm glucose 100 µm Figure S7. Glucose-dependent adhesion of rat islet cells. Representative transmitted light images of rat islet monolayer cells seeded on laminin coated glass for three days in neuronal medium containing 11 mm glucose and then switched to fresh neuronal medium containing either 5 mm or 11 mm glucose for 16 hours. The ability of cells to switch back and forth between rounded (5 mm glucose) vs a well spread (11 mm glucose) phenotype in response to a change in the glucose concentration was maintained for at least 3 days after the initial 3 day seeding period.

9 Video S1. Associated with Fig. 6. Time-lapse live-cell epifluorescence recording of rat islet beta cells expressing the genetically encoded ratiometric calcium indicator YC3.6cyto, during successive exposure to baseline glucose (2.5 mm glucose), high glucose stimulation (16.7 mm glucose), diazoxide inhibition of ATP-sensitive K+ channels, and complete depolarization (35 mm KCl). Video S2. Associated with Supplementary Fig. S3. Time-lapse live-cell epifluorescence recording of rat islet beta cells cultured on laminin coated glass in islet basal medium expressing the genetically encoded ratiometric calcium indicator YC3.6cyto, during successive exposure to baseline glucose (2.5 mm glucose), high glucose stimulation (16.7 mm glucose), diazoxide inhibition of ATP-sensitive K+ channels, and complete depolarization (35 mm KCl). Video S3. Associated with Supplementary Fig. S3. Time-lapse live-cell epifluorescence recording of rat islet beta cells cultured on laminin coated glass in neuronal medium expressing the genetically encoded ratiometric calcium indicator YC3.6cyto, during successive exposure to baseline glucose (2.5 mm glucose), high glucose stimulation (16.7 mm glucose), diazoxide inhibition of ATP-sensitive K+ channels, and complete depolarization (35 mm KCl).

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

Nature Methods: doi: /nmeth.4257

Nature Methods: doi: /nmeth.4257 Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted

Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted Ctns -/- mice. Cells immunolabeled for the proliferation marker (Ki-67) were counted in sections (n=3 WT, n=4

More information

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

Inhibition of DYRK1A stimulates human beta-cell proliferation

Inhibition of DYRK1A stimulates human beta-cell proliferation Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses Yichen Shi 1,2, Peter Kirwan 1,2, James Smith 1,2, Hugh P.C. Robinson 3 and Frederick

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment

Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment Soheila Sharghi-Namini 1, Evan Tan 1,2, Lee-Ling Sharon Ong 1, Ruowen Ge 2 * and H. Harry Asada 1,3

More information

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI

More information

J. Cell Sci. 129: doi: /jcs : Supplementary information

J. Cell Sci. 129: doi: /jcs : Supplementary information Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.

More information

islets scored 1 week month months

islets scored 1 week month months Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP

More information

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified

More information

mm Distance (mm)

mm Distance (mm) b a Magnet Illumination Coverslips MPs Objective 2575 µm 1875 µm 1575 µm 1075 µm 875 µm 545 µm 20µm 2 3 0.5 0.3mm 1 1000 100 10 1 0.1 1000 100 10 1 0.1 Field Induction (Gauss) 1.5 0 5 10 15 20 Distance

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina

More information

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547 Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

More information

Supplementary Information

Supplementary Information Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,

More information

Nature Neuroscience: doi: /nn.2275

Nature Neuroscience: doi: /nn.2275 Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.

More information

Supplemental Materials Molecular Biology of the Cell

Supplemental Materials Molecular Biology of the Cell Supplemental Materials Molecular Biology of the Cell Gilberti et al. SUPPLEMENTAL FIGURE LEGENDS: Figure S1: The effect of pharmacological inhibitors on particle uptake. The data presented in Figure 1

More information

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Distinct contributions of Na v 1.6 and Na v 1.2 in action potential initiation and backpropagation Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Supplementary figure and legend Supplementary

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Diagram of BBB and brain chips.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Diagram of BBB and brain chips. Supplementary Figure 1 Diagram of BBB and brain chips. (a) Schematic of the BBB Chip demonstrates the 3 parts of the chip, Top PDMS channel, membrane and Bottom PDMS channel; (b) Image of 2 BBB Chips,

More information

Medical School Histology Basics Introduction to Microscopy. VIBS 289 lab

Medical School Histology Basics Introduction to Microscopy. VIBS 289 lab Medical School Histology Basics Introduction to Microscopy VIBS 289 lab Larry Johnson Texas A&M University Objectives Learn the difference in magnification and resolution Learn about different types of

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

JCB. Supplemental material. Gu et al.,

JCB. Supplemental material. Gu et al., Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the

More information

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

Supplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24

Supplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24 Current Biology, Volume 24 Supplemental Information Autophagy in Oncogenic K-Ras Promotes Basal Extrusion of Epithelial Cells by Degrading S1P Gloria Slattum, Yapeng Gu, Roger Sabbadini, and Jody Rosenblatt

More information

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

More information

Supplementary Information

Supplementary Information 1 Supplementary Information A role for primary cilia in glutamatergic synaptic integration of adult-orn neurons Natsuko Kumamoto 1,4,5, Yan Gu 1,4, Jia Wang 1,4, Stephen Janoschka 1,2, Ken-Ichi Takemaru

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass

More information

Time after injection (hours) ns ns

Time after injection (hours) ns ns Platelet life span (% iotinylated platelets) 1 8 6 4 2 4 24 48 72 96 Time after injection (hours) 6 4 2 IgG GPIα GPIβ GPII GPVI Receptor expression (GeoMean, fluorescence inteity) Supplementary figure

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii

Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii María Lázaro-Díez, Itziar Chapartegui-González, Santiago Redondo-Salvo, Chike Leigh, David Merino, David San Segundo, Jesús

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome

More information

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with

More information

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by

More information

A genetically targeted optical sensor to monitor calcium signals in astrocyte processes

A genetically targeted optical sensor to monitor calcium signals in astrocyte processes A genetically targeted optical sensor to monitor calcium signals in astrocyte processes 1 Eiji Shigetomi, 1 Sebastian Kracun, 2 Michael V. Sofroniew & 1,2 *Baljit S. Khakh Ψ 1 Departments of Physiology

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Longitudinal tracking of single live cancer cells to understand cell cycle effects of the

Longitudinal tracking of single live cancer cells to understand cell cycle effects of the Longitudinal tracking of single live cancer cells to understand cell cycle effects of the nuclear export inhibitor, selinexor Joshua M. Marcus 1, Russell T. Burke 1, John A. DeSisto 1, Yosef Landesman

More information

Primary Cilia are Expressed on a Small Fraction of Cells in Trabecular Bone and Marrow

Primary Cilia are Expressed on a Small Fraction of Cells in Trabecular Bone and Marrow Primary Cilia are Expressed on a Small Fraction of Cells in Trabecular Bone and Marrow Thomas R. Coughlin 1, Muriel Voisin, Ph.D. 2, Glen L. Niebur, PhD 1, Laoise M. McNamara 2. 1 University of Notre Dame,

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed

More information

Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were

Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

Nature Medicine doi: /nm.2860

Nature Medicine doi: /nm.2860 Supplemental Figure Legends Supplemental Figure 1: Hypomorphic expression of IFT88 results in olfactory signaling proteins no longer localizing to the ciliary layer. (a) ACIII localizes to the cilia and

More information

Thursday, October 16 th

Thursday, October 16 th Thursday, October 16 th Good morning. Those of you needing to take the Enzymes and Energy Quiz will start very soon. Students who took the quiz Wednesday: Please QUIETLY work on the chapter 6 reading guide.

More information

Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense

Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense Shida Yousefi, Jeffrey A. Gold, Nicola Andina, James J. Lee, Ann M. Kelly, Evelyne

More information

Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex

Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex Supplementary Information Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex Luc Gentet, Yves Kremer, Hiroki Taniguchi, Josh Huang, Jochen Staiger and Carl

More information

Boucher et al NCOMMS B

Boucher et al NCOMMS B 1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;

More information

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male

More information

FIG S1 Replication rates of S. suis strain 10, 10Δsly, and 10cpsΔEF on mono- and virus pre-infected porcine PCLS.

FIG S1 Replication rates of S. suis strain 10, 10Δsly, and 10cpsΔEF on mono- and virus pre-infected porcine PCLS. A strain 10 10cps EF B strain 10 H1N1 + strain 10 10cps EF H1N1 + 10cps EF 10 8 10 sly 10 7 H3N2 + strain 10 H3N2 + 10cps EF CFU/ml media 10 7 10 6 10 5 10 4 CFU/ml media 10 6 10 5 10 4 10 3 0 2 4 8 12

More information

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Loss of Ena/VASP proteins inhibits filopodia and neuritogenesis. (a) Bar graph of filopodia number per stage 1 control and mmvvee (Mena/ VASP/EVL-null) neurons at 40hrs in culture. Loss of all

More information

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department

More information

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells a CD11c Na + K + ATPase Na + K + ATPase CD11c x-y CD11c Na + K + ATPase Na + K + ATPase CD11c x-z c b x-y view BoNT NAPs CD11c BoNT CD11c NAPs BoNT NAPs CD11c 90 x-z view Apical Basolateral Supplementary

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences. Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 SNARE Probes for FRET/2pFLIM Analysis Used in the Present Study. mturquoise (mtq) and Venus (Ven) are in blue and yellow, respectively. The soluble N-ethylmaleimide-sensitive

More information

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis

More information

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. a. Schematic of the V-ATPase proton pump macro-complex structure. The V1 complex is composed of

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

A Tour of the Cell Chapter 4. Outline. Early contributors to Understanding Cells. Cell Theory. Cell Size s Matt Schleiden & Ted Schann

A Tour of the Cell Chapter 4. Outline. Early contributors to Understanding Cells. Cell Theory. Cell Size s Matt Schleiden & Ted Schann A Tour of the Cell Chapter 4 Outline History of the science behind cells Cell theory & its importance Why are cells small? Microscopes Cell structure and function Prokaryotic cells Eukaryotic cells Early

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

APPLICATION SPECIFIC PROTOCOL ANGIOGENESIS... 1 TABLE OF CONTENTS... 1 MONOLAYER FORMATION... 2 OPTION 1: APPLICATION OF ANGIOGENIC STIMULI...

APPLICATION SPECIFIC PROTOCOL ANGIOGENESIS... 1 TABLE OF CONTENTS... 1 MONOLAYER FORMATION... 2 OPTION 1: APPLICATION OF ANGIOGENIC STIMULI... APPLICATION SPECIFIC PROTOCOL ANGIOGENESIS AIM 3D Cell Culture Chips offer a new perspective in studying angiogenesis by allowing the growth of new vascular sprouts in a 3D matrix from a pre-existing endothelial

More information

Nature Medicine: doi: /nm.4322

Nature Medicine: doi: /nm.4322 1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Results and discussion

Results and discussion Supplementary Figure 1. Assessment of the cross-talk between FuraPE3 and D4ER fluorescent spectra. Cells were perifused with 15 mmol/l glucose (G15) in the presence of 250 µmol/l of the KATP channel opener

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES. !! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions

More information

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

d e f Spatiotemporal quantification of subcellular ATP levels in a single HeLa cell during changes in morphology Supplementary Information

d e f Spatiotemporal quantification of subcellular ATP levels in a single HeLa cell during changes in morphology Supplementary Information Ca 2+ level (a. u.) Area (a. u.) Normalized distance Normalized distance Center Edge Center Edge Relative ATP level Relative ATP level Supplementary Information Spatiotemporal quantification of subcellular

More information

Chapter 6: A Tour of the Cell. 1. Studying Cells 2. Intracellular Structures 3. The Cytoskeleton 4. Extracellular Structures

Chapter 6: A Tour of the Cell. 1. Studying Cells 2. Intracellular Structures 3. The Cytoskeleton 4. Extracellular Structures Chapter 6: A Tour of the Cell 1. Studying Cells 2. Intracellular Structures 3. The Cytoskeleton 4. Extracellular Structures 1. Studying Cells Concepts of Microscopy MAGNIFICATION factor by which the image

More information

1. Studying Cells. Concepts of Microscopy 11/7/2016. Chapter 6: A Tour of the Cell

1. Studying Cells. Concepts of Microscopy 11/7/2016. Chapter 6: A Tour of the Cell Electron microscope Light microscope Unaided eye 11/7/2016 Chapter 6: A Tour of the Cell 1. Studying Cells 2. Intracellular Structures 3. The Cytoskeleton 4. Extracellular Structures 1. Studying Cells

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Control of Glucose Metabolism

Control of Glucose Metabolism Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale

Supplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale Supplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale (b) show stronger immunolabeling for CB 1 than those in

More information

Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) (B) (C) (D) (E)

Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) (B) (C) (D) (E) Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) Confocal images of septal olfactory epithelium of an adult Gγ8-sypGFP-tdTom mouse showing colocalization

More information