Effects of superovulated heifer diet type and quantity on relative mrna abundances and pyruvate metabolism in recovered embryos.
|
|
- Quentin Beasley
- 5 years ago
- Views:
Transcription
1 Western University Obstetrics & Gynecology Publictions Obstetrics & Gynecology Deprtment Effects of superovulted heifer diet type nd quntity on reltive mrna bundnces nd pyruvte metbolism in recovered embryos. C Wrenzycki P De Sous E W Overström R T Duby D Herrmnn See next pge for dditionl uthors Follow this nd dditionl works t: Prt of the Obstetrics nd Gynecology Commons Cittion of this pper: Wrenzycki, C; De Sous, P; Overström, E W; Duby, R T; Herrmnn, D; Wtson, A J; Niemnn, H; O'Cllghn, D; nd Bolnd, M P, "Effects of superovulted heifer diet type nd quntity on reltive mrna bundnces nd pyruvte metbolism in recovered embryos." (2). Obstetrics & Gynecology Publictions. 5.
2 Authors C Wrenzycki, P De Sous, E W Overström, R T Duby, D Herrmnn, A J Wtson, H Niemnn, D O'Cllghn, nd M P Bolnd This rticle is vilble t Scholrship@Western:
3 Journl of Reproduction nd Fertility (2) 11, 9 7 Effects of superovulted heifer diet type nd quntity on reltive mrna bundnces nd pyruvte metbolism in recovered embryos C. Wrenzycki 1, P. De Sous 2, E. W. Overström 3, R. T. Duby 4, D. Herrmnn 1, A. J. Wtson 5, H. Niemnn 1, D. O Cllghn nd M. P. Bolnd 7 1 Deprtment of Biotechnology, Institut für Tierzucht und Tierverhlten (FAL), Mriensee, Neustdt, Germny; 2 Roslin Bio-Med, Roslin Institute, Roslin, UK; 3 Deprtments of Biomedicl Sciences nd Antomy nd Cellulr Biology, Tufts University, MA, USA; 4 Deprtment of Veterinry nd Animl Sciences, University of Msschusetts, MA, USA; 5 Deprtments of Obstetrics nd Gynecology nd Physiology, University of Western Ontrio, London, Ontrio, Cnd; Fculty of Veterinry Medicine nd 7 Fculty of Agriculture, University College Dublin, Irelnd This study investigted the effects of quntity nd type of diet fed to superovulted donor heifers on moleculr nd metbolic indices of embryonic development. These effects included the reltive bundnces of mrnas for the α1 subunit of N/K-ATPse nd the ntioxidnt enzyme Cu/Zn-SOD, s well s pyruvte utiliztion in bovine morule nd blstocysts developed in vivo. Heifers were fed dily rtion of either grss silge nd citrus beet pulp-bsed concentrte or grss silge nd brley-bsed concentrte for 11 dys, both t 3 kg per dy or d libitum. In embryos derived from heifers fed the pulp-bsed diets, the reltive bundnces of the trnscripts were not ffected by either dy of collection or quntity of diet. In embryos derived from heifers fed the brley-bsed diets, the reltive bundnces of the N/K-ATPse trnscripts were lso not chnged by these min effects, while the reltive bundnces of the Cu/Zn-SOD trnscripts were ffected by dy of collection nd by the quntity of diet. Pyruvte metbolism ws ffected by dy of collection, nd ws significntly incresed in dy embryos compred with dy 7 nd dy embryos. Diet quntity did not ffect pyruvte utiliztion, wheres diet type did increse pyruvte metbolism in the brley group when compred with the pulp group. The results of this study show for the first time tht moleculr nd metbolic vritions my exist in embryos derived in vivo nd developed in donor heifers on nutritionl regimens differing in type nd quntity. Differences in embryos collected on different developmentl dys my be ttributed to vrying cell numbers. Altertions in the reltive bundnces of the Cu/Zn-SOD trnscripts nd pyruvte metbolism cused by the quntity of diet fed to the donor niml were likely to hve been due to ltertions in metbolic end products tht ccumulte in reproductive trct fluids, wheres differences in embryonic metbolism cused by type of diet re relted to the composition of the diet. These findings chrcterize embryos produced in vivo t the moleculr level, indicting tht the moleculr mrkers used in the present study cn differentite between popultions of embryos produced under different nutritionl regimens nd determine conditions conducive to the production of good qulity embryos. Introduction Superovultion of donors provides multiple embryos for the embryo trnsfer industry (Bolnd et l., 1991; Armstrong, 1993). Despite mjor reserch inititives to enhnce nd stndrdize the superovultory response to exogenous gondotrophins, niml to niml vrition in number nd qulity of embryos remins problem (Goulding et l., 199; Kelly et l., 1997). Severl fctors, such s seson, breed, type Received 1 Februry of gondotrophin nd the presence or bsence of dominnt follicle, contribute to the vrible number nd qulity of embryos produced (Armstrong, 1993; Bungrtz nd Niemnn, 1994). In superovulted beef heifers, n increse in concentrte intke from 3 kg per dy to d libitum reduced the number of ovultions nd provided fewer good qulity embryos (Mntovni et l., 1993). The type of diet fed before superovultion lso ffects superovultory response nd embryo qulity. Heifers fed high concentrte low fibre diet before superovultion hd fewer high qulity embryos 2 Journls of Reproduction nd Fertility Ltd /2
4 7 C. Wrenzycki et l. (Ykub et l., 1999). Similrly, rtions of high rumendegrdble protein decresed fertiliztion rtes nd preimplnttion development (Blnchrd et l., 199). Thus, diet type, either in terms of energy source or protein content, cn lter embryo yields nd survivl. The quntity of the food cn lso ffect other prmeters of the reproductive response, such s follicle size nd progesterone concentrtions (Murphy et l., 1991; Noln et l., 199). The min energy substrtes used by ruminnts re voltile ftty cids (VFA) which re produced in the rumen. The type of concentrte fed ffects rumen fermenttion, with VFA profiles differing between cttle fed on strch-bsed or fibrebsed concentrte (Moloney et l., 1994). The reltive mounts of ech VFA produced re diet-dependent, but rpidly fermented concentrte supplements tend to fvour the production of propionte, nd the more slowly fermented fibre-bsed diets fvour cette production (Slon et l., 19). Propionte is the min precursor of glucose synthesis in the liver. Glucose, mino cids or nutrientrelted metbolites, such s insulin, growth hormone, nd the insulin-like growth fctors nd their binding proteins, hve been postulted to operte t the ovrin level nd to support the growth of the gondotrophin-dependent follicles by reducing the mount of FSH required for follicle growth (Downing nd Scrmuzzi, 1991). Bovine embryos re sensitive to glucose, s high concentrtions in culture medi inhibit embryo development in vitro (Tkhshi nd First, 1992). The gene trnscripts nlysed in the present study re known to ply essentil roles during preimplnttion development. N/K-ATPse is key enzyme for blstocyst development, mediting fluid trnsfer cross the outer blstomeres to form fluid-filled cvity (Wtson, 1992, Kidder, 1993). In bovine embryos produced in vitro, trnscripts encoding multiple isoforms of both the α nd β subunits of N/K-ATPse re expressed throughout erly development (Betts et l., 1997). A similr trnscription pttern ws detected for the ntioxidnt enzyme, Cu/Zn- SOD (Hrvey et l., 1995), which is involved in protection from oxidtive stress. Another ccepted mrker of embryo qulity is energy metbolism (Rieger, 194, 1992; Overström, 199; Grdner, 199). Temporl, stge-specific pthwys of energy metbolism hve been investigted nd metbolic ctivity my provide n objective mens to ssess the vibility of embryos (Rieger, 1992). The ptterns of uptke nd metbolic utiliztion of energy substrtes, such s pyruvte, lctte, glucose nd glutmine, hve been determined in bovine embryos (Thompson et l., 199). Given the reported effects of diet type nd quntity on embryo qulity fter superovultion nd the effects of diet type nd quntity on energy metbolism in cttle, the purpose of this experiment ws to evlute the effects of quntity nd type of diet on the reltive bundnce of two different gene trnscripts nd pyruvte metbolism in cttle embryos recovered t the morul nd blstocyst stges fter superovultory tretment. While in vitro culture conditions cn hve profound effects on the expression of importnt genes in developing rodent nd bovine embryos (Ho et l., 1994, 1995; Morit et l., 1994; Shim et l., 199; Wrenzycki et l., 199, 199, 1999; Koerber et l., 199), the effects of nutrition regimens on gene expression nd metbolism in bovine embryos collected from superovulted donors hve not yet been reported. The nutritionl model used ws designed to provide differing mounts (3 kg per dy versus d libitum) nd types (strch (brley)-bsed versus sugr (citrus beet pulp)- bsed) of concentrte supplement to lter rumen metbolism. The heifers were superovulted to produce dequte embryos from the nutritionlly treted heifers. Mterils nd Methods Animls nd tretments The nutritionl nd superovultory tretments were described by Ykub et l. (1999). Briefly, seventy-six continentl crossbred heifers of pproximtely 5 kg live weight were offered grss silge supplemented with either brley concentrte t 3 kg per dy (n = 2) or d libitum (n = 19), or citrus beet pulp concentrte t 3 kg per dy (n = 1), or d libitum (n = 19) for 11 dys. Both concentrtes were formulted to contin 14% crude protein. The mjor ingredients of the brley concentrte consisted of % brley, 12% soyben mel, 5% molsses, nd citrus beet pulp concentrte consisted of 31.9% citrus pulp, 31.9% molssed beet pulp, 1% mize gluten nd 12% soyben mel. Grss silge contined 12.1% crude protein, with ph of 4.4 nd 1.2% dry mtter. Silge intke for heifers offered 3 kg concentrtes per dy ws d libitum, but for heifers offered d libitum concentrte silge intke ws limited to pproximtely 1 kg dry mtter per dy. The diets were chosen becuse the crbohydrte metbolism for strch (brley)-bsed nd sugr fibre (citrus beet pulp)-bsed energy sources would vry significntly in the rumen, resulting in different ftty cid production profiles. Synchroniztion of oestrus, superovultion nd embryo recovery Heifers were treted for 7 dys with n intrvginl progesterone-relesing device contining 1.9 g progesterone (CIDR-B, InterAg, NZ) fter 1 dys on the tretment diets. Heifers received totl of 25 mg NIH-FSH-P1 equivlent (pfsh, Folltropin-V, Vetrephrm Cnd, London, Ontrio) dministered over injections t 12 h intervls. The lst two injections were given t 12 nd 24 h fter CIDR withdrwl. Heifers received prostglndin F 2α nlogue (15 mg luprostiol, PG, Prosolvin; Intervet, Boxmeer) injection with the fifth injection of pfsh. Heifers were rtificilly inseminted twice, t 5 nd 72 h fter CIDR withdrwl, without reference to oestrus, using frozen thwed semen from single bull with proven fertility. Embryos were recovered from excised reproductive trcts ccording to the procedures reported by Goulding et l. (1994) on dy, 7 or fter first insemintion into PBS (Oxoid Ltd, Bsingstoke) contining 5% fetl clf serum (FCS, Gibco, Grnd Islnd, NY) nd trnsferred into CR-2 collection medium (114.7 mmol NCl l 1 1 mmol KCl l 1, 2.2 mmol NHCO 3, 5.5 mmol
5 Bovine embryo gene expression nd diet 71 hemi-clcium lctte l 1,.4 mmol pyruvte l 1, 5 mmol glutmine l 1, 1% BSA, nd.1% (w/v) gentmicin (Gibco- BRL, Githersburg, MD). Embryos were grded on the bsis of morphology using scle of 1 to 5 (Bolnd et l., 197), wshed twice with PBS contining.1% polyvinyllcohol (PVA), nd then trnsferred, s pools of two or three embryos, in miniml volume (< 1 µl) to the bottom of.5 ml tube. All embryo pools were lysed in 1 µl GITC lysis buffer (4 mol gunidinium thiocynte l 1,.1 mol Tris l 1 (ph 7.4), 1 mol bet-mercptoethnol l 1 ). Smples were quick frozen in liquid nitrogen nd trnsported on dry ice to the lbortory for nlysis, where they were stored t 7 C. Only embryos from morphologicl grdes 1 nd 2 were used, nd these were blnced cross tretments. Detils on embryo yields hve been reported by Ykub et l. (1999). Semi-quntittive RT PCR Reltive chnges in the bundnce of mrna trnscripts in embryo smples were determined using semi-quntittive (SQ) RT PCR ssy, using exogenous dded globin mrna s n internl stndrd (Temeles et l., 1994). In this ssy, the bundnce of given gene trnscript in n embryo smple is determined by expressing the bundnce of gene-specific mplifiction product s frction of the α-globin mplifiction product. This ssy cn be used to compre the reltive bundnce of one mrna mong different smples, but not the bsolute mount of one mrna compred with tht of nother (Temeles et l., 1994; Ho et l., 1994, 1995; Lthm et l., 1995). Since embryos isolted from heifers fed pulp- or brleybsed diets were nlysed in two different lbortories, using methods for mesuring the reltive bundnce of mrnas with minor differences, direct comprisons mong diet types cnnot be mde nd only generl trends cn be evluted. Anlysis of mrna expression in embryos collected from heifers fed the pulp-bsed diets RNA isoltion, RT PCR, nd quntifiction of mplifiction product on embryos from the pulp-bsed diets ws performed s described by De Sous et l. (199). At the time of thwing,.1 pg rbbit globin RNA (Gibco-BRL, Burlington) were dded per embryo equivlent, lysed in smple nd mixed by pipetting. For ech smple, 2 mm 2 mm squre of Hybond TM -messenger ffinity pper (map; Amershm Interntionl, Little Chlfont), wetted with.5 mol NCl l 1, ws soked in the lysed smple for 2 3 h t room temperture to llow for binding of poly(a) + RNA. Unbsorbed lystes were pipetted onto respective map squres supported on Whtmn 1 Filter pper (Whtmn Interntionl Ltd, Springfield Mill) on prfilm. map squres were then trnsferred individully into seprte.5 ml tubes nd wshed by gentle inversion with 2 µl of.5 mol NCl l 1,.1 mol Tris l 1 (3 ),.5 mol NCl l 1 (3 ), nd 7% ethnol (2 ). Poly(A) + RNA ws eluted from ech map squre in fresh tubes in 11 µl sterile H 2 O contining.5 µg oligo(dt) 12 1 (Gibco-BRL) by incubtion t 7 o C for 1 min, followed by cooling on ice for 5 min. RNA isolted by this procedure hs been shown to be free of ny contminting genomic DNA (De Sous et l., 199). Reverse trnscription rections took plce in finl volume of 2 µl buffer, consisting of 5 mmol Tris HCl l 1 (ph.3), 75 mmol KCl l 1, 3 mmol MgCl 2 l 1, 1 mmol dithiothreitol l 1, 75 µmol dntps l 1, nd 3 iu Superscript TM RNse H (Gibco-BRL) for 9 min t 43 C. Rections were terminted t 5 min t 95 o C nd then plced on ice. Reverse trnscribed cdna ws either used directly for PCR or stored t 2 o C. As negtive control for RNA isoltion nd reverse trnscription, blnk map squre ws crried long with the smples during the procedure. Oligonucleotide primers for the mplifiction of N/K- ATPse α1, Cu/Zn-SOD nd α-globin were designed using known sequence informtion (Tble 1). PCRs were performed in 25 µl of 1 GeneAmp PCR Buffer II (1 mmol Tris HCl l 1, ph.3, 5 mmol KCl l 1 ; Perkin Elmer, Vterstetten) contining 2 µmol dntps l 1, 2.5 iu AmpliTq Gold (Perkin Elmer), 1 µmol l 1 of ech of the pproprite 3 nd 5 gene specific primers, 1 mmol MgCl 2 l 1 (N/K- ATPse α1, nd Cu/Zn-SOD) or 1.25 mmol MgCl 2 l 1 (αglobin), nd volume of the reverse trnscription rection corresponding to.1.2 embryo equivlents. The bsic progrmme for mplifiction of gene trnscripts consisted of 1 min sok t 94 o C, followed by cycle progrmme of 1 min t 94 C, trnscript-specific nneling temperture (5, nd 55 C, for N/K-ATPse α1, Cu/Zn-SOD, nd α-globin, respectively) for 3 s, nd 1 min t 72 C. The number of Tble 1. Primers used for RT PCR nd the size of dignostic mplifiction products Gene primers Primer sequence Product size (bp) N/K-ATPse α ACCTGTTGGGCATCCGAGAGAC AGGGGAAGGCACAGAACCACCA-3 Cu/Zn-SOD 5 5 -AAGGCCGTGTGCGTGCTGAA CAGGTCTCCAACATGCCTCT-3 α-globin 5 5 -GCAGCCACGGTGGCGAGTAT GTGGGACAGGAGCTTGAAAT-3 N/K-ATPse α1 primers were bsed on regions of shred homology between the rt nd horse sequences (Shull et l., 19; Kno et l., 199) nd mplified product from bovine cdnatht ws 9.1% identicl to the corresponding cdnasequence in rts (Betts et l., 1997). Cu/Zn-SOD primers were bsed on the rt sequence (Ho nd Crpo, 197), nd hve been shown to mplify product of the correct size, with the nticipted dignostic restriction enzyme site, from bovine cdna (Hrvey et l., 1995). For α-globin, the 5 nd 3 primers correspond to bp nd , respectively, in the rbbit α-globin genomic clone (Cheng et l., 19).
6 72 C. Wrenzycki et l. cycles were 35 (N/K-ATPse α1), 3 (Cu/Zn-SOD), nd 31 (α-globin). RT PCR products were visulized by seprtion for 45 min t 1 V on 2% grose gels in 1 TAE buffer (4 mmol Tris cette l 1, 1 mmol EDTA l 1 ) contining.5 µg ml 1 ethidium bromide. RT PCR products were quntified by cpillry electrophoresis (De Sous et l., 199), using Beckmn P/ACE System 21 in conjunction with lserinduced fluorescence (LIF) detector operting with n rgon ion 4 nm lser nd 53 nm emission filter. Anlysis of mrna expression in embryos collected from heifers fed the brley-bsed diets Poly(A) + RNA ws isolted using Dynbeds mrna DIRECT Kit (Dynl, Oslo) ccording to the mnufcturer s instructions, with minor modifictions s described by Wrenzycki et l. (199b, 1999). Briefly, embryos were lysed by dding 15 µl lysis-binding buffer (1 mmol Tris HCl l 1, ph., 5 mmol LiCl l 1, 1 mmol EDTA l 1, 1% (w/v) LiDS (SDS), 5 mmol dithiothreitol l 1 ). Rbbit globin mrna (.1 pg; BRL, Githersburg, MD) per oocyte or embryo ws dded to ech tube s n internl stndrd. After vortexing for 1 s, brief centrifugtion t 12 g for 5 s nd incubtion t room temperture for 1 min, 1 µl prewshed Dynbeds Oligo (dt) 25 ws pipetted into the fluid. After 5 min incubtion t room temperture for binding poly(a) + RNAs to oligo (dt) Dynbeds, the beds were seprted employing Dynl MPC-E-1 mgnetic seprtor, wshed once using 1 µl wshing buffer 1 (1 mmol Tris HCl l 1, ph.,,15 mol LiCl l 1, 1 mmol EDTA l 1,,1% (w/v) LiDS) nd three times with 1 µl wshing buffer 2 (1 mmol Tris HCl, ph.,,15 mol LiCl l 1, 1 mmol EDTA l 1 ). Poly(A) + RNAs were then eluted from the beds by incubtion in 11 µl sterile wter t 5 C for 2 min, nd liquots were used immeditely for reverse trnscription. Poly(A) + RNA ws reverse trnscribed into cdna in totl volume of 2 µl, using 2.5 µmol rndom hexmers l 1 (Perkin-Elmer) to get the widest rry of cdnas. The rection mixture consisted of 1 RT buffer (5 mmol KCl l 1, 1 mmol Tris HCl l 1, ph.3, Perkin-Elmer, Vterstetten), 5 mmol MgCl 2 l 1, 1 mmol l 1 of ech dntp (Amershm, Brunswick), 2 iu RNse inhibitor (Perkin-Elmer) nd 5 iu MuLV reverse trnscriptse (Perkin-Elmer). The mixture ws overlid with minerl oil to prevent evportion. The RT rection ws crried out t 25 C for 1 min, 42 C for 1 h, followed by denturtion step t 99 C for 5 min nd flsh cooling on ice. PCR ws performed with volume of the RT rection corresponding to.1 or.2 embryo equivlents nd volume of the RT rection corresponding to 1 fg equivlent of globin RNA in finl volume of 5 µl consisting of 1 PCR buffer (2 mmol Tris HCl l 1, ph.4, 5 mmol KCl l 1, Gibco BRL, Eggenstein), 1.5 mmol MgCl 2 l 1, 2 µmol l 1 of ech dntp, 1 µmol l 1 of ech sequence specific primer (globin:.5 µmol l 1 ) using PTC-2 thermocycler (MJ Reserch, Wtertown, MA). A hot strt PCR ws performed to obtin specific mplifiction. During the hot strt, 1 iu Tq DNA polymerse (Gibco, Pisley) ws dded t 72 C. The sequences nd positions of the primers used, the frgment sizes nd the sequence references of the expected PCR products re summrized (Tble 1). The PCR progrm used n initil step t 99 C for 5 min nd 72 C for 2 min (hot strt) followed by 2 cycles (globin: 3 cycles) of 15 s, ech t 95 C for DNA denturtion, 15 s t different tempertures for nneling of primers, nd 15 s t 72 C for primer extension. The lst cycle ws followed by 5 min extension t 72 C nd cooling to 4 C. Genertion of the dignostic frgments ws strictly dependent on the presence of RNA in the RT rection, since omitting reverse trnscriptse from the RT did not generte ny mplified frgments (dt not shown). After ddition of 5 µl of 1 loding buffer (.25% (w/v) xylenecynol nd 25 mmol EDTA l 1 in 5% (v/v) glycerin), 1 µl of the RT PCR products were subjected to electrophoresis on 2% grose gel in 1 TBE buffer (9 mmol Tris l 1, 9 mmol borte l 1, 2 mmol EDTA l 1, ph.3) contining.2 µg ethidium bromide (EtBr) ml 1 with further ddition of in the sme concentrtion s in the running buffer. After running t V for 45 min, the frgments were visulized on n 312 nm UV-trnsillumintor. The imge of ech gel ws digitized using CCD cmer (Quntix, Photometrics, München) nd the IP Lb spectrum (IP Lb Gel, Signl Anlytics Corportion, Vienn, VA). The signl intensity of ech bnd ws quntitted by densitometric scnning using computer-ssisted imge nlysis system (IP Lb Gel). The reltive mount of the mrna of interest ws clculted by dividing the intensity of the bnd for ech developmentl stge by the intensity of the globin bnd for the corresponding stge. For ech mrna, experiments were repeted with t lest three seprte embryo btches. Mesurement of [ 14 C]pyruvte metbolism by individul embryos produced in vivo Rdiolbelled pyruvte ([2-14 C], 15.4 mci mmol 1 ; Dupont-NEN, Brussels) ws reconstituted in CR1-Hepes medium (Rosenkrns nd First, 1994) to stock concentrtion of.5 µci µl 1, nd sodium bicrbonte ([ 14 C],.1 mci mmol 1 ; Amershm Interntionl) ws used t the concentrtion of.25 µci µl 1. Lbelled regents were stored t 4 C. The rdiometric, hnging-drop method of Rieger et l. (1992) ws used to mesure pyruvte metbolism. Individul embryos from ech nutrition tretment were tken up in 2 µl of CR1-Hepes medium nd trnsferred to the cp of sterile 2.5 ml screw-cp mini-vil (Srstedt, Newton, NC). Immeditely, 2 µl CR1-Hepes, contining [2-14 C]pyruvte ws dded, resulting in totl culture volume of 4 µl, nd the cp ws crefully secured onto the 2.5 ml mini-vil. Ech mini-vil contined 1.75 ml of 25 mmol NHCO 3 l 1 tht hd been equilibrted for 2 h to humidified tmosphere of 5% CO 2 in ir t 39 C. Assy control mini-vils included shm preprtions (n = 5) tht contined ll regents but did not include n embryo (to ccount for nonspecific counts), nd bckground mini-vils contining 2 µl unlbelled CR1 medium. Embryos were cultured for 3 h (39 C). The cps were removed, nd the bicrbonte contined within the vil quickly poured into 2 ml
7 Bovine embryo gene expression nd diet 73 scintilltion vil contining.2 ml of.1 mol NOH l 1 nd cpped. The scintilltion vils were gently mixed nd held t 4 C overnight to fcilitte conversion of dissolved [ 14 C]O 2 nd bicrbonte into crbonte. Scintilltion fluid ws dded (15 ml), nd disintegrtions per minute (d.p.m.) determined by counting for 5 min using Pckrd Tri-Crb scintilltion counter progrmmed for utomtic-quench correction. Two microlitres of lbelled [ 14 C]pyruvte were mixed with 1.75 ml NHCO 3 nd.2 ml NOH, nd the rdioctivity quntified in the sme mnner, to determine totl substrte d.p.m. The mount of [ 14 C]pyruvte metbolized by individul embryos ws clculted s described by Tiffin et l. (1991) nd Rieger et l. (1992,b). The men d.p.m. for the shm preprtions ws subtrcted from the d.p.m. vlue of ech embryo, nd the difference divided by the totl [ 14 C]pyruvte d.p.m. nd multiplied by the totl quntity of substrte (lbelled nd unlbelled pyruvte) in 4 µl medium. This vlue ws then multiplied by the product recovery correction fctor of 1.4 (1/9.1) determined for the 3 h culture period (Rieger et l., 1992). This clcultion involved generting stndrd percentge recovery curve over the 3 h incubtion period to determine the plteu sturtion vlue of NH[ 14 C]O 3 t 3 h (dt not shown). Sttisticl nlysis Expression dt were nlysed using the SigmStt 2. (Jndel Scientific, Sn Rfel, CA) softwre pckge. Prmetric nlysis of differences in the mens between two or more popultions were tested using ANOVA with the min effects of dy of collection nd quntity of diet nd their interctions followed by multiple pirwise comprisons using Tukey s test. Pyruvte uptke dt were nlysed by the SAS softwre pckge, version. (SAS Institute Inc., 199) using the generlized liner models (GLM) procedure, with the min effects of dy of collection, quntity of diet nd type of diet nd their interctions. Differences of P.5 were considered to be significnt. As the reltive bundnces of specific mrnas in embryos from nimls fed either the pulp- or brley-bsed diets were determined in two different lbortories, no comprisons cn be mde between these groups. However, pyruvte use ws mesured from both embryo types in the sme lb, llowing comprisons mong ll groups. Correltions between the reltive bundnce of ech mrna of embryos recovered from heifers fed the different diets nd the corresponding pyruvte metbolism dt were clculted with the Person product moment correltion. Results Superovultory response (number of corpor lute t slughter) ws greter (P <.) when heifers were offered 3 kg per dy (15.5 ± 1.) thn when they were offered d libitum concentrtes (12.3 ± 1.4). The superovultory response for both citrus beet pulp (14.4 ± 1.5) nd brley (13.3 ± 1.5) ws not different (P >.5). Heifers offered 3 kg concentrtes per dy produced greter numbers of trnsferble embryos (4. ±.7) compred with heifers offered d libitum concentrtes (2. ±.; P<.5). Heifers offered citrus beet pulp produced greter numbers of trnsferble embryos (4. ±.7) thn heifers offered brley (2.9 ±.5; P<.5). Detils hve been reported by Ykub et l. (1999). Reltive bundnce of N/K-ATPse α1 nd Cu/Zn-SOD trnscripts in embryos For ll primer pirs, the number of PCR cycles ws kept within the liner rnge of mplifiction (De Sous et l., 199b; Wrenzycki et l., 1999). Globin RNA, dded before RNA isoltion s n internl stndrd, ws effectively mplified t 3 31 PCR cycles (Fig. 1), showing liner increse in the mount of PCR products s function of RNA input up to 1 fg (Fig. 1b). Trnscripts for N/K-ATPse α1, Cu/Zn-SOD, nd exogenously supplied α-globin were mplified from bovine embryos developed in vivo from heifers on 3 kg per dy or d libitum diets of citrus beet pulp or brley re shown (Fig. 2,b). In embryos derived from heifers fed the pulp-bsed diets, the reltive bundnces of both trnscripts were not ffected by either dy of collection or quntity of diet (Fig. 3). In embryos derived from heifers fed the brley-bsed diets, the reltive bundnces of the N/K-ATPse trnscripts were lso not chnged by these min effects, while the reltive bundnces of the Cu/Zn-SOD trnscripts were ffected by dy of collection (significntly lower in dy thn in dy 7 embryos) nd by the quntity of diet (Fig. 3b). No interctive effects were observed for dy of collection nd quntity of diets in the reltive bundnce of both trnscripts. Reltive intensity (rbitrry units) () Cycle number 1 (b) [globin RNA] RNA input (fg) Fig. 1. Vlidtion of the semi-quntittive RT PCR ssy in terms of the number of cycles using n mount of 2 fg globin RNA () or different mounts of globin RNA using 3 PCR cycles (b).
8 74 C. Wrenzycki et l. () Dy 3 kg d lib Dy 3 kg d lib Negtive controls N/K-ATPse (d) Dy 3 kg d lib Dy 7 3 kg d lib Dy 3 kg d lib Negtive controls 7 N/K-ATPse (b) Cu/Zn-SOD (e) Cu/Zn-SOD (c) α-globin (f) α-globin Fig. 2. Detection of genetrnscripts in bovine morule nd blstocysts developed in vivo from heifers on 3 kg per dy or d libitum dily intkes of citrus beet pulp ( c) or brley (d f). Representtive ethidium bromide-stined gels showing mplifiction of 33 bp product representing N/K-ATPse α1 trnscript (,d), 24 bp product representing the Cu/Zn-SOD trnscript (b,e), nd 257 bp product representing the exogenously supplied α-globin trnscript (c,f), mplified from dy (lnes 1 nd 2), dy 7 (d f, lnes 3 nd 4) nd dy ( c, lnes 3 nd 4; d f, lnes 5 nd ) from heifers on 3 kg per dy ( c, lnes 1 nd 3; d f, lnes 1, 3 nd 5) or d libitum ( c, lnes 2 nd 4; d f, lnes 2, 4 nd ) diets. As negtive controls, trnscript-specific PCR ws performed on liquots of mock reverse trnscriptions on blnk map squres run through the RNA isoltion procedure ( c: lne 5) nd wter ( c: lne ), while RNA (d f: lne 7) or reverse trnscriptse (d f: lne ) ws omitted during the RT rection. d lib: d libitum. [ 14 C]pyruvte metbolism by individul bovine embryos The effects of dy of collection (Fig. 4), quntity of diets (Fig. 4b), nd type of diets (Fig. 4c) on the utiliztion of [2-14 C]pyruvte by bovine embryos produced in vivo is shown. Pyruvte metbolism ws ffected by dy of collection nd showed significnt increse in dy embryos compred with dy 7 nd dy embryos. Diet quntity did not ffect pyruvte utiliztion, wheres pyruvte metbolism ws significntly incresed in the brley diet group compred with the pulp diet group. No interctive effects were observed for dy of collection, quntity of diets nd type of diets in pyruvte metbolism. The reltive bundnces of the Cu/Zn-SOD trnscript nd pyruvte metbolism showed negtive significnt correltion (r =.4, P.5) in embryos collected from heifers fed brley diets. Discussion The present study is the first to investigte the effects of quntity nd type of diet on mrna expression nd energy metbolism in preimplnttion bovine embryos. Altertions in the reltive mounts of specific gene trnscripts in bovine oocytes produced in vitro nd embryos during preimplnttion development hve been determined using sensitive semi-quntittive RT PCR ssy (Lequrre et l., 1997; De Sous et l., 199; Wrenzycki et l., 1999). Furthermore, this technique hs been used to determine the effects of different culture conditions on the mount of mrna expression of vrious developmentlly importnt genes (Wrenzycki et l., 199b, 1999). Vritions in the detected mounts of different mrnas my be ttributed to the mrna structure or the intrcellulr environment ffecting the stbility nd turnover rte of the mrna (Ross,
9 Bovine embryo gene expression nd diet 75 Reltive mrna bundnce () N/K-ATPse Cu/Zn-SOD Dy of collection (b) (c) (d) 3 kg d lib 199) s well s the methodology used to detect rre trnscripts. Polydenyltion my increse the presence of messenger fter reverse trnscription with n oligo-dt primer by incresing the probbility tht such primer will nnel to the trnscript (Moore et l., 199; De Sous et l., 3 kg d lib N/K-ATPse Cu/Zn-SOD Quntity of pulp-bsed diet 7 N/K-ATPse Cu/Zn-SOD Dy of collection b 3 kg d lib N/K-ATPse Cu/Zn-SOD Quntity of brley-bsed diet 3 kg b 7 d lib Fig. 3. Vritions in the reltive bundnce of mrna in bovine morule nd blstocysts developed in heifers on diets of citrus beet pulp (,b) or brley (c,d) ffected by dy of collection (,c) or quntity of diets (b,d). The men reltive mrna bundnce (± SEM) ws determined for N/K-ATPse α1, nd Cu/Zn-SOD from embryos in three independent RNA isoltion RT PCR experiments. Significnt differences re denoted by different superscripts (P.5). d lib: d libitum. b Metbolism of [ 14 C]pyruvte (pmol per embryo per 3 h) () (b) (c) 199b). However, the increse of most gene trnscripts results from synthesis de novo fter the mjor ctivtion of the bovine embryonic genome t the 1-cell stge (Telford et l., 199). Despite nlysis by independent lbortories with slight modifictions in methodology in the present study, the differences tend to be similr within the experimentl subgroups. During preimplnttion development, the formtion of the blstocyst is medited by fluid trnsfer cross the outer blstomeres through the ctivity of N/K-ATPse. N/K- ATPse is composed of two subunits, of which the α (ctlytic) subunit represents the physiologicl role of the enzyme (Jorgensen, 19), while the β (nonctlytic, glycolysted) subunit is thought to fcilitte the processing nd insertion of the α subunit into the plsm membrne (Geering, 1991). The functionl expression of the α subunit is regulted fter trnscription during preimplnttion 7 b Dy of collection 3 kg d lib Quntity of diet pulp b brley Type of diet Fig. 4. Pyruvte metbolism by individul embryos produced in vivo from heifers on diets of citrus beet pulp nd brley ffected by () dy of collection, (b) quntity of diets or (c) type of diet.
10 7 C. Wrenzycki et l. development (Kidder, 1992). As no differences in the reltive bundnce of the α1 trnscripts were found in embryos from ll tretment groups, this trnscript seems to possess n enormous plsticity to vrious environments, or cts rther independent from environmentl fctors. Free oxygen rdicls (FOR) hve been implicted in embryonic rrest nd cell deth (Johnson nd Nsr-Esfhni, 1994). FOR production is physiologicl process tht occurs within cells when electrons lek to oxygen during electron trnsfer rections. This hs pronounced effects on DNA, RNA nd protein synthesis, nd pertubtes cell membrnes, increses intrcellulr ph nd disturbs mitochondril function. While there re numerous non-enzymtic ntioxidnt gents, specific ntioxidnt enzymes re ble to detoxify O 2, H 2 O 2, nd orgnic peroxides (Johnson nd Nsr-Esfhni, 1994), tht is, Cu/Zn-SOD ctlyses the dismuttion rection, removing O 2 species. The significnt increse of Cu/Zn-SOD trnscripts recovered from heifers fed brley-bsed diets, either d libitum or restricted, my be cused by oxidtive stress s result of d libitum feeding of the donor nimls. In ddition, it hs been proposed tht het shock proteins, such s HSP 7, re induced by FOR (Donti et l., 199). The trnscription of this gene is induced by suboptiml culture conditions in mouse embryos (Christins et l., 1995) nd bovine preimplnttion embryos (Wrenzycki et l., 199b, 1999). The differences between embryos collected on different developmentl dys my be ttributed to vrying cell numbers. Evidence indictes tht the rte of energy substrte utiliztion by preimplnttion embryos is n pproprite predictive prmeter for embryo vibility (Rieger, 194; Grdner nd Leese, 19, 19; Rondeu et l., 1995). Rdiolbelled energy substrtes hve been used extensively in studies of bovine embryo metbolism (Rieger, 194, 1992; Rieger nd Guy, 19; Jved nd Wright, 1991; Tiffin et l., 1991; Rieger et l., 1992, b). Furthermore, peroxidtive dmge of mitochondril lipids results in shift in the cells from oxidtive use of pyruvte in the Krebs cycle to metbolize succinte (Johnson nd Nsr-Esfhni, 1994). The effects of nutrition on preimplnttion embryo development my reflect the generl energy blnce, while other effects my be ttributed to those of specific nutrients, such s vitmins or minerls. When defining nutritionl effects, the response to nutrition t one stge of the reproductive cycle my hve profound responses t lter stge. Effects on the preovultory development of the oocyte will crry over into the periovultory period (Downing et l., 1995; Thoms et l., 1997) nd these nutritionl effects could continue to ffect pre- nd post-fertiliztion events within the oviduct (Rbiee et l., 1997). The uterine phse of development is ffected by nutritionl fctors either indirectly, by effects on progesterone secretion, or directly t the uterus. In sheep, effects on circulting progesterone concentrtions my be n importnt mechnism by which nutrition nd metbolic stte lter embryo survivl (Prr et l., 197, 1993). Furthermore, in superovulted ewes infused with glucose, decrese in ovultion rte nd embryo qulity ws found (Ykub et l., 1997). The correltion dt demonstrte tht feeding the brleybsed diet d libitum to the donor heifers led to decresed pyruvte utiliztion nd n increse in the reltive bundnce of the Cu/Zn-SOD trnscript in dy embryos. The correltion indictes tht the incresed mounts of Cu/Zn-SOD mrna re due to cellulr stress in these embryos. This hypothesis is supported by the fct tht, in embryos derived from heifers fed brley-bsed diets, pyruvte uptke is significntly incresed compred with tht in embryos from heifers fed pulp-bsed diets. Reduced development of bovine embryos grown in vitro under serumfree conditions is lso ssocited with incresed pyruvte uptke (Eckert et l., 1999). Furthermore, significntly smller number of trnsferble embryos ws recovered from brley-fed compred with pulp-fed donor nimls (Ykub et l., 1999) indicting tht there is negtive ssocition between the brley diet nd erly embryonic development. In ddition, oxidtive stress cused by d libitum feeding of the donor nimls my lso led to significntly decresed number of trnsferble embryos compred with donor nimls fed restricted diets (Ykub et l., 1999). In conclusion, for the first time, differences in gene expression nd metbolic substrte metbolism in in vivo derived embryos collected from heifers fed different quntities nd types of diet were determined. These differences observed in embryos collected on the sme dy of development cn be ttributed to the composition nd quntity of diet fed to the donor niml. The type of diet my lso lter oocyte development nd mturtion nd embryonic development by ltertion of the microenvironment. As result of these metbolic chnges, trnscription nd trnsltion of key developmentl genes my be ltered with effects on erly development. The present findings chrcterize embryos produced in vivo t the moleculr level, nd indicte tht these moleculr mrkers cn be used to differentite between popultions of embryos produced under different nutritionl regimens, nd to determine conditions conducive to the production of good qulity embryos. References Armstrong DT (1993) Recent dvnces in superovultion in cttle Theriogenology Betts DH, McPhee DJ, Kidder GM nd Wtson AJ (1997) Oubin sensitivity nd expression of N/K-ATPse α- nd β-subunit isoform genes during bovine erly development Moleculr Reproduction nd Development Blnchrd T, Ferguson J, Love L, Tked T, Henderson B, Hsler J nd Chlup W (199) Effect of dietry crude-protein type on fertiliztion nd embryo qulity in diry cttle Americn Journl of Veterinry Reserch Bolnd MP, Crosby TF nd Gordon I (197) Morphologicl normlity of cttle embryos following superovultion using PMSG Theriogenology Bolnd MP, Goulding D nd Roche JF (1991) Alterntive gondotropins for superovultion in cttle Theriogenology Bungrtz L nd Niemnn H (1994) Assessment of the presence of dominnt follicle nd selection of diry cows suitble for superovultion by single ultrsound exmintion Journl of Reproduction nd Fertility Cheng J-F, Rid L nd Hrdison RC (19) Isoltion nd nucleotide sequence of rbbit globin gene cluster ψζ-α1-αψ. Absence of pir of α-globin genes evolving in concert Journl of Biologicl Chemistry Christins E, CmpionE, Thompson EM nd Renrd J-P (1995) Expression of the HSP 7.1 gene, lndmrk in erly zygotic ctivity in the mouse embryo is restricted to the first burst of trnscription Development
11 Bovine embryo gene expression nd diet 77 De Sous PA, Westhusin ME nd Wtson AJ (199) Anlysis of vrition in reltive mrna bundnce for specific gene trnscripts in single bovine oocytes nd erly embryos Moleculr Reproduction nd Development De Sous PA, Wtson AJ nd Schultz RM (199b) Trnsient expression of trnsltion initition fctor is conservtively ssocited with embryonic gene ctivtion in murine nd bovine embryos Biology of Reproduction Donti YRA, Slosmn DO nd Poll BS (199) Oxidtive injury nd the het shock response Biochemicl Phrmcology Downing JA nd Scrmuzzi RJ (1991) Nutrient effects on ovultion rte, ovrin function nd the secretion of gondotrophin nd metbolic hormones in sheep Journl of Reproduction nd Fertility Supplement Downing JA, Joss J nd Scrmuzzi RJ (1995) Ovultion rte nd the concentrtions of gondotrophins nd metbolic hormones in ewes infused with glucose during the lte lutel phse of the oestrus cycle Journl of Endocrinology Eckert J, Pugh PA, Thompson JG, Niemnn H nd Tervit R (199) Exogenous protein ffects developmentl competence nd metbolic ctivity of bovine preimplnttion embryos in vitro. Reproduction, Fertility nd Development Grdner DK (199) Chnges in requirements nd utiliztion of nutrients during mmmlin preimplnttion embryo development nd their significnce in embryo culture Theriogenology Grdner DK nd Leese HJ (19) Non-invsive mesurement of nutrient uptke by single cultured preimplnttion mouse embryos Humn Reproduction Grdner DK nd Leese HJ (19) The role of glucose nd pyruvte trnsport in regulting nutrient utiliztion by preimplnttion mouse embryos Development Geering K (1991) The functionl role of the bet subunit in the mturtion nd intrcellulr trnsport of N/K-ATPse FEBS Letters Goulding D, Willims DH, Roche JF nd Bolnd MP (1994) Effect of exogenous progesterone on superovultory response in heifers inseminted with fresh or frozen semen Journl of Reproduction nd Fertility Goulding D, Willims DH, Roche JF nd Bolnd MP (199) Fctors ffecting superovultion in heifers treted with PMSG Theriogenology Hrvey MB, Arcelln-Pnlilio MY, Zhng X, Schultz GA nd Wtson AJ (1995) Expression of genes encoding ntioxidnt enzymes in preimplnttion mouse nd cow embryos nd primry bovine oviduct cultures employed for embryo coculture Biology of Reproduction Ho Y, Doherty AS nd Schultz RM (1994) Mouse preimplnttion embryo development in vitro: effect of sodium concentrtion in culture medi on RNA synthesis nd ccumultion nd gene expression Moleculr Reproduction nd Development Ho Y, Wigglesworth K, Eppig JJ nd Schultz RM (1995) Preimplnttion development of mouse embryos in KSOM: ugmenttion by mino cids nd nlysis of gene expression Moleculr Reproduction nd Development Ho YS nd Crpo JD (197) Sequences of cdna nd deduced mino cid of rt copper-zinc-contining superoxide dismutse Journl of Biologicl Chemistry Jved MH nd Wright RW, Jr (1991) Determintion of pentose phosphte nd Embden Meyerhof pthwy ctivities in bovine embryos Theriogenology Johnson MH nd Nsr-Esfhni MH (1994) Rdicl solutions nd culturl problems: could free oxygen rdicls be responsible for the impired development of preimplnttion mmmlin embryos in vitro? BioEssys Jorgensen PL (19) Structure, function nd regultion of the N/K-ATPse in the kidney Kidney Interntionl Kno I, Ngi F, Stoh K, Ushiym K, Nko T nd Kno K (199) Structure of the α1 subunit of horse N,K-ATPse gene FEBS Letters Kelly P, Duffy P, Roche JF nd Bolnd MP (1997) Superovultion in cttle: effect of FSH type nd method of dministrtion of folliculr growth, ovultory response nd endocrine pttern Animl Reproduction Science Kidder GM (1992) The genetic progrm for preimplnttion development Developmentl Genetics Kidder GM (1993) Genes involved in clevge, compction nd blstocyst formtion. In Genes in Mmmlin Reproduction pp Ed. RBL Gwtkin. Wiley Liss, New York Koerber S, Sntos AN, Tetens F, Küchenhoff A nd Fischer B (199) Incresed expression of NADH Ubiquinone oxidoreductse chin 2 (ND2) in preimplnttion rbbit embryos cultured with 2% oxygen concentrtion Moleculr Reproduction nd Development Lthm KE, Scott CD, Doherty AS nd Schultz RM (1995) Igf2r nd Igf2 gene expression in ndrogenetic, gynogenetic, nd prthenogenetic preimplnttion mouse embryos: bsence of regultion by genomic imprinting Genes nd Development Lequrre AS, Grisrt B, Moreu B, Schuurbiers N, Mssip A nd Dessy F (1997) Glucose metbolism during bovine preimplnttion development: nlysis of gene expression in single oocytes nd embryos Moleculr Reproduction nd Development Mntovni R, Enright WJ, Kene MG, Roche JF nd Bolnd MP (1993) Effect of nutrition nd dose of follicle stimulting hormone (FSH) on superovultory response in beef heifers Proceedings of 9th Scientific Meeting of Assocition Europeene de Trnsfert Embyonnire, Lyon p. 234 Moloney AP, Almildi AA, Drennn MJ nd Cffrey PJ (1994) Rumen nd blood vribles in steers fed grss silge nd rolled brley or sugr cne mollsses-bsed supplements Animl Feeding Science Technology Moore GD, Aybe T, Kopf GS nd Schultz RM (199) Temporl pttern of gene expression of G1-S cyclins nd cdks during the first nd second mitotic cell cycles in mouse embryos Moleculr Reproduction nd Development Morit Y, Tsutsumi O, Ok Y nd Tketni Y (1994) Glucose trnsporter GLUT 1 mrna expression in the ontogeny of glucose incorportion in mouse preimplnttion embryos Biochemicl nd Biophysicl Reserch Communiction Murphy MG, Enright WJ, Crowe MA, McConnell K, Spicer LJ, Bolnd MP nd Roche JF (1991) Effect of dietry intke on pttern of growth of dominnt follicles during the oestrus cycle in beef heifers Journl of Reproduction nd Fertility Noln R, O Clllghn D, Duby RT, Lonergn P nd Bolnd MP (199) The influence of short-term nutrient chnges on follicle growth nd embryo production following superovultion in beef heifers Theriogenology Overström EW (199) In vitro ssessment of embryo vibility Theriogenology Prr RA, Dvis IF, Firclough RJ nd Moss MA (197) Overfeeding during erly pregnncy reduces peripherl progesterone concentrtion nd pregnncy in sheep Journl of Reproduction nd Fertility Prr RA, Dvis IF, Miles MA nd Squires TJ (1993) Feed intke ffects metbolic clernce rte of progesterone in sheep Reserch in Veterinry Science Rbiee AR, Len IJ, Gooden JM, Miller BG nd Scrmuzzi RJ (1997) An evlution of trnsovrin uptke of metbolites using rterio venous difference methods in diry cttle Animl Reproduction Science Rieger D (194) The mesurement of metbolic ctivity s n pproch to evluting vibility nd dignosing sex in erly embryos Theriogenology Rieger D (1992) Reltionships between energy metbolism nd development of erly mmmlin embryos Theriogenology Rieger D nd Guy P (19) Mesurement of the metbolism of energy substrtes in individul bovine blstocysts Journl of Reproduction nd Fertility Rieger D, Loskutoff NM nd Betteridge KJ (1992) Developmentlly relted chnges in the uptke nd metbolism of glucose, glutmine nd pyruvte by cttle embryos produced in vitro. Reproduction, Fertility nd Development Rieger D, Loskutoff NM nd Betteridge KJ (1992b) Developmentlly relted chnges in the metbolism of glucose nd glutmine by cttle embryos produced nd co-cultured in vitro. Journl of Reproduction nd Fertility Rondeu M, Guy P, Goff AK nd Cooke GM (1995) Assessment of embryo potentil by visul nd metbolic evlution Theriogenology Rosenkrns CF, Jr nd First NL (1994) Effect of free mino cids nd vitmins on clevge nd developmentl rte of bovine zygotes in vitro. Journl of Animl Science Ross J (199) Control of messenger RNA stbility in higher eukyotes Trends in Genetics SAS (199) SAS User s Guide: Sttistics SAS Institute, Cry, NC Shim C, Kwon HB nd Kim K (199) Differentil expression of lminin chinspecific mrna trnscripts during mouse preimplnttion embryo development Moleculr Reproduction nd Development
12 7 C. Wrenzycki et l. Shull GE, Greeb J nd Lingrel JB (19) Moleculr cloning of 3 distinct forms of the N +,K + -ATPse lph-subunit from rt brin Biochemistry Slon BK, Rowlinson P nd Armstrong DG (19) Milk production in erly lcttion diry cows given grss silge d libitum: influence of concentrte energy source, crude protein content nd level of concentrte llownce Animl Production Tkhshi Y nd First NL (1992) In vitro development of bovine one-cell embryos: influence of glucose, lctte, pyruvte, mino cids nd vitmins Theriogenology Telford NA, Wtson AJ nd Schultz GA (199) Trnsition from mternl to embryonic control in erly mmmlin development: comprison of severl species Moleculr Reproduction nd Development Temeles GL, Rm PT, Rothstein JL nd Schultz RM (1994) Expression ptterns of novel genes during mouse preimplnttion embryogenesis Moleculr Reproduction nd Development Thoms MG, Bo B nd Willims GL (1997) Dietry fts vrying in their ftty cid composition differentilly influence folliculr growth in cows fed isoenergetic diets Journl of Animl Science Tiffin GJ, Rieger D, Betteridge KJ, Ydv BR nd King WA (1991) Glucose nd glutmine metbolism in prettchment cttle embryos in reltion to sex nd stge of development Journl of Reproduction nd Fertility Thompson JG, Prtridge RJ, Houghton FD, Cox CI nd Leese HJ (199) Oxygen uptke nd crbohydrte metbolism by in vitro derived bovine embryos Journl of Reproduction nd Fertility Wtson AJ (1992) The cell biology of blstocyst development Moleculr Reproduction nd Development Wrenzycki C, Herrmnn D, Crnwth JW nd Niemnn H (199) Expression of the gp junction gene connexin43 (Cx43) in preimplnttion bovine embryos derived in vitro or in vivo. Journl of Reproduction nd Fertility Wrenzycki C, Herrmnn D, Crnwth JW nd Niemnn H (199) RNA expression of developmentlly importnt genes in preimplnttion bovine embryos produced in TCM supplemented with bovine serum lbumin (BSA) Journl of Reproduction nd Fertility Wrenzycki C, Herrmnn D, Lemme E, Korswe K, Crnwth JW nd Niemnn H (199b) Determintion of the reltive bundnce of vrious developmentlly importnt gene trnscripts in bovine embryos generted in vitro or in vivo using semi-quntittive RT PCR ssy Stellite Workshop Proceedings, Embryo Development In Vitro Current Chllenges nd Future Concepts, Boston pp Wrenzycki C, Herrmnn D, Crnwth JW nd Niemnn H (1999) Altertions in the reltive bundnce of gene trnscripts in preimplnttion bovine embryos cultured in medium supplemented with either serum or PVA Moleculr Reproduction nd Development 53 1 Ykub H, Willims SA, O Cllghn D nd Bolnd MP (1997) Effect of dietry intke nd glucose infusion on ovultion rte nd embryo qulity in superovulted ewes Journl of Reproduction nd Fertility Abstrct Series 19 Abstrct 151 Ykub H, O Cllghn D nd Bolnd MP (1999) Effect of type nd quntity of concentrte on superovultion nd embryo yield in beef heifers Theriogenology
Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationSoybean Hulls as an Alternative Feed for Horses
Animl Industry Report AS 650 ASL R1931 2004 Soyben Hulls s n Alterntive Feed for Horses Josie Booth Iow Stte University Howrd Tyler Iow Stte University Peggy Miller-Auwerd Iow Stte University Jenette Moore
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationEffect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows
Ksetsrt J. (Nt. Sci.) 37 : 145-149 (2003) Effect of Orl Administrtion of Propylene Glycol on Serum Glucose Concentrtions in Periprturient Diry Cows Theer Rukkwmsuk, Nrongpol Petploi, Ing-orn Preechnvinit,
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationComparison of three simple methods for the
J. clin. Pth. (1967), 2, 5 Comprison of three simple methods for the ssessment of 'free' thyroid hormone T. M. D. GIMLETTE1 From the Rdio-Isotope Lbortory, St. Thoms's Hospitl, London SYNOPSIS A dilysis
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationThe Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers
Beef Reserch Report, 2000 Animl Science Reserch Reports 2001 The Effects of High-Oil Corn or Typicl Corn with or without Supplementl Ft on Diet Digestibility in Finishing Steers Crig R. Belknp Iow Stte
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationAOAC Official Method Determination of Isoflavones in Soy and Selected Foods Containing Soy
45.4.14 AOAC Officil Method 2001.10 Determintion of Isoflvones in Soy nd Selected Foods Contining Soy Extrction, Sponifiction, nd Liquid Chromtogrphy First Action 2001 (Applicble to the determintion of
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationA. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5
Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationChromium Content Of Feedstuffs. Chromium An Essential Nutrient. Which Tissue?
CHROMIUM FOR DAIRY CATTLE Chromium Content Of Feedstuffs Feedstuff Avil Cr in Diry Production A. Geiger, Ph.D. Zinpro Corportion Psture 0.8 Whet silge 2.2 Dehydrted lflf 0.2 Corn silge 2.0 Ryegrss 0.4
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationEffect of Field Pea Replacement and Yucca schidigera extract on weaning transition growth and feedlot performance
Effect of Field Pe Replcement nd Yucc schidiger extrct on wening trnsition growth nd feedlot performnce D.G. Lndblom 1 nd J. Pennington 2 1 Dickinson Reserch Extension Center, Dickinson, ND 2 Dickinson
More informationProtein Quality Dynamics During. Grass-Legume Forage
Protein Qulity Dynmics During Wilting nd Preservtion of Grss-Legume Forge Eliset Ndeu 1, Wolfrm Richrdt 2, Michel Murphy 3 nd Horst Auerch 4 1 Swedish University of Agriculturl Sciences, Skr, Sweden 2
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,
DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,
More informationArticle Cryosystem assessment by glucose uptake of murine blastocysts
RBMOnline - Vol 11. No 5. 2005 601 607 Reproductive BioMedicine Online; www.rbmonline.com/article/1747 on web 31 August 2005 Article Cryosystem ssessment by glucose uptke of murine blstocysts Dvid Wlker
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationA comparative study on the extraction of membranebound bilirubin from erythrocyte membranes using various methods
J. Biochem. Biophys. Methods 39 (1999) 39 45 A comprtive study on the extrction of membrnebound bilirubin from erythrocyte membrnes using vrious methods * Sd Tyyb, Mohmmd Kutub Ali Interdisciplinry Biotechnology
More informationIntroduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010
Introduction Lnce Bumgrd Associte Professor Ntive of southwest Minnesot BS: U of Minnesot MS: U of Minnesot Advisor: Brin Crooker Thesis: Effects of genetic selection for milk yield on somtotropin prmeters
More informationFERTILITY EFFECTS OF SODIUM FLUORIDE IN MALE MICE
128 Fluoride Vol. 33 No. 3 128-134 2000 Reserch Report FERTILITY EFFECTS OF SODIUM FLUORIDE IN MALE MICE Ahmed Elbetieh, Hom Drmni, Ahmd S Al-Hiyst b Irbid, Jordn SUMMARY: Sexully mture mle Swiss mice
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationNorthern blot analysis
Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C 5 2 4 1 um C 5 2 4 1 um Angus dipocytes expressed SCD higher thn Wgyu dipocyte
More informationAnalysis of Regulatory of Interrelated Activity of Hepatocyte and Hepatitis B Viruses
Interntionl Journl of Biomedicl Mterils Reserch 8 6(): -7 http://www.sciencepublishinggroup.com/j/ijbmr doi:.648/j.ijbmr.86. ISSN: 33-756 (Print) ISSN: 33-7579 (Online) Anlysis of Regultory of Interrelted
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationSupporting Information
Supporting Informtion Ethylbromoisobutyrte (EBIB), tin (II) 2-ethylhexnote (Sn(EH) 2 ), copper (II) bromide (CuBr 2 ), toluene, sodium zide, dimethylformmide (DMF), nd N, N, N, N, N pentmethyltriethylenedimine
More informationScientific research on the biological value of olive oil
Scientific reserch on the biologicl vlue olive oil Cov F.G. Ally M. (ed.). L' économie de l' olivier Pr : CIHEAM Options Méditerrnéennes : Série Etudes; n. 1988-V 1988 pges 149-152 Article vilble on le
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationReplacing Fish Meal with Soybean Meal and Brewer s Grains with Yeast in Diets for Australian Red Claw Crayfish, Cherax quadricarinatus
Replcing Fish Mel with Soyben Mel nd Brewer s Grins with Yest in Diets for Austrlin Red Clw Cryfish, Cherx qudricrintus Lur A. Muzinic*, Kenneth R. Thompson, & Crl D. Webster Introduction Soyben mel (SBM)
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More information3/10/ Energy metabolism o How to best supply energy to the pig o How the pig uses energy for growth
Keeping Control of Feed Costs in n Uncertin Mrket Presented To: Iow Pork Producers Assocition Regionl Meetings Februry, 2009 John F. Ptience Iow Stte University Ames, IA Outline Wht s new in swine nutrition
More informationStrategies for Cost-Effective Supplementation of Beef Cattle 1
SS-ANS-14 Strtegies for Cost-Effective Supplementtion of Beef Cttle 1 Mtt Hersom nd W. E. Kunkle 2 Forge should provide the mjority of the nutrition for the beef herd. Sesonl forge growth nd chnges in
More informationEffect of FSH and insulin on lipogenesis in cultures of Sertoli cells from immature rats
Brzilin Journl of Medicl nd Biologicl Reserch (1997) 30: 591-597 FSH nd insulin in lipogenesis in Sertoli cells ISSN 0100-879X 591 Effect of FSH nd insulin on lipogenesis in cultures of Sertoli cells from
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationTheriogenology 41:
Theriogenology 41:915-9211 1994 VIABILITY OF FROZEN-THAWED BOVINE IVM/IVF EMBRYOS IN RELATION TO AGING USING VARIOUS CRYOPROTECTANTS M. Tkgi 1 IT. Otoi 2, A. Boediono 1, S. Sh 1 nd T. Suzuki! 1 United
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationBeetroot juice and exercise: pharmacodynamic and dose-response relationships
J Appl Physiol 115: 325 336, 2013. First published My 2, 2013; doi:10.1152/jpplphysiol.00372.2013. Beetroot juice nd exercise: phrmcodynmic nd dose-response reltionships Lee J. Wylie, 1 Jmes Kelly, 1 Stephen
More informationAppendix J Environmental Justice Populations
Appendix J Environmentl Justice s [This pge intentionlly left blnk] Tble of Contents REFERENCES...J-2 Pge LIST OF TABLES Pge Tble J-1: Demogrphic Overview of Bruinsburg Site Project Are... J-3 Tble J-2:
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationCHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS
CHAPTER- 3 CHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS 3.1. INTRODUCTION The liver, hs vriety of trnsminse to synthesize nd
More informationRelationship between food availability, glycerol and glycogen levels in lowtemperature challenged rainbow smelt Osmerus mordax
866 The Journl of Experimentl Biology, 866-87 Published by The Compny of Biologists 7 doi:.4/jeb.749 Reltionship between food vilbility, glycerol nd glycogen levels in lowtemperture chllenged rinbow smelt
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationThe Effects of Diet Particle Size on Animal Performance
MF-2050 Feed Mnufcturing Feed Mnufcturing Cerel grins re the primry energy source in swine nd poultry diets. Therefore, not only must producers be concerned bout the composition of the grin, but lso how
More informationMetabolomics Reveals How Cucumber (Cucumis. sativus) Reprograms Metabolites to Cope with. Silver Nanoparticle-Induced Oxidative Stress
1 Supporting Informtion for 2 3 4 5 Metbolomics Revels How Cucumber (Cucumis stivus) Reprogrms Metbolites to Cope with Silver Nnoprticle-Induced xidtive Stress 6 7 8 Huiling Zhng, Wencho Du, Jose R. Perlt-Vide
More informationACROSOME REACTION PROGRESS IN FROZEN-THAWED AND CAPACITATED BOAR SPERMATOZOA INFLUENCES THE EFFICIENCY OF IN VITRO FERTILIZATION
H G BDG, 2, 28 (1) G Z-HWD D D B Z LU H Y V LZ rtečíková. 1, 2, Hulínská. 1, ečková Z. 1, Hnzlová K. 1, Ješet. 1, chtková. 1 1 Veterinry eserch nstitute, Brno, zech epublic 2 sryk University, culty of
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationEffects of Dietary Methionine-Supplementation on the General Performance and Economic Value of Rahmani Lambs
Avilble online t www.scinzer.com ISSN 0000-0000 Effects of Dietry Methionine-Supplementtion on the Generl Performnce nd Economic Vlue of Rhmni Lmbs A. S. El-Thwy 1 *, A. M. Ismeil 2, H. A. Ahmed 3 1. Deprtment
More informationEffect of granulocyte macrophage colony-stimulating factor deficiency on ovarian follicular cell function
Journl of Reproduction nd Fertility (2) 12, 283 292 Effect of grnulocyte mcrophge colony-stimulting fctor deficiency on ovrin folliculr cell function R. B. Gilchrist, D. B. Rowe, L. J. Ritter, S. A. Robertson,
More informationSUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis
SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song
More informationPaper-based skin patch for the diagnostic screening of cystic fibrosis
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 2015 Supplementry informtion Pper-bsed skin ptch for the dignostic screening of cystic fibrosis Xun Mu,*
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationFermentation of L-Aspartate by a Saccharolytic Strain of
APPLIZD AND ENVIRONMENTAL MICROBIOLOGY, Jn. 1977, p. 69-73 Copyright 1977 Americn Society for Microbiology Vol. 33, No. 1 Printed in U.S.A. Fermenttion of L-Asprtte by Scchrolytic Strin of Bcteroides melninogenicus
More informationTHE INFLUENCE OF MILK THISTLE SEED CAKES ON BROILER CHICKENS PERFORMANCE PARAMETERS
THE INFLUENCE OF MILK THISTLE SEED CAKES ON BROILER CHICKENS PERFORMANCE PARAMETERS STASTNIK ONDREJ 1, DETVANOVA LENKA 2, KARASEK FILIP 1, STENCLOVA HANA 1, KALHOTKA LIBOR 2, PAVLATA LEOS 1, MRKVICOVA
More informationEffect of Various Doses of Cinnamon on Lipid Profile in Diabetic Individuals
Pkistn Journl of Nutrition 2 (5): 312-319, 2003 Asin Network for Scientific Informtion 2003 Effect of Vrious Doses of Cinnmon on Lipid Profile in Dibetic Individuls Alm Khn, Mhpr Sfdr nd Mohmmd Muzffr
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationGeographical influence on digit ratio (2D:4D): a case study of Andoni and Ikwerre ethnic groups in Niger delta, Nigeria.
Journl of Applied Biosciences 27: 1736-1741 ISSN 1997 5902 Geogrphicl influence on digit rtio (2D:4D): cse study of Andoni nd Ikwerre ethnic groups in Niger delt, Nigeri. Gwunirem, Isrel U 1 nd Ihemelndu,
More informationEffect of processing on in vitro bioaccessibility of phenolics, flavonoids and antioxidant activity of vegetables with/without yoghurt
Effect of processing on in vitro ioccessiility of phenolics, flvonoids nd ntioxidnt ctivity of vegetles with/without yoghurt Assoc. Prof. Dr. Esr ÇAPANOĞLU GÜVEN Deprtment of Food Engineering Istnul Technicl
More informationMolecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress
Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationNot for Citation or Publication Without Consent of the Author
Not for Cittion or Puliction Without Consent of the Author AN AUTOMATED SEX PHEROMONE TRAP FOR MONITORING ADULT CM AND OFM AND THE INFLUENCE OF TRAP COLOR ON MOTH AND NON-TARGET CAPTURES Brin L. Lehmn
More informationRecent advances in cryopreservation od salmonid fish semen. Andrzej Ciereszko
Recent dvnces in cryopreservtion od slmonid fish semen Andrzej Ciereszko Institute of Animl Reproduction nd Food Reserch, Polish Acdemy of Sciences in Olsztyn, Polnd Justifiction for the studies Poor performnce
More informationEffect of Mannan Oligosaccharide (Bio-Mos) Addition With and Without Zinc Oxide on Performance and Immunocompetence of Weanling Pigs
Effect of Mnnn Oligoscchride (Bio-Mos) Addition With nd Without Zinc Oxide on Performnce nd Immunocompetence of Wenling Pigs E. Dvis, C. Mxwell, B. de Rods, nd D. Brown 1 Story in Brief An experiment involving
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationphosphatase isoenzyme activity: estimation of
J Clin Pthol 1988;41:202-206 Quntittive method for determining serum lkline phosphtse isoenzyme ctivity: estimtion of intestinl component M J PEAKE, M PEJAKOVIC, G H WHITE From the Deprtment ofbiochemistry
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationThe Acute Time Course of Concurrent Activation Potentiation
Mrquette University e-publictions@mrquette Exercise Science Fculty Reserch nd Publictions Exercise Science, Deprtment of 1-1-2010 The Acute Time Course of Concurrent Activtion Potentition Luke Grceu Mrquette
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationXII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV
XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies
More informationAltered dietary nutrient intake maintains metabolic homeostasis in parasitized larvae of the insect Manduca sexta L.
The Journl of Experimentl iology 2, 65 (21) Printed in Gret ritin The Compny of iologists Limited 21 JE316 65 ltered dietry nutrient intke mintins metbolic homeostsis in prsitized lrve of the insect Mnduc
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationMaternal metabolic stress may affect oviduct gatekeeper function
Mternl metbolic stress my ffect oviduct gtekeeper function L. Jordens, V. Vn Hoeck, V. Millo b, A. Gutierrez-Adn b, W. Mrei,c, B. Vleminck d, S. Thys e, R. Sturmey f, P.E.J. Bols, J.L.M.R. Leroy Lbortory
More information