Philip Osdoby 1,2. Metabolism, Washington University Medical School, St. Louis, MO 63110, and 3 Department of

Transcription

1 JBC Papers in Press. Published on March 23, 2001 as Manuscript M RANKL and OPG expression by human microvascular endothelial cells, regulation by inflammatory cytokines, and role in human osteoclastogenesis Patricia Collin-Osdoby 1,2, Linda Rothe 1, Fred Anderson 1, Maureen Nelson 1, William Maloney 3, and Philip Osdoby 1,2 1 Department of Biology, Washington University, St. Louis, MO 63130, 2 Division of Bone and Mineral Metabolism, Washington University Medical School, St. Louis, MO 63110, and 3 Department of Orthopedics, Washington University Medical School, St. Louis, MO Running title: Cytokines induce RANKL/OPG in HMVEC and human OC resorption Please send all correspondence, proofs, offprints, and reprint requests to: Patricia Collin-Osdoby, Ph.D. Department of Biology, Box 1229 Washington University St. Louis, MO Tel: (314) Fax: (314) Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

2 2

3 SUMMARY Receptor activator of NF-κB (RANKL) is the essential signal required for full osteoclast (OC) development, activation and survival. RANKL is highly expressed in areas of trabecular bone remodeling and inflammatory bone loss, increased on marrow stromal cells or osteoblasts by osteotropic hormones or cytokines, and neutralized by osteoprotegerin (OPG), a soluble decoy receptor also crucial for preventing arterial calcification. Vascular endothelial cells (VEC) are critically involved in bone development and remodeling, and influence OC recruitment, formation, and activity. Although OC develop and function in close association with bone VEC and sinusoids, signals mediating their interactions are not well known. Here, we show for the first time that human microvascular endothelial cells (HMVEC) express transcripts for both RANKL and OPG, inflammatory cytokines TNF-α and IL-1α elevate RANKL and OPG expression 5- to 40-fold in HMVEC (with an early OPG peak that declines as RANKL rises), and RANKL protein increases on the surface of TNF-α activated HMVEC. Cytokine activated HMVEC promoted the formation, fusion, and bone-resorption of OC formed in co-cultures with circulating human monocytic precursors, via a RANKL-mediated mechanism fully antagonized by exogenous OPG. Furthermore, paraffin sections of human osteoporotic fractured bone exhibited increased RANKL immunostaining in vivo on VEC located near resorbing OC in regions undergoing active bone turnover. Therefore, cytokine-activated VEC may contribute to inflammatory-mediated bone loss via regulated production of RANKL and OPG. VEC-derived OPG may also serve as an autocrine signal to inhibit blood vessel calcification. 3

4 INTRODUCTION Receptor activator of NF-κB ligand (RANKL), also known as osteoprotegerin ligand (OPGL), osteoclast differentiation factor (ODF), or TNF-related activation induced cytokine (TRANCE), is a recently discovered transmembrane molecule of the tumor necrosis factor (TNF) ligand superfamily that is highly expressed in lymphoid tissues and trabecular bone, particularly in areas associated with active bone remodeling or inflammatory osteolysis 1-4. RANKL is the essential and final common signal required both in vitro and in vivo for full osteoclastic (OC) differentiation from multipotential hematopoietic precursor cells into mature multinucleated bone-resorptive OC in the presence of the permissive factor macrophage colony stimulating factor (M-CSF) 1-7. RANKL expressed on the surface of osteoblasts (OB) or bone marrow stromal cells (BMSC) interacts with a cell surface receptor, RANK, present on pre-oc (induced by M-CSF) and mature OC to stimulate their fusion, development, bone resorption, and cell survival 5-9. RANKL expression increases during early OB development and is upregulated in OB and BMSC by various pro-resorptive stimuli such as parathyroid hormone (PTH), 1,25-dihydroxyvitamin D3 (VD3), dexamethasone (Dex), prostaglandin E2 (PGE2), or interleukin-11 (IL-11) 6, Recently, the pro-resorptive inflammatory cytokines TNF-α and IL-1β were also shown to elevate RANKL mrna levels in human BMSC and MG63 osteosarcoma cells 13. Targeted ablation of RANKL in mice results in suppressed osteoclastogenesis and an osteopetrotic phenotype 14, whereas RANKL administration into normal adult mice elicits increased OC size and activation (but not numbers) and systemic hypercalcemia 5. Osteoprotegerin (OPG, also known as osteoclastogenesis inhibitory factor or OCIF) is a naturally-occurring soluble member of the TNF receptor superfamily that is widely expressed in multiple tissues and binds to 1 Abbreviations used in this paper: RANKL, receptor activator of NF-κB; ODF, osteoclast differentiation factor; TRANCE, TNF-related activation induced cytokine; OPGL, osteoprotegerin ligand; OPG, osteoprotegerin; RANK, receptor activator of NF-κB; TNF-α, tumor necrosis factor-α; IL-1α, interleukin-1α; M-CSF, macrophage colony stimulating factor; VD3, 1,25-dihydroxyvitamin D3; Dex, dexamethasone; PTH, parathyroid horomone; OC, osteoclast; VEC, vascular endothelial cells; HMVEC, human microvascular 4

5 endothelial cells; (H)OB, (human) osteoblast; (H)BMSC, (human) bone marrow stromal cells; PBMC, peripheral blood mononuclear cell; MNC, multinucleated cell; EGM-MV, essential growth medium-microvascular; EBM, essential basal medium; α-mem, α- minimal essential medium; FBS, fetal bovine serum; CM, conditioned medium; HBSS, Hanks balanced salt solution; PF, paraformaldehyde; BSA, bovine serum albumin; Mab, monoclonal antibody; Pab, polyclonal antibody; TRAP, tartrate resistant acid phosphatase. RANKL, thereby neutralizing its function 1-4. OPG therefore acts as a secreted decoy receptor to negatively regulate OC differentiation, activity, and survival both in vivo and in vitro 15,16. OPG production by OB and BMSC is regulated by calcitropic hormones and cytokines, and the balance in the ratio of RANKL to OPG critically determines net effects on OC development and bone resorption 1-4,11. In vivo administration of OPG to normal rats reduces osteoclastogenesis and increases bone density, OPG prevents estrogen deficiencyassociated bone loss in ovariectomized animals, and transgenic mice over-expressing OPG exhibit increased bone density and severe osteopetrosis 15. Conversely, mice deficient in OPG display increased OC development and activity, early onset osteoporosis, and arterial calcification 17,18. Thus, OPG has been proposed to regulate bone resorption both locally and systemically, as well as to serve as a physiological suppressive signal of local calcification in blood vessels 2,17. Vascular endothelial cells (VEC) are intimately associated with pre-oc and OC during both their formation and resorption of bone This close physical interaction permits VEC to directly influence and convey local and systemic regulatory signals for OC development and bone remodeling under normal or pathological conditions Recent studies indicate that many pre-oc reside in the peripheral circulation as well as in the bone marrow Circulating pre-oc may therefore also be exposed to and potentially activated by signaling molecules displayed on the VEC surface during and following their transmigration across the VEC layer of blood vessels in response to local stimulatory signals to reach the bone microenvironment. Although all OC develop and function in close association with the VEC and sinusoids of bone, specific signals mediating interactions between these cells are not well known. Because VEC function as primary immune response cells 5

6 that are potently activated by TNF-α and IL-1 27,28, we investigated whether primary human VEC expressed RANKL and/or OPG, and if such expression was regulated by these or other pro-resorptive stimuli. The functional consequences of RANKL expression and regulation in HMVEC were assessed relative to the in vitro development and activity of multinucleated bone-resorptive OC from precursors present in human peripheral blood mononuclear cell preparations. 6

7 EXPERIMENTAL PROCEDURES HMVEC culture and treatments. Primary human microvascular endothelial cells (HMVEC) of normal adult female dermal tissue origin, media (essential growth medium-microvascular, EGM-MV, and essential basal medium, EBM), and media supplements (packaged as SingleQuots containing human recombinant epidermal growth factor, hydrocortisone, gentamicin, bovine brain extract, and fetal bovine serum, FBS) were obtained from Clonetics Corporation (San Diego, CA). HMVEC were grown, subcultured by trypsin/edta, and used within 4 passages as recommended. HMVEC expressed all the hallmark characteristics of endothelial cells (morphology, tubule formation, acetylated LDL uptake, Factor VIII expression, PECAM-1, ICAM-1, VCAM- 1, ELAM-1, P-selectin, ACE, and vimentin, and no smooth muscle α-actin). For molecular analyses, HMVEC were cultured to near confluence in 24-well dishes in EGM-MV complete medium (with supplements and 5% FBS), modulators were administered the next day in fresh medium, and the cells were incubated for the times indicated before RNA was harvested. For withdrawl experiments, the modulator medium was removed after the induction period, the cells were rinsed twice briefly with fresh medium, and the cells were cultured in medium without modulator for various times before RNA was harvested. Cytokine release by HMVEC was evaluated in cells grown to near confluence in EGM-MV complete medium and switched to phenol red-free EBM (lacking supplements) plus 5% FBS for 16 to 24h before modulators were administered in fresh medium. The conditioned medium (CM, briefly centrifuged) and cells were harvested after 24h and stored at 80 C until analyzed for cytokine and protein levels, respectively. Modulators used were: 1,25-dihydroxyvitamin D3 (VD3, a gift of Hoffman-La Roche, Nutley, NJ), dexamethasone (Dex) and human parathyroid hormone 1-34 (PTH 1-34; both from Sigma Chemical Company, St. Louis, MO), and human recombinant cytokines TNF-α, IL-1α, and M-CSF (all from R & D Systems, Minneapolis, MN). Primary human osteoblast and bone marrow stromal cell populations. Primary human osteoblasts (HOB) were obtained as cultured outgrowth cells from trabecular bone explants according to the Robey/Termine method as 7

8 described previously 29. Human bone marrow stromal cells (HBMSC) were isolated from discarded thoracic rib surgical specimens or bone obtained from accident victims and cultured in α-mem with 10% FBS and 1% antibiotic/antimycotic (GIBCO BRL, Gaithersburg, MD), with or without Dex (100 nm) and VD3 (10 nm) to promote a more OB-like phenotype as described previously 29,30. RNA isolation and RT-PCR analysis. RNA was isolated from cells using RNA STAT-60 (Tel-Test, Incorporated, Friendswood, TX). Semi-quantitative RT-PCR amplification for RANKL was performed using forward and reverse primers (designed by Drs. N. Weitzmann and L. Rifas, Washington University, St. Louis, MO) to the extracellular region of OPGL/TRANCE/RANKL (nucleotides 4-735) of cloned human TRANCE (nucleotides 1-738, GenBank accession # AF013171) and Amersham Ready-To-Go RT-PCR beads. Oligonucleotide primers were: forward 5 -GCTCTAGAGCCATGGATCCTAATAGAAT-3, reverse 5 - ATCTCGAGTCACTATTAATGATGATGATGATGATGATCTATATCTCGAACTTTAAAAGCC-3. RT- PCR amplification for OPG was performed using forward and reverse primers to cloned human OPG (GenBank accession # U94332): forward 5 -GGGGACCACAATGAACAAGTTG-3 (nucleotides ), reverse 5 - AGCTTGCACCACTCCAAATCC-3 (nucleotides ) 31. Parallel reactions were performed for every assay using primers designed to amplify human GAPDH as described previously 32. Initial trials were performed using RNA obtained from unstimulated cultures as well as each modulator treatment to establish optimal cycle numbers and RNA amounts for routine use so that RT-PCR reactions would yield RANKL, OPG, and GAPDH amplifications within an exponentially linear range over the amount of input RNA used. Thus, cycle numbers were varied from 20 to 35 (OPG), 30 to 35 (RANKL), and 15 to 35 (GDH), and RNA amounts from 0.15 ng to 1.5 ug (OPG), 25 ng to 12 ug (RANKL), and 1 pg to 4 ug (GDH), in up to 6 replicate trials each. No products were obtained in controls lacking either RNA or first strand primers, and amplified products were not eliminated or reduced by DNAse treatment of the RNA samples. Conditions were chosen that consistently provided mid- 8

9 linear range amplification of each PCR product for all further studies. Therefore, PCR reactions were run at 94 C for 1 minute, 60 C for 1 minute, and 72 C for 2 minutes for 35 (RANKL), 26 (OPG) or 20 (GAPDH) cycles. Products were separated by agarose gel electrophoresis, visualized by ethidium bromide staining, photographed using a Polaroid camera, and quantified in a scanner (Scanjet II, Hewlett-Packard, CA) computer linked to a Quantimet image analysis system (Leica, United Kingdom). RANKL or OPG signals were normalized to GAPDH signals determined in parallel for each sample, and data was expressed as a percentage of the RANKL/GAPDH or OPG/GAPDH ratio for untreated HMVEC measured in the same trial. The 731 bp RANKL and 408 bp OPG amplicons generated by RT-PCR from HMVEC (as well as HOB and HBMSC) were directly sequenced using an ABI Prism Cycle Sequencing kit (Perkin-Elmer, CA) and DNA sequences compared to published sequences to confirm their identity using computation performed at the NCBI and the BLAST network service. Quantification of cytokine secretion by HMVEC. Cytokine levels in CM were measured using specific enzymelinked immunoassay kits (Quantikine kits, R & D Systems, Minneapolis, MN) for human IL-1β, TNF-α, and M-CSF as recommended. Standard curves were run with each assay, control medium was analyzed for background levels of each cytokine (which were insignificant), and modulators were tested in at least 3 separate culture wells per trial for 2 to 8 independent HMVEC cultures. Results were normalized for cell protein using the bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL) and bovine serum albumin (BSA) as a standard 33, and data expressed as the mean ± SEM ng/ml of cytokine released per mg cell protein during 24h of culture. Immunodetection of RANKL protein expression on HMVEC. HMVEC were cultured in EGM-MV complete medium on glass coverslips in 24-well tissue culture dishes to near confluency, TNF-α (1 nm) was administered in fresh medium for 24h, and the cells were fixed and immunostained 34. Briefly, HMVEC were 9

10 rinsed, fixed in 3% paraformaldehyde/hbss (15 min), rinsed, blocked for 1h with 1% BSA and 10% horse serum in phosphate buffered saline (PBS), and reacted for 1h with (or without) primary antibodies diluted in block. Mouse monoclonal antibodies (Mab) specific for human ICAM-1 or VCAM-1 (Serotec, Raleigh, NC, each at 1:200 dilution), Mab to the angiogenesis-related integrin αvβ3 (LM 609, Chemicon International, Temecula, CA, 1:100 dilution), and goat polyclonal antibody (Pab) raised to a C-terminal extracellular peptide region of human RANKL (Santa Cruz Biotechnology, Santa Cruz, CA, 1:100 dilution) were used. Primary antibody binding was detected using a secondary goat anti-mouse FITC conjugate (GIBCO BRL, Gaithersburg, MD; 1:200) for Mabs or a biotinylated donkey anti-goat antibody (Santa Cruz; 1:200) followed by a streptavidin-texas Red conjugate (GIBCO BRL; 1:1000) for RANKL Pab. In some cases, HMVEC were simultaneously immunostained for both ICAM-1 and RANKL to visualize their co-localization on the HMVEC plasma membrane. Coverslips were mounted on glass microscope slides in glycerol buffered mounting medium (Becton Dickinson, Cockeysville, MD), and images were viewed and digitally captured using a Leica scanning laser (argon/krypton/he) confocal microscope (TCS-SP-2) equipped with a 20X phase objective. Wavelengths for excitation and emission for FITC were 494 nm and 518 nm, respectively, and those for Texas Red were 595 nm and 615 nm, respectively. RANKL immunodetection in paraffin embedded sections of human osteoporotic bone. Human osteoporotic bone was obtained from fractured femoral heads discarded during hip replacement surgery and briefly held at 4 C in α-mem before fixation in 10% buffered formalin. Samples were decalcified, paraffin embedded, and sectioned by standard procedures. Sections were prepared for immunostaining by deparaffinization in xylene, hydration through 100% EtOH, 95% EtOH, and water, and heating (97 C, 20 ) in an antigen unmasking Target Retrieval Solution (DAKO Corporation, Carprinteria, CA). Cooled sections were PBS rinsed, endogenous peroxidase activity was quenched in DAKO Peroxidase Blocking reagent (15 ), rinsed sections were blocked with DAKO serum-free Protein Block (10 ), and sections were reacted overnight at 4 C with the Pab to human 10

11 RANKL described above (diluted 1:500 to 1:1000 in PBS + 1.5% DAKO Protein Block). Sections were rinsed, incubated with biotinylated donkey anti-goat Pab (Santa Cruz, 1:100 dilution in PBS/block, 45 ) followed by DAKO streptavidin-peroxidase (1:300 in PBS, 15 ), reacted with DAKO DAB solution (5 ), briefly counterstained using DAKO hematoxylin solution, and mounted on glass slides with Permount. Immunostained sections were viewed by light microscopy and images digitally captured using a computer-linked Olympus microscope. OC development in human peripheral blood mononuclear cells (PBMC) co-cultured with HMVEC. HMVEC were cultured in 24-well dishes in EGM complete medium to near confluency, two-thirds of the wells were treated for 48 h with either 1 nm of TNF-α or IL-1α to maximally induce RANKL (while allowing stimulated OPG levels to decline), and the cells were washed (3x) to remove cytokines just prior to the addition of human PBMC for co-culture. Human PBMC were prepared from heparinized blood obtained from the American Red Cross (St. Louis, MO). Mononuclear cells were isolated by Ficoll/Hypaque 26,32,33, resuspended in α-mem plus 10% FBS and 1% antibiotic/antimycotic, and added (1.6 x 10 6 PBMC/well) to the 24-well dish containing unactivated or cytokine pre-activated HMVEC. Some wells also received 100 ng/ml recombinant human OPG:Fc fusion peptide (Alexis Corporation, San Diego, CA). The next day (day 1) all wells were treated with 10 nm VD3 and 25 ng/ml M-CSF, and OPG:Fc was readministered to the wells originally receiving this treatment. On day 5 the cells were refed with M-CSF, with or without OPG:Fc, and the cells were harvested on day 7, rinsed, fixed in 3% PF/HBSS, rinsed, and stained for TRAP activity 34,35,36. Cells were co-stained with DAPI (Molecular Probes, Eugene, OR) to label nuclei, and the numbers of mononuclear and multinucleated TRAP+ cells, as well as the number of nuclei per TRAP+ cell, were counted (encompassing ~ 2000 to 7000 TRAP+ cells per condition per trial) across a constant number of sequential random fields using an Olympus light and fluorescent microscope. To simultaneously evaluate OC formation and acquisition of bone resorbing 11

12 capability, HMVEC were cultured in 24-well dishes in EGM complete medium to near confluency, half the wells were pre-activated with TNF-α (1 nm, 21h), HMVEC were washed, and human PBMC were added (1.6 x 10 6 PBMC/well) and initially co-cultured with VD3 and M-CSF, with or without OPG:Fc, as above. Every fourth day, cells were refed with M-CSF with or without OPG:Fc, a small circular disc of ivory was added to each well on day 9, and the cells and ivory pieces were harvested on day 16, rinsed, fixed in 1% PF/HBSS, rinsed, and stained for TRAP activity 34,35,36. Cells in the wells were co-stained with DAPI and analyzed for the numbers of TRAP+ cells formed and nuclei per cell. Ivory was subjected to resorption pit analysis (below). Parallel human PBMC were cultured alone (without HMVEC) with VD3 and M-CSF, in the presence or absence of human recombinant RANKL (75 ng/ml, Alexis Corporation, San Diego, CA) and/or OPG:Fc fusion peptide (100 ng/ml), according to the same feeding regimen used for the co-cultures, and the cells and ivory were harvested on day 16 for analysis as in the co-cultures. Bone pit resorption analysis. The number of TRAP+ cells was determined for a constant number (40) of random fields per ivory piece, the cells were then removed, and bone pit resorption within these same fields was quantified using a computer-linked dark-field reflective light microscopic image analysis system 34,35,36. TRAP+ cell counts on the ivory include both MNC and mononuclear cells (since DAPI nuclear staining cannot be used on ivory to distinguish between them). The total area (µm 2 ) of ivory resorbed, number of pits formed, and size of each excavation were assessed. Results were also normalized to TRAP+ cell numbers in order to compare the mean area of bone resorbed per TRAP+ cell (area/trap+ cell) and number of pits formed per TRAP+ cell (pits/trap+ cell). More than 2000 TRAP+ cells and their associated resorption pits were evaluated per co-culture trial. Data shown are presented as means ± standard error of the mean (SEM) from a representative co-culture trial performed in triplicate. 12

13 Statistical analysis. Data are presented as the mean ± SEM of 3 to 12 independent trials, typically having at least 3 replicates per condition and assayed at least in duplicate. Differences between treatments were analyzed using single-factor ANOVA. For simultaneous comparisons between multiple treatments, significant differences were determined using the post-anova Bonferroni test. Differences were considered significant for P <

14 Results: Primary HMVEC express mrna for both RANKL and OPG. RT-PCR using specific primers to cloned human OPGL/TRANCE/RANKL (hereafter referred to as RANKL) yielded a single amplicon product of the expected size (731 bp) from primary HMVEC, as well as from primary HOB and HBMSC (Fig. 1A). Complete nucleotide sequencing of the products obtained from HMVEC and HBMSC demonstrated their identity to sequences previously reported for cloned human OPGL (GenBank accession #AF053712), RANKL (#AF019047) and TRANCE (#AF013171). RT-PCR using specific primers to cloned human OPG also yielded a single amplicon product of the expected size (408 bp) from each of these three primary human cell types (Fig. 1B), and complete nucleotide sequencing of these three products showed that they matched the sequence reported for cloned human OPG (GenBank accession #U94332). Therefore, HMVEC express mrna transcripts for both RANKL and OPG. HMVEC differ from HBMSC in their hormonal regulation of RANKL and OPG. Because RANKL and OPG mrna levels are regulated during OB differentiation and stimulated by PTH or VD3 (alone or in combination with Dex) in OB or stromal cells, the modulatory actions of these hormones on RANKL and OPG mrna expression were studied in HMVEC using semi-quantitative RT-PCR. Treatment of HMVEC for 6, 24, or 72h with PTH 1-34 (500 nm) or VD3 (10 nm) and Dex (100 nm) had no effect on either RANKL or OPG mrna expression levels normalized to GAPDH in comparison with untreated HMVEC cultured for the same time periods (Fig. 2A and C). By contrast, HBMSC differentiated with VD3 and Dex over 8 days of culture exhibited a 1.5-fold increase in RANKL/GAPDH mrna levels (Fig. 2B), and a remarkable 10-fold decrease in OPG/GAPDH mrna levels (Fig. 2D), in comparison with untreated HBMSC. Although RANKL/GAPDH mrna expression was higher in HOB than in VD3/Dex differentiated HBMSC (Fig. 2B), OPG/GAPDH mrna expression was also significantly higher in HOB (Fig. 2D). Consequently, VD3/Dex differentiation of HBMSC raised the relative GAPDH normalized ratio of RANKL to OPG mrna expression (in arbitrary 14

15 densitometric units) from 0.04 in untreated HBMSC to 0.63 in VD3/Dex treated HBMSC, a value close to the RANKL/OPG mrna expression ratio associated with primary HOB (0.86) and HMVEC (set at 1.0). Therefore, RANKL and OPG mrna levels are regulated by these calcitropic hormones in HBMSC but not in HMVEC under the conditions tested. TNF-α increases both RANKL and OPG mrna levels in HMVEC but with temporally different kinetics. HMVEC are highly responsive to inflammatory signals such as TNF-α and IL-1α, and each of these potent immune activators increases RANKL and OPG mrna levels in HBMSC. TNF-α and IL-1α were therefore tested for their potential effects on RANKL and OPG mrna expression in HMVEC. TNF-α significantly and dose-dependently increased both RANKL and OPG mrna levels in HMVEC by 24h as measured by semiquantitative RT-PCR (Fig. 3A and C). Although maximal induction of both RANKL and OPG were achieved with 1 to 10 nm TNF-α, OPG mrna levels were increased further (25-fold) than RANKL mrna levels (5- fold) in relation to their expression levels in untreated HMVEC. Analysis of the temporal kinetics of RANKL mrna expression by TNF-α (1 nm) revealed that stimulation was first apparent at 10h post-treatment, rose to a maximal 3- to 6-fold elevation over untreated HMVEC by 24h, and was sustained over at least 48h to 72h of culture in the continuous presence of this cytokine (Fig. 3B). Following TNF-α (1 nm) withdrawl from 24h stimulated HMVEC cultures, induced RANKL mrna levels began to decline (Fig. 3B). However, even after 48h of culture in the absence of TNF-α they remained 2-fold elevated over the levels originally observed in unstimulated HMVEC cells. A similar temporal pattern of RANKL mrna induction in HMVEC was observed in response to either 0.1 or 10 nm TNF-α (data not shown). In contrast to RANKL, OPG mrna levels in HMVEC were more rapidly and transiently increased in response to TNF-α (Fig. 3D). Stimulated OPG mrna levels were apparent within 1h, reached a maximum by 10h, declined to less than half their peak values by 24h, and thereafter declined more modestly over 72h of 15

16 culture in the continued presence of TNF-α. However, OPG mrna levels at 72h were still 10-fold elevated over those in untreated HMVEC (Fig. 3D). Following TNF-α withdrawl from 24h stimulated HMVEC, OPG mrna levels rapidly returned to the levels associated with unstimulated HMVEC (Fig. 3D). Together, these results indicate that TNF-α increases both RANKL and OPG mrna levels in HMVEC and, further, that their regulation exhibits a nearly reciprocal temporal relationship: OPG mrna levels rapidly increase in response to TNF-α and then begin to decline, while RANKL mrna levels rise more slowly and are sustained at their peak over at least 48h of culture. Moreover, within 24h of TNF-α withdrawl from HMVEC cultures, OPG mrna expression returns to basal levels whereas RANKL mrna expression remains 3-fold above unstimulated levels. IL-1α increases both RANKL and OPG mrna levels in HMVEC in a more complex manner than TNF-α. Treatment of HMVEC for 24 or 48h with IL-1α also significantly and dose-dependently increased both RANKL and OPG mrna levels measured by semi-quantitative RT-PCR (Fig. 4A and C). Maximal induction of RANKL or OPG at either 24 or 48h was achieved with 1 to 10 nm IL-1α. Unlike TNF-α, IL-1α (1 nm, 48h) elicited nearly equivalent ~10-fold increases in both OPG and RANKL mrna expression over the corresponding levels in untreated HMVEC (Fig. 4A and C). Dose-response curves for RANKL and OPG mrna expression after 48h of IL-1α (1 nm) treatment paralleled, but were much higher, than RANKL and OPG mrna stimulation measured after only 24h of exposure to this cytokine (Fig. 4A and C). Analysis of the temporal kinetics of RANKL mrna expression induced by IL-1α (1 nm) showed an early increase first observed 3 to 6h post-treatment that rose to a reproducible level 3- to 4-fold over untreated HMVEC by 10h (Fig. 4B). This initial stimulation of RANKL mrna levels was comparable to that elicited by TNF-α (Fig. 3B). However, it was immediately followed by a second phase of induction in response to IL-1α, to levels 8- to 10-fold over untreated HMVEC, that peaked within 48h and were sustained over at least 72h of culture in the continuous presence of this cytokine (Fig. 4B). Following the withdrawl of IL-1α (1 nm) from 16

17 either 24 or 48h stimulated HMVEC cultures, induced RANKL mrna levels declined within the next 24h period to the low levels seen in unstimulated HMVEC (Fig. 4B). This contrasts with the more moderately elevated, but sustained, levels of RANKL expression maintained following TNF-α induction and withdrawl. The continued presence of IL-1α beyond the first 24h was essential for achieving the second higher peak of RANKL mrna expression in cultured HMVEC because this did not occur if IL-1α was withdrawn immediately after the initial 24h period. A similar bimodal temporal pattern of RANKL mrna level induction in HMVEC was also observed in response to 10 nm IL-1α (data not shown). OPG mrna levels rose more rapidly in response to IL-1α than did RANKL mrna levels (Fig. 4D). However, like RANKL, OPG mrna levels always exhibited a bimodal temporal pattern of IL-1α stimulated expression (Fig. 4D). Elevated OPG mrna levels were detectable by 1h, reached an initial maximum by 6h, and then partially declined briefly, but reproducibly, before rising again to maximal levels 10-fold over unstimulated HMVEC by 24h (Fig. 4D). Thereafter, OPG mrna expression declined over 72h of culture in the continued presence of IL-1α, although OPG mrna levels at 72h were still 4-fold elevated over those in untreated HMVEC (Fig. 4D). Compared to TNF-α, maximal levels of OPG expression elicited by IL-1α were 4-fold lower than peak OPG expression induced by TNF-α and were equivalent to the naturally declining levels of OPG expression seen after 72h of continuous TNF-α exposure (Fig. 3D and 4D). However, like TNF-α, IL-α withdrawl from 24h stimulated HMVEC led to the rapid return within the next 24h of OPG mrna levels to the lower levels associated with unstimulated HMVEC (Fig. 4D). If IL-1α withdrawl was delayed until 48h, when OPG mrna levels were already naturally declining, little further acceleration in the rate of decline occurred (Fig. 4D). Together, these results indicate that IL-1α increases both RANKL and OPG mrna levels in HMVEC, and that their regulated expression exhibits an apparent reciprocal relationship analogous to what had been observed for RANKL and OPG in response to TNF-α. However, in contrast to TNF-α, IL-1α stimulated RANKL and OPG mrna increases were more similar in magnitude and exhibited more complex temporal expression profiles. Thus, prolonged stimulation of HMVEC with IL-1α caused a 17

18 greater induction of RANKL and a lesser induction of OPG expression than was elicited by TNF-α. However, following 24 to 48h of cytokine withdrawl, RANKL expression remained partially elevated in TNF-α treated HVMEC whereas it declined to basal levels in IL-1α treated HMVEC, and OPG expression returned to basal levels in both. When HMVEC were simultaneously treated with TNF-α (1 nm) and IL-1α (1 nm) for 24h, a small additive stimulation of RANKL mrna expression over that evoked by either cytokine alone was typically observed (Fig. 5A). Additive increases were also seen using 0.01 nm of each cytokine in combination (data not shown). In contrast, RANKL mrna expression was not raised beyond the maximal levels induced by either cytokine alone after 48h of combined TNF-α (1 nm) and IL-1α (0.01, 0.1, or 1.0 nm) treatment (Fig. 5B). Like RANKL, OPG mrna levels were higher in HMVEC concurrently treated for 24h with both TNF-α and IL-1α in comparison with the levels induced by either cytokine alone (Fig. 5C). However, OPG mrna levels at 48h were generally no higher (except with TNF-α in combination with 0.01 nm IL-1α) in the co-treated cells than in those treated with TNF-α alone, although these levels were significantly greater than the stimulation of OPG mrna by IL-1α alone (Fig. 5D). TNF-α increases RANKL protein expression in HMVEC. Changes in mrna steady state levels are not always accompanied by corresponding changes in protein expression. Therefore, immunostaining was employed to learn whether RANKL protein expression increased in parallel with RANKL mrna levels following cytokine activation of HMVEC. Using a Pab to the C-terminal extracellular region of human RANKL, a low basal level of specific immunostaining was detected in unstimulated HMVEC (Fig. 6A) which was markedly increased in HMVEC cultured with TNF-α (1 nm) for 24h (Fig. 6B). RANKL immunostaining was primarily associated with the plasma membrane of TNF-α activated HMVEC and intense throughout the sample when viewed by optical sectioning confocal microscopy. Similarly, unstimulated HMVEC exhibited a low level of specific basal immunostaining using an Mab to the cell surface integrin adhesion molecule ICAM-1 (Fig. 6C), and such 18

19 staining was greatly enhanced and predominantly cell surface-associated in HMVEC stimulated with 1 nm TNF-α for 24h (Fig. 6D). HMVEC co-stained for both RANKL and ICAM-1 exhibited strong overlapping signals for these two molecules all over the cell surface (not shown). TNF-α treated HMVEC also exhibited specific increases in immunostaining for the cell surface adhesion molecules VCAM-1 and αvβ3 (not shown). Therefore, TNF-α stimulation of HMVEC increases expression of RANKL mrna in addition to RANKL protein, which is primarily located on the surface plasma membrane of activated HMVEC. TNF-α and IL-1α stimulate the release of M-CSF, as well as one another, from HMVEC. Because M-CSF is an essential permissive factor required for OC differentiation promoted by RANKL, the effects of TNF-α and IL-1α on the production of M-CSF by HMVEC were also investigated. HMVEC cultured for 24h with either IL-1α or TNF-α (1 or 10 nm) released 2- to 4-fold more M-CSF into the culture medium than did unstimulated HMVEC (Table 1). These pro-inflammatory cytokines also stimulated the release of one another from HMVEC, although IL-1α (1 or 10 nm) elicited a somewhat greater increase in TNF-α release (up to 8- fold) than TNF-α (only at 10 nm) did in IL-1α release (3-fold) from HMVEC (Table 1). Inflammatory cytokine activation of HMVEC promotes in vitro osteoclastogenesis in co-cultured human PBMC, by a RANKL-dependent mechanism antagonized by OPG. Whether cytokine stimulation of RANKL mrna and protein expression in HMVEC enhanced their ability to promote OC formation and development was evaluated in HMVEC co-cultured with M-CSF and human PBMC as a source of OC precursors. Because TNF-α and IL-1α can themselves influence OC development, bone resorption, and/or survival, these cytokines were withdrawn from activated HMVEC before their co-culture with human PBMC so that biological effects mediated by cytokine-induced RANKL and OPG could be distinguished from potential direct actions of TNFα or IL-1α. HMVEC that were pre-activated with either TNF-α or IL-1α (1 nm, 48h), and then washed prior to the addition of human PBMC, caused a significant 1.5-fold increase in the number of TRAP+ multinucleated 19

20 cells (MNC) having 3 or more nuclei that formed in the co-cultures after one week compared to the number generated from human PBMC co-cultured with unstimulated HMVEC (Fig. 7A and B). These increases were attributed in each case to a cytokine mediated induction of RANKL in HMVEC, and not other soluble or cellsurface factors (eg. ICAM-1, VCAM-1), because inclusion of an inhibitory OPG fusion peptide that directly binds and neutralizes RANKL completely blocked the stimulatory effects obtained with either TNF-α (Fig. 7A) or IL-1α (Fig. 7B). These data also suggest that endogenous OPG production by TNF-α or IL-1α preactivated HMVEC in the co-cultures was below the inhibitory levels achieved through exogenous addition of 100 ng/ml OPG fusion peptide. In contrast to its suppression of MNC formation promoted by cytokine stimulated HMVEC, OPG did not diminish the 2- to 5-fold greater MNC formation that occurred in human MN co-cultured with (untreated) HMVEC (Fig. 7A and B) compared to human MN cultured in the absence of HMVEC (data not shown). Thus, OPG restrained TRAP+ MNC formation stimulated by either TNF-α or IL- 1α activated HMVEC via a RANKL-dependent mechanism, but not that promoted by unactivated HMVEC in a RANKL-independent pathway. Inflammatory cytokine activation of HMVEC promotes the fusion of OC precursors to form larger, more multinucleated TRAP+ MNC. In vitro osteoclastogenesis was examined in further detail using TNF-α preactivated HMVEC (1 nm, 24h) co-cultured with human PBMC for 16 days. Again, TNF-α activated HMVEC caused a significant 2-fold increase in the number of TRAP+ MNC (with 3 or more nuclei) that formed in the co-cultures compared to co-cultures with unstimulated HMVEC and OPG fusion peptide fully blocked such induction, thereby implicating a RANKL-dependent mechanism (Fig. 8A). The proportion of total TRAP+ cells that became MNC was also significantly increased by TNF-α pre-activation of HMVEC (Fig. 8A). However, the overall number of mononuclear or total (mononuclear plus MNC) TRAP+ cells in the co-cultured human PBMC population was not affected by TNF-α pretreatment of HMVEC, suggesting that the increase in TRAP+ MNC formation in the presence of TNF-α pre-activated HMVEC likely involved the stimulated fusion, rather 20

21 than proliferative expansion, of TRAP+ precursor cells (Fig. 8B). Consistent with this, microscopic examination of human PBMC co-cultured with TNF-α activated HMVEC revealed formation of not only more numerous, but also generally larger, TRAP+ MNC than were obtained in co-cultures of human PBMC with unstimulated HMVEC (Fig. 8C). Inclusion of the OPG fusion peptide prevented these increases in TRAP+ MNC numbers and size, without affecting basal co-culture TRAP+ MNC formation (Fig. 8C). MNC size changes were confirmed by quantifying the number of nuclei contained within individual TRAP+ MNC (Table 2). Thus, TNF-α activated HMVEC day 16 co-cultures contained fewer small MNC (with 3 nuclei/mnc) and more numerous large MNC (with 4 nuclei/mnc), these were the only cultures to contain MNC with as many as 11 to 16 nuclei/mnc, and the addition of OPG fusion peptide abrogated the stimulated formation of larger MNC from human PBMC (Table 2). Similarly, TRAP+ MNC sizes were increased in day 7 co-cultures containing TNF-α (Table 2) or IL-1α (not shown) pre-activated HMVEC, and reduced in the presence of the OPG inhibitory peptide. Thus, inflammatory cytokine activated HMVEC stimulated both the number and multinuclearity of TRAP+ MNC formed in co-cultures with human PBMC, in each case via a RANKLdependent pathway antagonized by OPG. TNF-α activation of HMVEC promotes in vitro formed OC bone pit resorption by a RANKL-dependent mechanism. Increased MNC formation was also accompanied by parallel changes in bone pit resorption activity (Fig. 9). Human PBMC co-cultured with TNF-α pre activated HMVEC exhibited substantial increases in the overall area of ivory resorbed and the total number of pits formed, effects that were completely abolished in the presence of the OPG fusion peptide (Fig. 9A and B). Although such increased resorption activity could simply reflect the greater numbers of TRAP+ MNC formed under these conditions, TNF-α stimulated HMVEC also activated individual TRAP+ cells formed to resorb more ivory. Thus, the mean area resorbed per TRAP+ cell (Fig. 9D), number of pits formed per TRAP+ cell (Fig. 9E), and size of lacunae formed (Fig. 9F) were all increased in the co-cultures containing TNF-α stimulated HMVEC, and elevations in these resorption 21

22 parameters were completely prevented by the presence of the OPG fusion peptide. Overall therefore, TNF-α activation of HMVEC promoted the developmental formation and fusion of TRAP+ mononuclear cells into MNC and activated their bone pit-resorptive function via RANKL-dependent mechanisms that were antagonized by OPG. RANKL is highly expressed by bone VEC located near resorbing OC in areas of active human bone turnover in vivo. Because developing and resorbing OC are situated close to blood vessels and capillaries in bone, and circulating OC precursors must transmigrate through a VEC barrier to reach the bone marrow microenvironment, inflammatory regulated expression of RANKL and OPG by VEC may impact on and contribute to the development, survival, and resorptive activity of OC at sites of localized bone loss. Therefore, to further validate the physiological relevancy of our in vitro findings, we examined whether RANKL protein was detectable on VEC within human bone tissue, particularly in areas undergoing bone turnover. Immunohistochemical staining of paraffin embedded sections of human osteoporotic bone derived from femoral head fractures performed using a Pab raised to human RANKL showed RANKL protein expression consistently displayed on blood vessels or capillaries located in regions associated with OC lacunar resorption and active bone remodeling (Fig. 10A-D). RANKL signals on VEC appeared comparable in intensity to that of other RANKL expressing cells in these regions, including OB-like cells located along the bone surface (Fig. 10B and D). RANKL appeared to be expressed in a polarized fashion on the basolateral surface of VEC facing the bone marrow microenvironment, where it could presumably interact with circulatory cells emigrating into the bone tissue as well as with pre-oc and resorbing OC in the bone marrow via close physical interactions between VEC and such cells (Fig. 10D). By contrast, blood vessels and capillaries proximal to newly forming osteoid or quiescent bone surfaces within these same bone sections evidenced no detectable specific RANKL protein staining (Fig. 10E). Control sections incubated without primary Pab also showed no peroxidase signals in any cell type, including VEC (Fig. 10F). 22

23 DISCUSSION This study has demonstrated for the first time that primary HMVEC express both RANKL and OPG, that the proinflammatory cytokines TNF-α and IL-1α induce elevated RANKL and OPG mrna levels in HMVEC according to differing temporal expression profiles, and that TNF-α or IL-1α stimulated levels of RANKL mrna and protein in HMVEC function to promote the in vitro development and activation of bone pitresorptive OC that form in co-cultures with human PBMC. In vivo, RANKL protein expression is increased on blood vessels or capillaries in the vicinity of resorbing OC and regions of active bone remodeling within sections of human osteoporotic bone. Therefore, microvascular endothelial cells may have an important role in regulating localized bone loss through their stimulated expression of RANKL and OPG, as well as M-CSF, the key factors involved in controlling OC development, survival, and bone resorption both in vitro and in vivo 1-4. Although it has long been known that the vasculature of bone plays an essential role in the development, dynamic remodeling, and repair of bone, it has only recently become clear that the vascular endothelium functions as more than a permeability barrier and passive conduit of cells and endocrine signals, but also as a vital secretory and immunologic organ 19-22,27. OC hematopoietic precursor cells are present within both the peripheral circulation and the bone marrow, and in all cases they develop into mature functional OC within the bone tissue while in close spatial proximity to the microvasculature and sinusoids 19-23,37. Thereafter, OC remain intimately associated with microvascular endothelial cells during their active resorption of bone 19-23,38,39. Whereas OB and BMSC are well documented to regulate OC formation and function through both soluble and cell contact-mediated mechanisms, much less is known regarding how microvascular endothelial cells may interact with developing and mature OC. Recently, RANKL mrna was detected in the metaphyseal vessels of bone 5, RANKL protein in the small blood vessels of the skin 40, and OPG, RANK, and RANKL mrna in the calcified arteries of OPG deficient mice but only OPG mrna in normal adult mouse arteries 41. Here, we have shown that primary HMVEC express mrna transcripts for both RANKL and OPG in a 23

24 regulated manner. Unlike BMSC or OB, HMVEC did not respond to PTH or VD3/Dex with any changes in RANKL or OPG mrna levels, although VEC have been reported to respond in other ways to such signals This contrasts with numerous studies in which human or mouse BMSC or OB have responded to these and other osteotropic hormonal signals by upregulating RANKL mrna and reducing (or not altering) OPG mrna levels 1-6,10,11, A reciprocal pattern of RANKL and OPG mrna expression also occurs during OBlike development, with consequent effects on osteoclastogenesis 1-6,11, Our findings therefore suggest that VEC may not directly contribute to the increased OC formation and resorptive activity associated with the complex actions of these osteotropic hormones. In contrast, VEC may have a prominent role in regulating the recruitment and development of boneresorptive OC at localized sites of inflammation, thereby contributing to the osteopenia associated with rheumatoid arthritis, periodontal disease, and other inflammatory disorders. Because the pro-inflammatory cytokines TNF-α and IL-1α potently activate VEC, stimulate OC-mediated bone resorption in vivo and in vitro, and are elevated and known to play an important role in pathological conditions associated with bone loss, their potential regulation of RANKL and OPG in HMVEC was investigated. TNF-α or IL-1α activation of HMVEC led to the dose- and time-dependent stimulation of both RANKL and OPG mrna levels, with OPG mrna levels rising rapidly and then declining at about the time that RANKL mrna levels were achieving maximal sustained levels. Compared to TNF-α, IL-1α evoked a similar initial but greater maximal rise in RANKL mrna expression (to levels comparable to HBMSC), a lesser stimulation of OPG mrna levels, and more complex biphasic kinetics of RANKL and OPG mrna expression. Recently, TNF-α and IL-1β were also reported to increase RANKL and/or OPG mrna levels in primary HBMSC, HOB, and human osteosarcoma MG-63 cells 13,48,50,51. As in HMVEC, RANKL mrna levels were stimulated 2- to 4-fold in HBMSC by nm concentrations of the cytokines, peak RANKL mrna levels were reached by 12h and maintained for at least 24h, and IL-1β elicited a greater increase than did TNF-α in RANKL mrna levels, 24

25 whereas the opposite was true for OPG mrna induction 13. However, no temporal analysis of OPG mrna induction was reported 13. In MG-63 and HOB, OPG mrna levels increased in response to TNF-α or IL-1α within 2h, peaked by 4 to 8h (MG-63) or 16h (HOB), and thereafter declined (MG-63) by 24h 50,51. However, parallel changes in RANKL mrna levels were not examined. To our knowledge, the present study is the only direct demonstration that a co-stimulation of RANKL and OPG mrna levels can involve a reciprocal temporal expression pattern, with an early rise in OPG followed by its decline in parallel with a delayed and sustained rise in RANKL. Because the net effects on OC formation, survival, and bone resorption activity are critically determined by the ratio of RANKL to OPG, the temporal nature of their mrna regulation and the actual levels of RANKL and OPG protein produced are key parameters that govern their physiological effects 1-4,41. RANKL protein levels assessed by immunostaining were increased along with RANKL mrna levels in TNF-α activated HMVEC. Enhanced RANKL expression on the surface of HMVEC proved physiologically capable of inducing the in vitro formation of OC when HMVEC were pre-activated with either TNF-α or IL- 1α and then directly co-cultured with human PBMC containing OC precursors. Whereas M-CSF stimulates the early stages of OC recruitment and development (including RANK and TRAP expression), RANKL affects the later stages of OC cell fusion and differentiation into mature functional OC 1-4. Consistent with this, all of the co-cultures that received M-CSF contained TRAP+ cells, and the total number of TRAP+ cells was not influenced by TNF-α pre-activation of HMVEC. However, either TNF-α or IL-1α pre-activation of HMVEC caused a remarkable 1.5- to 3-fold greater number of TRAP+ MNC to form in the co-cultures, as well as an increase in the size and multinuclearity of such TRAP+ MNC. Addition of an anti-rankl neutralizing inhibitory OPG fusion peptide completely abolished this stimulation of TRAP+ MNC number, size, and multinuclearity, thereby establishing that the mechanism by which TNF-α or IL-1α activated HVMEC increased OC formation was via a RANKL-dependent pathway. The fact that TNF-α or IL-1α stimulated HMVEC each caused a similar level of RANKL-dependent human OC development by day 7 in the co- 25

26 cultures, even though these cytokines induced RANKL/GAPDH and OPG/GAPDH mrna levels in HMVEC according to somewhat different temporal profiles, may potentially be explained by the kinetics of their effects on these molecules (Figs. 3 and 4). Thus, following TNF-α or IL-1α induction and withdrawl from stimulated HMVEC (as was performed before the addition of human PBMC to avoid potential confounding effects due to direct actions of these cytokines on human OC formation or survival), RANKL/GAPDH mrna levels remained moderately elevated in TNF-α stimulated HMVEC but declined from highly elevated to basal levels in IL-1α stimulated HMVEC, while OPG/GAPDH levels returned to basal levels within 24h in both TNF-α and IL-1α stimulated HMVEC. Therefore, human PBMC might be exposed to higher initial, but briefer, elevated RANKL levels in the co-cultures containing IL-1α pre-activated HVMEC versus more moderate, but sustained, elevated RANKL levels in the co-cultures containing TNF-α pre-activated HMVEC. Only low basal OPG levels should be present in these co-cultures after one or two days due to the rapid fall in OPG expression following cytokine withdrawl, the labile nature of OPG, and its removal through medium changes. These effects might balance out overall to produce similar levels of in vitro human OC formation. Although additional experiments would be required to confirm and dissect this further, the key message derived from the current studies is that both TNF-α and IL-1α prove capable of activating HMVEC to promote human OC formation in vitro via a RANKL-dependent mechanism. Greater OC formation was accompanied by enhanced bone pit resorption activity, both overall as a result of increased OC numbers and on a per cell basis reflecting activation of these OC for resorption. Thus, the total area resorbed, number of pits formed, area resorbed per cell, resorption sites initiated per cell, and mean lacunar pit size excavated by OC formed in the TNF-α activated HMVEC co-cultures were all significantly higher than in the other co-culture conditions. A RANKL-mediated pathway was again implicated since the OPG inhibitory peptide fully suppressed this activation of OC for resorption. All of these actions elicited by TNF-α or IL-1α activated HMVEC to promote pre-oc cell fusion, multinucleation, differentiation, and activation of OC for bone pit resorption match those previously reported to be caused by RANKL and antagonized by OPG

27 In vivo, TNF-α and IL-1α tend to be co-produced at sites of localized inflammation, elicit many similar biological responses, may function in concert with one another, and often remain elevated if the inflammatory condition does not resolve and progresses into a chronic disorder. Many inflammatory cytokines, including TNF-α and IL-1, that act to initiate and maintain inflammation and to promote bone resorption, also stimulate angiogenesis, a hallmark characteristic and vital component of the pathology of inflammation, tumor-associated osteolysis, osteoporosis, and other skeletal disorders 19,27,28,36, Increased angiogenesis enables greater recruitment of circulating OC precursors to localized sites of inflammation, and the close contact that VEC share with transmigrating cells and OC precursors already residing within the bone marrow allows for their direct exposure to RANKL, M-CSF, and other regulatory molecules expressed by activated VEC that could initiate their development into bone-resorptive OC. Consistent with this, we found that sections of human osteoporotic bone prepared from femoral head fractures exhibited RANKL protein expression on VEC that were located proximal to resorbing OC and regions of active bone remodeling in vivo. In contrast, negligible RANKL signals were detected on VEC associated with newly forming osteoid or quiescent regions of these same human bone samples. Osteolysis in such fractured femoral heads is known to be associated with increased OC numbers, trabecular scalloping, and locally elevated levels of pro-inflammatory cytokines including TNF-α and IL-1. Therefore, the in vivo immunohistochemical findings strongly support the in vitro HMVEC studies and suggest that activated VEC may contribute to promoting the development, activity, and survival of bone-resorptive OC at inflammatory sites through their regulated expression of RANKL and OPG. Prolonged exposure of VEC in vivo to TNF-α or IL-1α may provoke a relatively persistent increase in RANKL expression, together with a rise and subsequent fall in OPG expression, based on our in vitro findings with continuously stimulated HMVEC. Furthermore, in contrast to our in vitro co-culture studies wherein cytokines were withdrawn after HMVEC activation, osteoclastogenic effects by VEC in vivo might be more pronounced in response to IL-1α versus TNF-α since continuous IL-1α stimulation caused greater RANKL induction and lesser OPG induction than did TNF-α in HMVEC. Moreover, the effects we have measured in vitro may be further magnified in vivo 27

28 since OPG is produced as a secreted factor whose local concentrations might be dissipated systemically through circulatory flow, thereby effectively increasing the potency of transmembrane RANKL locally expressed on activated VEC. These issues will require further investigation. Such VEC-related mechanisms likely interface with similar and additional important soluble and contact-dependent regulatory signals received from BMSC, OB and other cells present in the bone marrow microenvironment. The regulated production of RANKL and OPG by VEC also has broader implications that extend beyond control of OC-mediated bone development and remodeling. Thus, RANKL expression by activated VEC potentially allows the vasculature to directly participate, in a spatial and temporal manner, in various important RANKL-mediated developmental and immune related processes, such as lymph node organogenesis, lymphocyte development, and T cell/dendritic cell interactions 1-4,14. Conversely, VEC-derived OPG could provide a counterbalancing signal for such processes, in addition to its role in calcium homeostasis and as a local and systemic inhibitor of OC formation and bone resorption 1-4. Due to the enormous surface area represented by the endothelium throughout the body, VEC could represent a major source of the circulating OPG found in serum, and contribute to the increased serum OPG levels reported for aging healthy men and women and in postmenopausal osteoporotic women (a condition associated with increased vascularity and levels of IL-1 and TNF-α) 55. Because OPG functions as an important physiological suppressor of vascular calcification, mice deficient in OPG exhibit arterial calcification in addition to early onset osteoporosis (which are both prevented by transgenic OPG expression), and OPG acts as an αvβ3-induced survival factor for VEC, OPG production by VEC may also serve as a key autocrine signal to inhibit blood vessel calcification 1-4,17,41,56. In conclusion, inflammatory cytokine activation of HMVEC caused a sustained upregulation of RANKL and a more transient expression of OPG, the key molecules involved together with M-CSF in controlling OC formation, survival, and bone resorption in vivo and in vitro. Functionally, this led to an increased ability of HMVEC to stimulate the in vitro co-culture development and activity of mature bone pit-resorptive OC from 28

29 circulating human monocytic precursors. In vivo, RANKL expression was upregulated on VEC only in the vicinity of resorbing OC and areas of active bone remodeling. Therefore, we surmise that inflammatoryactivated VEC may help promote localized bone loss via their RANKL-mediated effects on pre-oc and OC to increase the number of sites and/or rates of bone remodeling. Therapeutic intervention aimed either at preventing an increase in RANKL or further enhancing OPG production by activated VEC may therefore help to alleviate the osteopenia seen in various inflammatory diseases, metabolic bone disorders, malignancy-related osteolyses, or certain immune disorders. 29

30 ACKNOWLEDGEMENTS The authors would like to thank Dr. Len Rifas for providing primary HOB cells, Drs. Len Rifas and Neil Weitzman for primer design and advice in setting up the RT-PCR reactions for RANKL, and Dr. Teresa Sunyer for valuable advice on initially performing and analyzing the RANKL RT-PCR studies. This work was supported by NIH grants DK46547 to P.C.O and AR32927 to P.O. Please direct reprint requests to: Patricia Collin-Osdoby, Ph.D. Department of Biology, Box 1229 Washington University St. Louis, MO

31 REFERENCES 1. Hofbauer, L., Khosla, S., Dunstan, C., Lacey, D., Boyle, W., and Riggs, B. (2000) J. Bone Miner. Res. 15, Filvaroff, E., and Derynck, R. (1998) Curr. Biol. 8, R679-R Suda, T., Takahashi, N., Udagawa, N., Jimi, E., Gillespie, M., and Martin, T. (1999) Endocr. Revs. 20, Wong, B., Josien, R., and Choi, Y. (1999) J. Leukoc. Biol. 65, Lacey, D., Timms, E., Tan, H-L., Kelley, M., Dunstan, C., Burgess, T., Elliott, R., Colombero, A., Elliott, G., Scully, S., Hsu, H., Sullivan, J., Hawkins, N., Davy, E., Capparelli, C., Eli, A., Qian, Y-X., Kaufman, S., Sarosi, I., Shalhoub, V., Senaldi, G., Guo, J., Delaney, J., and Boyle, W. (1998) Cell 93, Yasuda, H., Shima, N., Nakagawa, N., Yamaguchi, K., Kinosaki, M., Mochizuki, S-I., Tomoyasu, A., Yano, K., Goto, M., Murakami, A., Takahashi, N., and Suda, T. (1998) Proc. Natl. Acad. Sci. USA 95, Matsuzaki, K., Udagawa, N., Takahasi, N., Yamaguchi, K., Yasuda, H., Shima, N., Morinaga, T., Toyama, Y., Yabe, Y., Higashio, K., and Suda, T. (1998) Biochem. Biophys. Res. Commun. 246, Nakagawa, N., Kinosaki, M., Yamaguchi, K., Shima, N., Yasuda, H., Yano, K., Morinaga, T., and Higashio, K. (1998) Biochem. Biophys. Res. Commun. 253, Hsu, H., Lacey, D., Dunstan, C., Solovyev, I., Colombero, A., Timms, E., Tan, H-L., Elliott, G., Kelley, M., Sarosi, I., Wang, L., Xia, X-Z., Elliott, R., Chiu, L., Black, T., Scully, S., Capparelli, C., Morony, S., Shimamoto, G., Bass, M., and Boyle, W. (1999) Proc. Natl. Acad. Sci. USA 96, Tsukii, K., Shima, N., Mochizuki, S., Yamaguchi, K., Kinosaki, M., Yano, K., Shibata, O., Udagawa, N., Yasuda, H., Suda, T., and Higashio,.K. (1998) Biochem. Biophys. Res. Commun. 246, Nagai, M., and Sata, N. (1999) Biochem. Biophys. Res. Commun. 257, Fuller, K., Wong, B., Fox, S., Choi, Y., and Chambers, T. (1998) J. Exp. Med. 188, Hofbauer, L., Lacey, D., Dunstan, C., Spelsberg, T., Riggs, B., and Khosla, S. (1999) Bone 25, Kong, Y., Yoshida, H., Sarosi, I., Tan, H., Timms, E., Capparelli, C., Morony, S., Oliveira-dos Santos, A., Van, G., Itie, A., Khoo, W., Wakeham, A., Dunstan, C., Lacey, D., Mak, T., Boyle, W., and Penninger, J. (1999) Nature 397, Simonet W, Lacey D, Dunstan C, Kelley M, Chang M-S, Luthy R, Nguyen H, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R, Colombero A, Tan H-L, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg 31

32 L, Hughes T, Hill D, Pattison W, Campbell P, Sander S, Van G, Tarpley J, Derby P, Lee R, Amgen EST Program, Boyle W 1997 Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 89: Yasuda, H., Shima, N., Nakagawa, N., Mochizuki, S-I., Yano, K., Fujise, N., Sato, Y., Goto, M., Yamaguchi, K., Kuriyama, M., Kanno, T., Murakami, A., Tsuda, E., Morinaga, T., and Higashio, K. (1998) Endocrinol. 139, Bucay, N., Sarosi, I., Dunstan, C., Morony, S., Tarpley, J., Capparelli, C., Scully, S., Tan, H., Xu, W., Lacey, D., and Boyle, W. (1998) Genes Devel. 12, Mizuno, A., Amizuka, N., Irie, K., Murakami, A., Fujise, N., Kanno, T., Sato, Y., Nakagawa, N., Yasuda, H., Mochizuki, S-I., Gomibuchi, T., Yano, K., Shima, N., Washida, N., Tsuda, E., Morinaga, T., Higashio, K., and Ozawa, H. (1998) Biochem. Biophys. Res. Commun. 247, Collin-Osdoby, P. (1994) J. Cell. Biochem. 55, Streeten, E., and Brandi, M. (1990) Bone Miner. 10, Burkhardt, B., Kettner, G., Bohm, W., Schmidmeier, M., Schlag, R., Frisch, B., Mallmann, B., Eisenmenger, W., and Gilg, T. (1987) Bone 8, Gerber, H-P., Vu, T., Ryan, A., Kowalski, J., Werb, Z., and Ferrara, N. (1999) Nature Med. 5, Parfitt, A. (1998) Bone 23, Faust, J., Lacey, D., Hunt, P., Burgess, T., Scully, S., Van, G., Eli, A., Qian, Y., and Shalhoub, V. (1999) J. Cell. Biochem. 72, Wani, M., Fuller, K., Kim, N., Choi, Y., and Chambers, T. (1999) Endocrinol. 140, Shalhoub, V., Faust, J., Boyle, W., Dunstan, C., Kelley, M., Kaufman, S., Scully, S., Van, G., and Lacey, D. (1999) J. Cell. Biochem. 72, Cines, D., Pollak, E., Buck, C., Loscalzo, J., Zimmerman, G., McEver, R., Pober, J., Wick, T., Konkle, B., Schwartz, B., Barnathan, E., McCrae, K., Hug, B., Schmidt, A., and Stern, D. (1998) Blood 91, Mantovani, A., Bussolino, F., and Dejana, E. (1992) FASEB J. 6, Chaudhary, L., Cheng, S-L., and Avioli, L. (1996) Molec. Cell. Biochem. 156, Cheng, S-L., Yang, J., Rifas, L., Zhang, S-F., and Avioli, L. (1994) Endocrinol. 134, Thomas, R., Guise, T., Yin, J., Elliott, J., Horwood, N., Martin, T., and Gillespie, M. (1999) Endocrinol. 140,

33 Sunyer, T., Lewis, J., Collin-Osdoby, P., and Osdoby, P. (1999) J. Clin. Invest. 103, Rothe, L., Collin-Osdoby, P., Chen, Y., Sunyer, T., Chaudhary, L., Tsay, A., Goldring, S., Avioli, L., and Osdoby, P. (1998) Endocrinol. 139, Collin-Osdoby, P., Oursler, M., Rothe, L., Webber, D., Anderson, F., and Osdoby, P. (1995) J. Bone Miner. Res. 10, Kasten, T., Collin-Osdoby, P., Patel, N., Osdoby, P., Krukowski, M., Misko, T., Settle, S., Currie, M., and Nickols, G. (1994) Proc. Natl. Acad. Sci. USA 91, Collin-Osdoby, P., Rothe, L., Bekker, S., Anderson, F., and Osdoby, P (2000) J. Bone Miner. Res. 15, Trueta, J. (1963) J. Bone Joint Surg. 45B, Soskolne, W. (1979) Cell Tiss. Res. 203, Zaidi, M., Alam, A., Bax, B., Shankar, V., Gill, J., Pazianas, M., Huang, C., Sahinoglu, T., Moonga, B., Stevens, C., and Blake, D. (1993) Bone 14, Kartsogiannis, V., Zhou, H., Horwood, N., Thomas, R., Hards, D., Quinn, J., Niforas, P., Ng, K., Martin, T., and Gillespie, M. (1999) Bone 25, Min, H., Morony, S., Sarosi I., Dunstan, C., Capparelli, C., Scully, S., Van, G., Kaufman, S., Kostenuik, P., Lacey, D., Boyle, W., and Simonet, W. (2000) J. Exp. Med. 4, Streeten, E., Ornberg, R., Curcio, F., Sakaguchi, K., Marx, S., Aurbach, G., and Brandi, M. (1989) Proc. Natl. Acad. Sci. USA 86, Crutchley, D., Ryan, U., Ryan, J. (1985) J. Pharmacol. Exp. Ther. 233, Brown, R., Rees, J., Mcfarland, C., Lewinson, D., and Ali, S. (1990) Bone Miner. 9, Horwood, N., Elliott, J., Martin, T., and Gillespie, M. (1998) Endocrinol. 139, Mbalaviele, G., Jaiswal, N., Meng, A., Cheng, L., Van Den Bos, C., and Thiede, M. (1999) Endocrinol. 140, Lee, S., and Lorenzo, J. (1999) Endocrinol. 140, Hofbauer, L., Dunstan, C., Spelsberg, T., Riggs, B., and Khosla, S. (1998) Biochem. Biophys. Res. Commun. 250,

34 49. Gao, Y., Shinki, T., Yuasa, T., Kataoka-Enomoto, H., Komori, T., Suda, T., and Yamaguchi, A. (1998) Biochem. Biophys. Res. Commun. 252, Vidal, O., Sjogren, K., Eriksson, B., Ljunggren, O., Ohlsson, C. (1998) Biochem. Biophys. Res. Commun. 248, Brandstrom, H., Jonsson, K., Vidal, O., Ljunghall, S., Ohlsson, C., and Ljunggren, O. (1998) Biochem. Biophys. Res. Commun. 248, Firestein, G. (1999) J. Clin. Invest. 103, Jackson, J., Seed, M., Kircher, C., Willoughby, D., and Winkler, J. (1997) FASEB J. 11, Koch, A. (1998) Arthrit. Rheum. 41, Yano, K., Tsuda, E., Washida, N., Kobayashi, F., Goto, M., Harada, A., Ikeda, K., Higashio, K., and Yamada, Y. (1999) J. Bone Miner. Res. 14, Malyankar, U., Scatena, M., Suchland, K., Yun, T., Clark, E., and Giachelli, C. (2000) J. Biol. Chem. 275,

35 FIGURE LEGENDS FIGURE 1. HMVEC, HOB, and HBMSC express mrna transcripts for RANKL and OPG. RT-PCR using total RNA isolated from human primary HMVEC, HOB or HBMSC and specific primers to the extracellular region of cloned human RANKL (A) or cloned human OPG (B) was performed as described in the Methods. A, B. Single amplicon products of the expected sizes were obtained for both RANKL (731 bp) and OPG (408 bp) from each of the three primary human cell types, and complete nucleotide sequencing of the products generated from HMVEC and HBMSC confirmed their identity to RANKL or OPG. Amplified RANKL and OPG products were RNA dependent since they were not obtained in the absence of input RNA or oligos for reverse transcription into cdna, and they were not eliminated by DNase pretreatment of RNA samples before RT-PCR (not shown). FIGURE 2. Calcitropic hormones modulate RANKL and OPG mrna expression in HBMSC, but not in HMVEC. Semi-quantitative RT-PCR was performed as described in the Methods to amplify RANKL, OPG, and GAPDH in a mid-linear range, and the signals for RANKL or OPG were each normalized to the GAPDH signals determined in parallel. All data was expressed as the mean ± SEM percentage of the RANKL/GAPDH or OPG/GAPDH mrna expression determined in control untreated HMVEC (set at 100%). A, C. Primary HMVEC cultured with PTH 1-34 (500 nm), or VD3 (10 nm) in combination with Dex (100 nm), for 6, 24, or 72h did not exhibit any significant change in their GAPDH normalized steady state mrna expression of either RANKL or OPG. The data shown in the bar graph represents 2 independent cultures of HMVEC incubated for 24h in the presence or absence of these hormones and analyzed for RANKL (A) and OPG (C) mrna expression. HMVEC cultured with or without these hormones for 6 or 72h yielded identical findings (not shown). B, D. Primary HBMSC were cultured in the presence or absence of VD3 (10 nm) and Dex (100 nm) for 8 days, and analyzed from 2 independent cultures by semi-quantitative RT-PCR for mrna expression of RANKL/GAPDH (B) and OPG/GAPDH (D). Primary isolated trabecular HOB (cultured without any modulator 35

36 treatments) were similarly analyzed. In each graph (A-D), the insert picture shows results from a representative RT-PCR trial for RANKL or OPG (top bands) and GAPDH (lower bands in each set) corresponding to the 3 conditions represented by the bars. FIGURE 3. TNF-α stimulates both RANKL and OPG mrna expression in HMVEC. A, C. HMVEC were cultured for 24h with or without various concentrations of TNF-α, and semi-quantitative RT-PCR analysis was performed to determine the relative mrna expression of RANKL/GAPDH (A) and OPG/GAPDH (C) as described in the Methods. All data was expressed as the mean ± SEM percentage of the RANKL/GAPDH or OPG/GAPDH mrna expression determined in control untreated HMVEC. Data shown in the bar graphs was compiled from at least 3 independent HMVEC experiments, each of which displayed dose-dependent increases in both RANKL and OPG mrna expression in response to TNF-α. RANKL/GAPDH and OPG/GAPDH were significantly (P < 0.05) increased by TNF-α concentrations of 0.01 nm and higher, or 0.1 nm and higher, respectively, in comparison to unstimulated HVMEC. Insert pictures show the results from a representative RT- PCR trial for RANKL or OPG (top bands) and GAPDH (lower bands in each set) corresponding to the same conditions represented by the bars. B, D. HMVEC were treated with or without 1 nm TNF-α for periods of 1 to 72h, and subsequently analyzed by semi-quantitative RT-PCR for the GAPDH normalized temporal profile of RANKL and OPG mrna expression. Data was obtained from at least 3 independent experiments and was expressed as the mean ± SEM percentage of the RANKL/GAPDH or OPG/GAPDH mrna expression determined at time 0 in control untreated HMVEC. Open symbols connected by dashed lines represent the results obtained following the withdrawl of TNF-α for 24 or 48h from 24h stimulated HMVEC. FIGURE 4. IL-1α stimulates both RANKL and OPG mrna expression in HMVEC. A, C. HMVEC were cultured for either 24 (open bars) or 48h (hatched bars) with or without various concentrations of IL-1α, and semi-quantitative RT-PCR analysis was performed to determine the relative mrna expression of 36

37 RANKL/GAPDH (A) and OPG/GAPDH (C) as described in the Methods. All data was expressed as the mean ± SEM percentage of the RANKL/GAPDH or OPG/GAPDH mrna expression determined in control untreated HMVEC. Data for the bar graphs was compiled from at least 3 independent HMVEC experiments, each of which exhibited dose-dependent increases in RANKL and OPG mrna expression in response to IL-1α. RANKL/GAPDH and OPG/GAPDH were each significantly (P < 0.05) increased at 24 h by IL-1α concentrations of 0.01 nm or higher, or nm or higher, respectively, and at 48h by IL-1α concentrations of 0.1 nm or higher (for both RANKL and OPG), in comparison to unstimulated HVMEC. Insert pictures show results from a representative RT-PCR trial for RANKL or OPG (top bands) and GAPDH (lower bands in each set) corresponding to the 48h conditions represented by the bars. B, D. HMVEC were treated with or without 1 nm IL-1α for periods of 1 to 72h, and subsequently analyzed by semi-quantitative RT-PCR for the GAPDH normalized temporal profile of RANKL and OPG mrna expression. Data was obtained from at least 3 independent experiments and was expressed as the mean ± SEM percentage of the RANKL/GAPDH or OPG/GAPDH mrna expression determined at time 0 in control untreated HMVEC. Open symbols connected by dashed lines represent the results obtained following the withdrawl of IL-1α for 24 or 48h from 24 or 48h stimulated HMVEC. Note the differences in scales for RANKL/GAPDH and OPG/GAPDH graphs between Figures 3 and 4. FIGURE 5. TNF-α and IL-1α act additively to increase RANKL and OPG mrna expression at 24h, but not 48h, in HMVEC. HMVEC were cultured for either 24 (A, C) or 48h (B, D) in the presence or absence of TNFα (1 nm), IL-1α (0.01 to 1 nm), or a combination of these cytokines, and subsequently analyzed by semiquantitative RT-PCR to determine the relative mrna expression of RANKL/GAPDH (A, B) and OPG/GAPDH (C, D) as described in the Methods. The results shown were compiled from 2 to 5 independent trials and data was expressed as the mean ± SEM percentage of the RANKL/GAPDH or OPG/GAPDH mrna expression determined in control untreated HMVEC at 24 or 48h. Significant differences from unstimulated 37

38 HMVEC are denoted by *, P < 0.05, from TNF-α stimulated HMVEC by +, P < 0.05, and from IL-1α stimulated HMVEC by #, P < FIGURE 6. TNF-α increases RANKL and ICAM-1 protein expression on the HMVEC cell surface. HMVEC were cultured for 24h in the presence or absence of 1 nm TNF-α, fixed, immunostained using antibodies specific to human RANKL or ICAM-1, and the labeled cells viewed in an optical sectioning confocal microscope as described in the Methods. Α, Β. RANKL protein expression was immunodetected using a Pab to the C-terminus of human RANKL together with a biotinylated secondary antibody and a streptavidin-texas Red conjugate. Unactivated HMVEC (A) exhibited a low basal level of RANKL protein immunostaining, whereas a markedly stronger signal was associated with HMVEC that had been exposed to TNF-α (B). C, D. ICAM-1 protein expression was immunodetected using a Mab to human ICAM-1 and an FITC-conjugated secondary antibody. As for RANKL, unactivated HMVEC (C) displayed a low basal level of ICAM-1 protein immunostaining, whereas an intense signal was detected in TNF-α activated HMVEC (D). No staining was apparent in parallel samples (± TNF-α) developed in the absence of either primary antibody (data not shown). Mag. (A-D): 200x. FIGURE 7. TNF-α or IL-1α activated HMVEC promote in vitro osteoclastogenesis by day 7 in co-cultured human PBMC via a RANKL-dependent mechanism antagonized by OPG. HMVEC were pre-activated for 48h with 1 nm TNF-α or IL-1α, washed (to eliminate potential direct effects of the cytokines), co-cultured with human PBMC (containing OC cell precursors) in the presence or absence of a RANKL neutralizing recombinant human OPG fusion peptide (100 ng/ml) for 7 days, and the development of TRAP+ multinucleated cells was evaluated as described in the Methods. A, B. The number of TRAP+ multinucleated cells (MNC, containing 3 or more nuclei) formed in co-cultures containing TNF-α (A) or IL-1α (B) pre-activated HMVEC were counted for each well (totaling over 25,000 MNC per trial), and the data was expressed as the mean ± SEM total number 38

39 of TRAP+ MNC formed per well. Significant differences from control co-cultures of human PBMC and unactivated HMVEC in the absence of the OPG fusion peptide are denoted by *, P < 0.05, and from TNF-α or IL-1α activated HMVEC co-cultured with human PBMC in the absence of OPG by +, P < FIGURE 8. TNF-α activated HMVEC promote the fusion of OC precursors to form larger, more multinucleated TRAP+ MNC via a RANKL-dependent mechanism antagonized by OPG. HMVEC were pre-activated for 24h with TNF-α (1 nm), washed, co-cultured with human PBMC (containing OC cell precursors) in the presence or absence of a RANKL neutralizing recombinant human OPG fusion peptide (100 ng/ml) for 16 days, and the development of TRAP+ multinucleated cells was evaluated as in Figure 7. A. The number of TRAP+ multinucleated cells (MNC, containing 3 or more nuclei) were counted in each co-culture well (totaling over 5000 MNC), and the data was expressed as the mean ± SEM total number of TRAP+ MNC formed per well (open bars) or proportion of TRAP+ MNC relative to total TRAP+ cells formed (hatched bars). Significant differences from control co-cultures of human PBMC and unactivated HMVEC in the absence of the OPG fusion peptide are denoted by *, P < 0.05, and from TNF-α activated HMVEC co-cultured with human PBMC in the absence of OPG by ++, P < 0.01 and +++, P < B. The mean ± SEM total number of TRAP+ mononuclear cells (open bars) or TRAP+ mononuclear plus MNC cells (hatched bars) per well was not influenced by TNF-α pre-activation of HMVEC. Although a trend toward higher numbers of TRAP+ mononuclear cells was seen in the co-culture wells containing the OPG fusion peptide, this did not reach statistical significance. C. Microscopic examination of the co-cultures fixed and stained for TRAP activity on day 16. Note the formation of more numerous and generally larger TRAP+ MNC in wells containing TNF-α pre-activated HMVEC, and the loss of this stimulation upon addition of the RANKL neutralizing OPG fusion peptide. Mags.: 50x (upper panel), 100x (lower panel). FIGURE 9. TNF-α activated HMVEC stimulate the bone pit resorptive activity of OC formed in co-cultures 39

40 with human PBMC via a RANKL-dependent mechanism antagonized by OPG. Ivory chips harvested from the co-culture wells of Figure 8 were stained for TRAP activity and analyzed over a constant number of random fields (40) for the overall amount of bone pit resorption activity (A, B), number of TRAP+ cells (C), and resorptive activity per TRAP+ cell (D-F) as described in the Methods. Data was obtained from 3 independent wells per condition of a representative co-culture resorption trial (totaling over 2000 TRAP+ cells and their associated resorption pits) and was expressed as the mean ± SEM for each resorption parameter. A, B. TNF-α pre-activated HMVEC significantly increased the mean overall area (µm 2 ) of ivory resorbed (A) and the mean total number of pits formed (B) by TRAP+ MNC formed in the co-cultures. The OPG fusion peptide completely prevented such stimulation. C. TNF-α pre-activated HMVEC did not significantly increase the total number of TRAP+ cells attached to the ivory chips (consistent with the data in Figure 8 demonstrating that the number of TRAP+ MNC, but not total TRAP+ cells, is increased by this co-culture treatment). D-F. TNF-α pre-activated HMVEC significantly increased the mean area (µm 2 ) of ivory resorbed per TRAP+ cell formed (D), the mean number of pits formed per TRAP+ cell (E), and the mean size (µm 2 ) of pits excavated (F). The OPG fusion peptide completely prevented this activation of the resorption activity of TRAP+ cells formed in the TNF-α stimulated HMVEC co-cultures. Significant differences from control co-cultures of human PBMC and unactivated HMVEC in the absence of the OPG fusion peptide are denoted by *, P < 0.05, and from TNF-α activated HMVEC co-cultured with human PBMC in the absence of OPG by +, P < 0.05 and ++, P < FIGURE 10. Blood vessels or capillaries of human osteoporotic bone exhibit RANKL immunostaining in areas associated with OC resorption and bone remodeling. Paraffin embedded sections of human osteoporotic bone derived from fractured femoral heads were immunostained using a Pab to human RANKL, developed using a peroxidase/dab protocol, counterstained with hematoxylin, and viewed and photographed as detailed in the Methods. RANKL protein was consistently immunodetected on VEC situated close to resorbing OC and regions 40

41 of bone remodeling; conversely, no RANKL immunostaining was exhibited by VEC that were not located in such areas. A. Immunodetection of RANKL protein on VEC (arrows) adjacent to OC (arrowhead) engaged in the resorption and remodeling of bone. Note that other cells within the bone marrow and along the bone surface also exhibit positive signals for RANKL protein. OC were RANKL negative. B. Immunodetection of RANKL protein on VEC (arrows) and OB-related cells (indicated by asterisks below the cells) in a region of active bone remodeling. C. RANKL immunostaining associated with a bone capillary in which a portion has been sectioned parallel to the length of the capillary (arrow). Note the relatively homogeneous distribution of the RANKL signal along the capillary surface. D. RANKL immunostaining in VEC (arrows) and OB-related cells (asterisks) in a region undergoing bone remodeling. Note that RANKL signals detected on the bone capillary appear to be generally polarized to the outer VEC surface. E. RANKL protein is not immunodetected on VEC (arrows) associated with a region of newly forming bone osteoid (star) in a different area of the bone section shown in (B). F. Control section demonstrating no peroxidase signals associated with VEC (arrow) near resorbing OC (arrowhead) in the absence of the primary Pab to human RANKL. Mags.: 600x (A), 400x (B-F). 41

42 TABLE 1. Cytokine production by HMVEC. Treatment Cytokine release (ng/ml/mg protein) Cytokine nm IL 1β TNF α M CSF None ± ± ± 1.7 IL 1α ± b 48.5 ± 8.1 b ± b 37.4 ± 3.1 b TNF α ± ± 4.1 b ± a 65.0 ± 7.7 b HMVEC were cultured for 24h in the presence of IL 1α or TNF α (1 or 10 nm), after which the conditioned media were harvested an d analyzed using cytokine specific immunoassays for the levels of IL 1β, TNF α, and M CSF released as described in the Methods. Results obtained from duplicate wells of at least 3 independent trials were each normalized for cell protein and the data was e xpressed as the mean ± SEM ng/ml of cytokine released per mg cell protein. a P < 0.01 compared to the levels of cytokine released by untreated HMVEC. b P < compared to the levels of cytokine released by untreated HMVEC. TABLE 2. TNF α activated HMVEC promote increased TRAP+ MNC fusion. % of TRAP+ MNC with designated # nuclei / MNC TNF OPG Harvest Pre activated Co cultured D ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 0.1 D ± ± ± ± ± ± ± ± ± ± ± ±

43 43

44

45

46

47

48

49

50

51

52

53