Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice

Mice( Dissertation_ 全文 ) https://doi.org/ /doctor.k19

Impact of Sox9 Dosage and Hes1-medi TitleControlling the Plasticity of Adult Mice( Dissertation_ 全文 ) Author(s) Hosokawa, Shinichi Citation Kyoto University ( 京都大学 ) Issue Date 2015-07-23 URL https://doi.org/10.14989/doctor.k19

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

Supplementary Figure 1. Satellite cell contribution to myofibers in whole. gastrocnemius/plantaris/soleus, diaphragm, and EOM of 12 or 20 month

Keefe et al. p. 1 Supplementary Figure 1. Satellite cell contribution to myofibers in whole muscles. (a-l) Representative cross-sections through whole TA/EDL, gastrocnemius/plantaris/soleus, diaphragm,

Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study

Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria,

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

Fig. S1. Generation of pancreas-specific Stard13 PA-deleted mice. (A) Schematic representation of the targeted Stard13 flox allele, indicating the

Fig. S1. Generation of pancreas-specific Stard13 PA-deleted mice. (A) Schematic representation of the targeted Stard13 flox allele, indicating the loxp sites (in pink) flanking exon 5 of the gene, FRT-flanked-Hygromicin,

Title Diabetes Caused by Elastase-Cre-Med in Mice Kodama, Sota; Nakano, Yasuhiro; Hir Author(s) Kenichiro; Horiguchi, Masashi; Kuha Toshihiko; Kawaguchi, Michiya; Gann Christopher V. E.; Uemoto, Shinji;

Supplementary Figure 1.

Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass

Analysis of the plasticity of duct cells in the embryonic and adult pancreas. Myriam Solar Hospital Clinic de Barcelona Barcelona 2009

Analysis of the plasticity of duct cells in the embryonic and adult pancreas Myriam Solar Hospital Clinic de Barcelona Barcelona 2009 Major periods of formation of new β-cells: 1- Embryogenesis (secondary

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions Yi Feng, Peng Cui, Xiaowei Lu, Brian Hsueh, Fredrik Möller Billig, Livia Zarnescu Yanez, Raju Tomer, Derek

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression

a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2697 Figure S1 Cytokeratin 5 is a specific marker for basal and intermediate cells in all mouse prostate lobes. (a) Immunofluorescence staining showing co-localization of YFP with p63 in

Supplementary Figure 1

Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

Supplementary Figure 1

Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged

Spatiotemporally regulated expression of transcription

ORIGINAL ARTICLE Reduction of Ptf1a Gene Dosage Causes Pancreatic Hypoplasia and Diabetes in Mice Akihisa Fukuda, 1,2,3 Yoshiya Kawaguchi, 1 Kenichiro Furuyama, 1 Sota Kodama, 1 Masashi Horiguchi, 1 Takeshi

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses

Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.

Supplementary Figure 1. himeric analysis of inner ears. (A-H) himeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears. (A,B) omposite images showing three colors in different vestibular

Nature Neuroscience: doi: /nn Supplementary Figure 1. Iliopsoas and quadratus lumborum motor neurons in the L2 spinal segment.

Supplementary Figure 1 Iliopsoas and quadratus lumborum motor neurons in the L2 spinal segment. (A) IL and QL motor neurons were labeled after CTb-488 (green) muscle injections at birth. At P4, the L2

Polyclonal Secondary Antibodies

Polyclonal Secondary Antibodies Quality Antibodies for Quality Research Mouse Ig Goat Human Ig 1010 Ig Goat F(ab ) 2 Human Ig 1012 IgA Goat 1040 IgE Goat 1110 IgG Goat Human Ig 1030 IgG Fab Goat 1015 IgG

Ectopic pancreas formation in Hes1-knockout mice reveals plasticity of endodermal progenitors of the gut, bile duct, and pancreas

Research article Ectopic pancreas formation in Hes1-knockout mice reveals plasticity of endodermal progenitors of the gut, bile duct, and pancreas Akihisa Fukuda, 1,2,3 Yoshiya Kawaguchi, 1,4 Kenichiro

Supporting Information

Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

Supplementary Figure 1

Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

Supplementary Figure 1

Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

Supporting Information

Supporting Information Song et al. 10.1073/pnas.1207238109 SI Materials and Methods Mice. To produce the GRP reer mouse line, the translational start TG in the mouse GRP genomic locus was replaced with

Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors

Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors Ka-Cheuk Liu, Gunter Leuckx, Daisuke Sakano, Philip A. Seymour, Charlotte L. Mattsson, Linn Rautio, Willem Staels, Yannick Verdonck,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature

Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez

Developmental Biology

Developmental Biology 334 (2009) 285 298 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology Pdk1 activity controls proliferation, survival,

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

Supplementary Information

Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

Supplementary Materials for

www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

Preferential reduction of β cells derived from Pax6 MafB pathway in MafB deficient mice

Available online at www.sciencedirect.com Developmental Biology 314 (2008) 443 456 www.elsevier.com/developmentalbiology Genomes & Developmental Control Preferential reduction of β cells derived from Pax6

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,

Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines

Supplementary Figure 1

VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

SUPPLEMENTARY INFORMATION

Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

Supplemental Information

Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding

Supporting Information

Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken

Supplemental Information Garmy-Susini, et al., PI3Kα activates integrin α4β1 to establish a metastatic niche in lymph nodes

Supplemental Information Garmy-Susini, et al., PI3Kα activates integrin α4β1 to establish a metastatic niche in lymph nodes Supplementary Figure 1: Lymphangiogenesis and metastasis in lymph nodes of tumorbearing

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

Sox9: A Master Regulator of the Pancreatic Program. Philip A. Seymour

Reprint from The Review of DIABETIC STUDIES Vol 11 No 1 2014 Special Edition Stem Cells and Pancreas Regeneration The Review of DIABETIC STUDIES Sox9: A Master Regulator of the Pancreatic Program Philip

Identification of Sox9-Dependent Acinar-to-Ductal Reprogramming as the Principal Mechanism for Initiation of Pancreatic Ductal Adenocarcinoma

Article Identification of Sox9-Dependent Acinar-to-Ductal Reprogramming as the Principal Mechanism for Initiation of Pancreatic Ductal Adenocarcinoma Janel L. Kopp, 1,6 Guido von Figura, 2,6 Erin Mayes,

SUPPLEMENTARY INFORMATION

Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.

Quantification of early stage lesions for loss of p53 should be shown in the main figures.

Reviewer #1 (Remarks to the Author): Expert in prostate cancer The manuscript "Clonal dynamics following p53 loss of heterozygosity in Kras-driven cancers" uses a number of novel genetically engineered

In vitro differentiation optimization Flow Cytometry

In vitro differentiation optimization The effect of various basal media formulations were examined during stages 3 4 of the differentiation protocol. For these studies, conditions were as described for

IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells

IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells Jennifer A. Mitchel, Silvio Antoniak, Joo-Hyeon Lee, Sae-Hoon Kim, Maureen McGill, David I. Kasahara,

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Primary Children s Hospital, Salt Lake City, UT, both

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

Supplementary Materials and Methods

Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or

Supplemental Materials, Nishimura et al, Page1 of 22 1

Supplemental Materials, Nishimura et al, Page of 5 Quantitative assessment of Pdx promoter activity in vivo using a secreted luciferase reporter system 6 7 8 9 Wataru Nishimura, Koki Eto, Atsushi Miki,

Acinar cells in the neonatal pancreas grow by self-duplication and not by neogenesis from duct cells Houbracken, Isabelle; Bouwens, Luc

Vrije Universiteit Brussel Acinar cells in the neonatal pancreas grow by self-duplication and not by neogenesis from duct cells Houbracken, Isabelle; Bouwens, Luc Published in: Scientific Reports DOI:

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

Boucher et al NCOMMS B

1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;

Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by

Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into

SUPPLEMENTARY DATA. Supplementary experimental procedures

Supplementary experimental procedures Glucose tolerance, insulin secretion and insulin tolerance tests Glucose tolerance test (GTT) and glucose stimulated insulin secretion (GSIS) was measured in over-night

Islets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled

Are adult pancreatic beta cells formed by self-duplication or stem cell differentiation? Introduction Researchers have long been interested in how tissues produce and maintain the correct number of cells

A Notch-dependent molecular circuitry initiates pancreatic endocrine and ductal cell differentiation

2488 AND STEM CELLS Development 139, 2488-2499 (2012) doi:10.1242/dev.078634 2012. Published by The Company of Biologists Ltd A Notch-dependent molecular circuitry initiates pancreatic endocrine and ductal

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

A 10.8 kb ghr fragment containing exons 4 and 5 was PCR amplified with Pfu Turbo. DNA polymerase (Stratagene) and cloned into pcr Blunt II-TOPO vector

Supplemental Method: Generation of a conditional GHR knockout mice. A 1.8 kb ghr fragment containing exons 4 and 5 was PCR amplified with Pfu Turbo DNA polymerase (Stratagene) and cloned into pcr Blunt

Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors

Development 129, 2447-2457 (2002) Printed in Great Britain The Company of Biologists Limited 2002 DEV3582 2447 Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct

Supporting Information

Supporting Information Soltani et al. 10.1073/pnas.1102715108 SI Experimental Procedures Evaluation of Mice and Drug Administration. IPGTT, insulin tolerance test, and glucagon tolerance test were performed

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.

Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific

SUPPLEMENTARY INFORMATION

doi: 10.1038/nature07173 SUPPLEMENTARY INFORMATION Supplementary Figure Legends: Supplementary Figure 1: Model of SSC and CPC divisions a, Somatic stem cells (SSC) reside adjacent to the hub (red), self-renew

Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC

Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya

Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue

Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue Kevin Docherty University of Aberdeen ELRIG Drug Discovery 2016 ACC Liverpool 14 th October 2016 Autoimmune destruction

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

Pancreas-specific deletion of mouse Gata4 and Gata6 causes pancreatic agenesis

Research article Related Commentary, page 3469 Pancreas-specific deletion of mouse Gata4 and Gata6 causes pancreatic agenesis Shouhong Xuan, 1 Matthew J. Borok, 1 Kimberly J. Decker, 2 Michele A. Battle,

SUPPLEMENTARY INFORMATION

b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

Biochemical and Biophysical Research Communications

Biochemical and Biophysical Research Communications 399 (2010) 440 445 Contents lists available at ScienceDirect Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

DEVELOPMENT. Shelley B. Nelson, Ashleigh E. Schaffer and Maike Sander*

RESEARCH ARTICLE 2491 Development 134, 2491-2500 (2007) doi:10.1242/dev.002691 The transcription factors Nkx6.1 and Nkx6.2 possess equivalent activities in promoting beta-cell fate specification in Pdx1