Effects of superovulated heifer diet type and quantity on relative mrna abundances and pyruvate metabolism in recovered embryos.

Transcription

1 Western University Obstetrics & Gynecology Publictions Obstetrics & Gynecology Deprtment Effects of superovulted heifer diet type nd quntity on reltive mrna bundnces nd pyruvte metbolism in recovered embryos. C Wrenzycki P De Sous E W Overström R T Duby D Herrmnn See next pge for dditionl uthors Follow this nd dditionl works t: Prt of the Obstetrics nd Gynecology Commons Cittion of this pper: Wrenzycki, C; De Sous, P; Overström, E W; Duby, R T; Herrmnn, D; Wtson, A J; Niemnn, H; O'Cllghn, D; nd Bolnd, M P, "Effects of superovulted heifer diet type nd quntity on reltive mrna bundnces nd pyruvte metbolism in recovered embryos." (2). Obstetrics & Gynecology Publictions. 5.

2 Authors C Wrenzycki, P De Sous, E W Overström, R T Duby, D Herrmnn, A J Wtson, H Niemnn, D O'Cllghn, nd M P Bolnd This rticle is vilble t Scholrship@Western:

3 Journl of Reproduction nd Fertility (2) 11, 9 7 Effects of superovulted heifer diet type nd quntity on reltive mrna bundnces nd pyruvte metbolism in recovered embryos C. Wrenzycki 1, P. De Sous 2, E. W. Overström 3, R. T. Duby 4, D. Herrmnn 1, A. J. Wtson 5, H. Niemnn 1, D. O Cllghn nd M. P. Bolnd 7 1 Deprtment of Biotechnology, Institut für Tierzucht und Tierverhlten (FAL), Mriensee, Neustdt, Germny; 2 Roslin Bio-Med, Roslin Institute, Roslin, UK; 3 Deprtments of Biomedicl Sciences nd Antomy nd Cellulr Biology, Tufts University, MA, USA; 4 Deprtment of Veterinry nd Animl Sciences, University of Msschusetts, MA, USA; 5 Deprtments of Obstetrics nd Gynecology nd Physiology, University of Western Ontrio, London, Ontrio, Cnd; Fculty of Veterinry Medicine nd 7 Fculty of Agriculture, University College Dublin, Irelnd This study investigted the effects of quntity nd type of diet fed to superovulted donor heifers on moleculr nd metbolic indices of embryonic development. These effects included the reltive bundnces of mrnas for the α1 subunit of N/K-ATPse nd the ntioxidnt enzyme Cu/Zn-SOD, s well s pyruvte utiliztion in bovine morule nd blstocysts developed in vivo. Heifers were fed dily rtion of either grss silge nd citrus beet pulp-bsed concentrte or grss silge nd brley-bsed concentrte for 11 dys, both t 3 kg per dy or d libitum. In embryos derived from heifers fed the pulp-bsed diets, the reltive bundnces of the trnscripts were not ffected by either dy of collection or quntity of diet. In embryos derived from heifers fed the brley-bsed diets, the reltive bundnces of the N/K-ATPse trnscripts were lso not chnged by these min effects, while the reltive bundnces of the Cu/Zn-SOD trnscripts were ffected by dy of collection nd by the quntity of diet. Pyruvte metbolism ws ffected by dy of collection, nd ws significntly incresed in dy embryos compred with dy 7 nd dy embryos. Diet quntity did not ffect pyruvte utiliztion, wheres diet type did increse pyruvte metbolism in the brley group when compred with the pulp group. The results of this study show for the first time tht moleculr nd metbolic vritions my exist in embryos derived in vivo nd developed in donor heifers on nutritionl regimens differing in type nd quntity. Differences in embryos collected on different developmentl dys my be ttributed to vrying cell numbers. Altertions in the reltive bundnces of the Cu/Zn-SOD trnscripts nd pyruvte metbolism cused by the quntity of diet fed to the donor niml were likely to hve been due to ltertions in metbolic end products tht ccumulte in reproductive trct fluids, wheres differences in embryonic metbolism cused by type of diet re relted to the composition of the diet. These findings chrcterize embryos produced in vivo t the moleculr level, indicting tht the moleculr mrkers used in the present study cn differentite between popultions of embryos produced under different nutritionl regimens nd determine conditions conducive to the production of good qulity embryos. Introduction Superovultion of donors provides multiple embryos for the embryo trnsfer industry (Bolnd et l., 1991; Armstrong, 1993). Despite mjor reserch inititives to enhnce nd stndrdize the superovultory response to exogenous gondotrophins, niml to niml vrition in number nd qulity of embryos remins problem (Goulding et l., 199; Kelly et l., 1997). Severl fctors, such s seson, breed, type Received 1 Februry of gondotrophin nd the presence or bsence of dominnt follicle, contribute to the vrible number nd qulity of embryos produced (Armstrong, 1993; Bungrtz nd Niemnn, 1994). In superovulted beef heifers, n increse in concentrte intke from 3 kg per dy to d libitum reduced the number of ovultions nd provided fewer good qulity embryos (Mntovni et l., 1993). The type of diet fed before superovultion lso ffects superovultory response nd embryo qulity. Heifers fed high concentrte low fibre diet before superovultion hd fewer high qulity embryos 2 Journls of Reproduction nd Fertility Ltd /2

4 7 C. Wrenzycki et l. (Ykub et l., 1999). Similrly, rtions of high rumendegrdble protein decresed fertiliztion rtes nd preimplnttion development (Blnchrd et l., 199). Thus, diet type, either in terms of energy source or protein content, cn lter embryo yields nd survivl. The quntity of the food cn lso ffect other prmeters of the reproductive response, such s follicle size nd progesterone concentrtions (Murphy et l., 1991; Noln et l., 199). The min energy substrtes used by ruminnts re voltile ftty cids (VFA) which re produced in the rumen. The type of concentrte fed ffects rumen fermenttion, with VFA profiles differing between cttle fed on strch-bsed or fibrebsed concentrte (Moloney et l., 1994). The reltive mounts of ech VFA produced re diet-dependent, but rpidly fermented concentrte supplements tend to fvour the production of propionte, nd the more slowly fermented fibre-bsed diets fvour cette production (Slon et l., 19). Propionte is the min precursor of glucose synthesis in the liver. Glucose, mino cids or nutrientrelted metbolites, such s insulin, growth hormone, nd the insulin-like growth fctors nd their binding proteins, hve been postulted to operte t the ovrin level nd to support the growth of the gondotrophin-dependent follicles by reducing the mount of FSH required for follicle growth (Downing nd Scrmuzzi, 1991). Bovine embryos re sensitive to glucose, s high concentrtions in culture medi inhibit embryo development in vitro (Tkhshi nd First, 1992). The gene trnscripts nlysed in the present study re known to ply essentil roles during preimplnttion development. N/K-ATPse is key enzyme for blstocyst development, mediting fluid trnsfer cross the outer blstomeres to form fluid-filled cvity (Wtson, 1992, Kidder, 1993). In bovine embryos produced in vitro, trnscripts encoding multiple isoforms of both the α nd β subunits of N/K-ATPse re expressed throughout erly development (Betts et l., 1997). A similr trnscription pttern ws detected for the ntioxidnt enzyme, Cu/Zn- SOD (Hrvey et l., 1995), which is involved in protection from oxidtive stress. Another ccepted mrker of embryo qulity is energy metbolism (Rieger, 194, 1992; Overström, 199; Grdner, 199). Temporl, stge-specific pthwys of energy metbolism hve been investigted nd metbolic ctivity my provide n objective mens to ssess the vibility of embryos (Rieger, 1992). The ptterns of uptke nd metbolic utiliztion of energy substrtes, such s pyruvte, lctte, glucose nd glutmine, hve been determined in bovine embryos (Thompson et l., 199). Given the reported effects of diet type nd quntity on embryo qulity fter superovultion nd the effects of diet type nd quntity on energy metbolism in cttle, the purpose of this experiment ws to evlute the effects of quntity nd type of diet on the reltive bundnce of two different gene trnscripts nd pyruvte metbolism in cttle embryos recovered t the morul nd blstocyst stges fter superovultory tretment. While in vitro culture conditions cn hve profound effects on the expression of importnt genes in developing rodent nd bovine embryos (Ho et l., 1994, 1995; Morit et l., 1994; Shim et l., 199; Wrenzycki et l., 199, 199, 1999; Koerber et l., 199), the effects of nutrition regimens on gene expression nd metbolism in bovine embryos collected from superovulted donors hve not yet been reported. The nutritionl model used ws designed to provide differing mounts (3 kg per dy versus d libitum) nd types (strch (brley)-bsed versus sugr (citrus beet pulp)- bsed) of concentrte supplement to lter rumen metbolism. The heifers were superovulted to produce dequte embryos from the nutritionlly treted heifers. Mterils nd Methods Animls nd tretments The nutritionl nd superovultory tretments were described by Ykub et l. (1999). Briefly, seventy-six continentl crossbred heifers of pproximtely 5 kg live weight were offered grss silge supplemented with either brley concentrte t 3 kg per dy (n = 2) or d libitum (n = 19), or citrus beet pulp concentrte t 3 kg per dy (n = 1), or d libitum (n = 19) for 11 dys. Both concentrtes were formulted to contin 14% crude protein. The mjor ingredients of the brley concentrte consisted of % brley, 12% soyben mel, 5% molsses, nd citrus beet pulp concentrte consisted of 31.9% citrus pulp, 31.9% molssed beet pulp, 1% mize gluten nd 12% soyben mel. Grss silge contined 12.1% crude protein, with ph of 4.4 nd 1.2% dry mtter. Silge intke for heifers offered 3 kg concentrtes per dy ws d libitum, but for heifers offered d libitum concentrte silge intke ws limited to pproximtely 1 kg dry mtter per dy. The diets were chosen becuse the crbohydrte metbolism for strch (brley)-bsed nd sugr fibre (citrus beet pulp)-bsed energy sources would vry significntly in the rumen, resulting in different ftty cid production profiles. Synchroniztion of oestrus, superovultion nd embryo recovery Heifers were treted for 7 dys with n intrvginl progesterone-relesing device contining 1.9 g progesterone (CIDR-B, InterAg, NZ) fter 1 dys on the tretment diets. Heifers received totl of 25 mg NIH-FSH-P1 equivlent (pfsh, Folltropin-V, Vetrephrm Cnd, London, Ontrio) dministered over injections t 12 h intervls. The lst two injections were given t 12 nd 24 h fter CIDR withdrwl. Heifers received prostglndin F 2α nlogue (15 mg luprostiol, PG, Prosolvin; Intervet, Boxmeer) injection with the fifth injection of pfsh. Heifers were rtificilly inseminted twice, t 5 nd 72 h fter CIDR withdrwl, without reference to oestrus, using frozen thwed semen from single bull with proven fertility. Embryos were recovered from excised reproductive trcts ccording to the procedures reported by Goulding et l. (1994) on dy, 7 or fter first insemintion into PBS (Oxoid Ltd, Bsingstoke) contining 5% fetl clf serum (FCS, Gibco, Grnd Islnd, NY) nd trnsferred into CR-2 collection medium (114.7 mmol NCl l 1 1 mmol KCl l 1, 2.2 mmol NHCO 3, 5.5 mmol

5 Bovine embryo gene expression nd diet 71 hemi-clcium lctte l 1,.4 mmol pyruvte l 1, 5 mmol glutmine l 1, 1% BSA, nd.1% (w/v) gentmicin (Gibco- BRL, Githersburg, MD). Embryos were grded on the bsis of morphology using scle of 1 to 5 (Bolnd et l., 197), wshed twice with PBS contining.1% polyvinyllcohol (PVA), nd then trnsferred, s pools of two or three embryos, in miniml volume (< 1 µl) to the bottom of.5 ml tube. All embryo pools were lysed in 1 µl GITC lysis buffer (4 mol gunidinium thiocynte l 1,.1 mol Tris l 1 (ph 7.4), 1 mol bet-mercptoethnol l 1 ). Smples were quick frozen in liquid nitrogen nd trnsported on dry ice to the lbortory for nlysis, where they were stored t 7 C. Only embryos from morphologicl grdes 1 nd 2 were used, nd these were blnced cross tretments. Detils on embryo yields hve been reported by Ykub et l. (1999). Semi-quntittive RT PCR Reltive chnges in the bundnce of mrna trnscripts in embryo smples were determined using semi-quntittive (SQ) RT PCR ssy, using exogenous dded globin mrna s n internl stndrd (Temeles et l., 1994). In this ssy, the bundnce of given gene trnscript in n embryo smple is determined by expressing the bundnce of gene-specific mplifiction product s frction of the α-globin mplifiction product. This ssy cn be used to compre the reltive bundnce of one mrna mong different smples, but not the bsolute mount of one mrna compred with tht of nother (Temeles et l., 1994; Ho et l., 1994, 1995; Lthm et l., 1995). Since embryos isolted from heifers fed pulp- or brleybsed diets were nlysed in two different lbortories, using methods for mesuring the reltive bundnce of mrnas with minor differences, direct comprisons mong diet types cnnot be mde nd only generl trends cn be evluted. Anlysis of mrna expression in embryos collected from heifers fed the pulp-bsed diets RNA isoltion, RT PCR, nd quntifiction of mplifiction product on embryos from the pulp-bsed diets ws performed s described by De Sous et l. (199). At the time of thwing,.1 pg rbbit globin RNA (Gibco-BRL, Burlington) were dded per embryo equivlent, lysed in smple nd mixed by pipetting. For ech smple, 2 mm 2 mm squre of Hybond TM -messenger ffinity pper (map; Amershm Interntionl, Little Chlfont), wetted with.5 mol NCl l 1, ws soked in the lysed smple for 2 3 h t room temperture to llow for binding of poly(a) + RNA. Unbsorbed lystes were pipetted onto respective map squres supported on Whtmn 1 Filter pper (Whtmn Interntionl Ltd, Springfield Mill) on prfilm. map squres were then trnsferred individully into seprte.5 ml tubes nd wshed by gentle inversion with 2 µl of.5 mol NCl l 1,.1 mol Tris l 1 (3 ),.5 mol NCl l 1 (3 ), nd 7% ethnol (2 ). Poly(A) + RNA ws eluted from ech map squre in fresh tubes in 11 µl sterile H 2 O contining.5 µg oligo(dt) 12 1 (Gibco-BRL) by incubtion t 7 o C for 1 min, followed by cooling on ice for 5 min. RNA isolted by this procedure hs been shown to be free of ny contminting genomic DNA (De Sous et l., 199). Reverse trnscription rections took plce in finl volume of 2 µl buffer, consisting of 5 mmol Tris HCl l 1 (ph.3), 75 mmol KCl l 1, 3 mmol MgCl 2 l 1, 1 mmol dithiothreitol l 1, 75 µmol dntps l 1, nd 3 iu Superscript TM RNse H (Gibco-BRL) for 9 min t 43 C. Rections were terminted t 5 min t 95 o C nd then plced on ice. Reverse trnscribed cdna ws either used directly for PCR or stored t 2 o C. As negtive control for RNA isoltion nd reverse trnscription, blnk map squre ws crried long with the smples during the procedure. Oligonucleotide primers for the mplifiction of N/K- ATPse α1, Cu/Zn-SOD nd α-globin were designed using known sequence informtion (Tble 1). PCRs were performed in 25 µl of 1 GeneAmp PCR Buffer II (1 mmol Tris HCl l 1, ph.3, 5 mmol KCl l 1 ; Perkin Elmer, Vterstetten) contining 2 µmol dntps l 1, 2.5 iu AmpliTq Gold (Perkin Elmer), 1 µmol l 1 of ech of the pproprite 3 nd 5 gene specific primers, 1 mmol MgCl 2 l 1 (N/K- ATPse α1, nd Cu/Zn-SOD) or 1.25 mmol MgCl 2 l 1 (αglobin), nd volume of the reverse trnscription rection corresponding to.1.2 embryo equivlents. The bsic progrmme for mplifiction of gene trnscripts consisted of 1 min sok t 94 o C, followed by cycle progrmme of 1 min t 94 C, trnscript-specific nneling temperture (5, nd 55 C, for N/K-ATPse α1, Cu/Zn-SOD, nd α-globin, respectively) for 3 s, nd 1 min t 72 C. The number of Tble 1. Primers used for RT PCR nd the size of dignostic mplifiction products Gene primers Primer sequence Product size (bp) N/K-ATPse α ACCTGTTGGGCATCCGAGAGAC AGGGGAAGGCACAGAACCACCA-3 Cu/Zn-SOD 5 5 -AAGGCCGTGTGCGTGCTGAA CAGGTCTCCAACATGCCTCT-3 α-globin 5 5 -GCAGCCACGGTGGCGAGTAT GTGGGACAGGAGCTTGAAAT-3 N/K-ATPse α1 primers were bsed on regions of shred homology between the rt nd horse sequences (Shull et l., 19; Kno et l., 199) nd mplified product from bovine cdnatht ws 9.1% identicl to the corresponding cdnasequence in rts (Betts et l., 1997). Cu/Zn-SOD primers were bsed on the rt sequence (Ho nd Crpo, 197), nd hve been shown to mplify product of the correct size, with the nticipted dignostic restriction enzyme site, from bovine cdna (Hrvey et l., 1995). For α-globin, the 5 nd 3 primers correspond to bp nd , respectively, in the rbbit α-globin genomic clone (Cheng et l., 19).

6 72 C. Wrenzycki et l. cycles were 35 (N/K-ATPse α1), 3 (Cu/Zn-SOD), nd 31 (α-globin). RT PCR products were visulized by seprtion for 45 min t 1 V on 2% grose gels in 1 TAE buffer (4 mmol Tris cette l 1, 1 mmol EDTA l 1 ) contining.5 µg ml 1 ethidium bromide. RT PCR products were quntified by cpillry electrophoresis (De Sous et l., 199), using Beckmn P/ACE System 21 in conjunction with lserinduced fluorescence (LIF) detector operting with n rgon ion 4 nm lser nd 53 nm emission filter. Anlysis of mrna expression in embryos collected from heifers fed the brley-bsed diets Poly(A) + RNA ws isolted using Dynbeds mrna DIRECT Kit (Dynl, Oslo) ccording to the mnufcturer s instructions, with minor modifictions s described by Wrenzycki et l. (199b, 1999). Briefly, embryos were lysed by dding 15 µl lysis-binding buffer (1 mmol Tris HCl l 1, ph., 5 mmol LiCl l 1, 1 mmol EDTA l 1, 1% (w/v) LiDS (SDS), 5 mmol dithiothreitol l 1 ). Rbbit globin mrna (.1 pg; BRL, Githersburg, MD) per oocyte or embryo ws dded to ech tube s n internl stndrd. After vortexing for 1 s, brief centrifugtion t 12 g for 5 s nd incubtion t room temperture for 1 min, 1 µl prewshed Dynbeds Oligo (dt) 25 ws pipetted into the fluid. After 5 min incubtion t room temperture for binding poly(a) + RNAs to oligo (dt) Dynbeds, the beds were seprted employing Dynl MPC-E-1 mgnetic seprtor, wshed once using 1 µl wshing buffer 1 (1 mmol Tris HCl l 1, ph.,,15 mol LiCl l 1, 1 mmol EDTA l 1,,1% (w/v) LiDS) nd three times with 1 µl wshing buffer 2 (1 mmol Tris HCl, ph.,,15 mol LiCl l 1, 1 mmol EDTA l 1 ). Poly(A) + RNAs were then eluted from the beds by incubtion in 11 µl sterile wter t 5 C for 2 min, nd liquots were used immeditely for reverse trnscription. Poly(A) + RNA ws reverse trnscribed into cdna in totl volume of 2 µl, using 2.5 µmol rndom hexmers l 1 (Perkin-Elmer) to get the widest rry of cdnas. The rection mixture consisted of 1 RT buffer (5 mmol KCl l 1, 1 mmol Tris HCl l 1, ph.3, Perkin-Elmer, Vterstetten), 5 mmol MgCl 2 l 1, 1 mmol l 1 of ech dntp (Amershm, Brunswick), 2 iu RNse inhibitor (Perkin-Elmer) nd 5 iu MuLV reverse trnscriptse (Perkin-Elmer). The mixture ws overlid with minerl oil to prevent evportion. The RT rection ws crried out t 25 C for 1 min, 42 C for 1 h, followed by denturtion step t 99 C for 5 min nd flsh cooling on ice. PCR ws performed with volume of the RT rection corresponding to.1 or.2 embryo equivlents nd volume of the RT rection corresponding to 1 fg equivlent of globin RNA in finl volume of 5 µl consisting of 1 PCR buffer (2 mmol Tris HCl l 1, ph.4, 5 mmol KCl l 1, Gibco BRL, Eggenstein), 1.5 mmol MgCl 2 l 1, 2 µmol l 1 of ech dntp, 1 µmol l 1 of ech sequence specific primer (globin:.5 µmol l 1 ) using PTC-2 thermocycler (MJ Reserch, Wtertown, MA). A hot strt PCR ws performed to obtin specific mplifiction. During the hot strt, 1 iu Tq DNA polymerse (Gibco, Pisley) ws dded t 72 C. The sequences nd positions of the primers used, the frgment sizes nd the sequence references of the expected PCR products re summrized (Tble 1). The PCR progrm used n initil step t 99 C for 5 min nd 72 C for 2 min (hot strt) followed by 2 cycles (globin: 3 cycles) of 15 s, ech t 95 C for DNA denturtion, 15 s t different tempertures for nneling of primers, nd 15 s t 72 C for primer extension. The lst cycle ws followed by 5 min extension t 72 C nd cooling to 4 C. Genertion of the dignostic frgments ws strictly dependent on the presence of RNA in the RT rection, since omitting reverse trnscriptse from the RT did not generte ny mplified frgments (dt not shown). After ddition of 5 µl of 1 loding buffer (.25% (w/v) xylenecynol nd 25 mmol EDTA l 1 in 5% (v/v) glycerin), 1 µl of the RT PCR products were subjected to electrophoresis on 2% grose gel in 1 TBE buffer (9 mmol Tris l 1, 9 mmol borte l 1, 2 mmol EDTA l 1, ph.3) contining.2 µg ethidium bromide (EtBr) ml 1 with further ddition of in the sme concentrtion s in the running buffer. After running t V for 45 min, the frgments were visulized on n 312 nm UV-trnsillumintor. The imge of ech gel ws digitized using CCD cmer (Quntix, Photometrics, München) nd the IP Lb spectrum (IP Lb Gel, Signl Anlytics Corportion, Vienn, VA). The signl intensity of ech bnd ws quntitted by densitometric scnning using computer-ssisted imge nlysis system (IP Lb Gel). The reltive mount of the mrna of interest ws clculted by dividing the intensity of the bnd for ech developmentl stge by the intensity of the globin bnd for the corresponding stge. For ech mrna, experiments were repeted with t lest three seprte embryo btches. Mesurement of [ 14 C]pyruvte metbolism by individul embryos produced in vivo Rdiolbelled pyruvte ([2-14 C], 15.4 mci mmol 1 ; Dupont-NEN, Brussels) ws reconstituted in CR1-Hepes medium (Rosenkrns nd First, 1994) to stock concentrtion of.5 µci µl 1, nd sodium bicrbonte ([ 14 C],.1 mci mmol 1 ; Amershm Interntionl) ws used t the concentrtion of.25 µci µl 1. Lbelled regents were stored t 4 C. The rdiometric, hnging-drop method of Rieger et l. (1992) ws used to mesure pyruvte metbolism. Individul embryos from ech nutrition tretment were tken up in 2 µl of CR1-Hepes medium nd trnsferred to the cp of sterile 2.5 ml screw-cp mini-vil (Srstedt, Newton, NC). Immeditely, 2 µl CR1-Hepes, contining [2-14 C]pyruvte ws dded, resulting in totl culture volume of 4 µl, nd the cp ws crefully secured onto the 2.5 ml mini-vil. Ech mini-vil contined 1.75 ml of 25 mmol NHCO 3 l 1 tht hd been equilibrted for 2 h to humidified tmosphere of 5% CO 2 in ir t 39 C. Assy control mini-vils included shm preprtions (n = 5) tht contined ll regents but did not include n embryo (to ccount for nonspecific counts), nd bckground mini-vils contining 2 µl unlbelled CR1 medium. Embryos were cultured for 3 h (39 C). The cps were removed, nd the bicrbonte contined within the vil quickly poured into 2 ml

7 Bovine embryo gene expression nd diet 73 scintilltion vil contining.2 ml of.1 mol NOH l 1 nd cpped. The scintilltion vils were gently mixed nd held t 4 C overnight to fcilitte conversion of dissolved [ 14 C]O 2 nd bicrbonte into crbonte. Scintilltion fluid ws dded (15 ml), nd disintegrtions per minute (d.p.m.) determined by counting for 5 min using Pckrd Tri-Crb scintilltion counter progrmmed for utomtic-quench correction. Two microlitres of lbelled [ 14 C]pyruvte were mixed with 1.75 ml NHCO 3 nd.2 ml NOH, nd the rdioctivity quntified in the sme mnner, to determine totl substrte d.p.m. The mount of [ 14 C]pyruvte metbolized by individul embryos ws clculted s described by Tiffin et l. (1991) nd Rieger et l. (1992,b). The men d.p.m. for the shm preprtions ws subtrcted from the d.p.m. vlue of ech embryo, nd the difference divided by the totl [ 14 C]pyruvte d.p.m. nd multiplied by the totl quntity of substrte (lbelled nd unlbelled pyruvte) in 4 µl medium. This vlue ws then multiplied by the product recovery correction fctor of 1.4 (1/9.1) determined for the 3 h culture period (Rieger et l., 1992). This clcultion involved generting stndrd percentge recovery curve over the 3 h incubtion period to determine the plteu sturtion vlue of NH[ 14 C]O 3 t 3 h (dt not shown). Sttisticl nlysis Expression dt were nlysed using the SigmStt 2. (Jndel Scientific, Sn Rfel, CA) softwre pckge. Prmetric nlysis of differences in the mens between two or more popultions were tested using ANOVA with the min effects of dy of collection nd quntity of diet nd their interctions followed by multiple pirwise comprisons using Tukey s test. Pyruvte uptke dt were nlysed by the SAS softwre pckge, version. (SAS Institute Inc., 199) using the generlized liner models (GLM) procedure, with the min effects of dy of collection, quntity of diet nd type of diet nd their interctions. Differences of P.5 were considered to be significnt. As the reltive bundnces of specific mrnas in embryos from nimls fed either the pulp- or brley-bsed diets were determined in two different lbortories, no comprisons cn be mde between these groups. However, pyruvte use ws mesured from both embryo types in the sme lb, llowing comprisons mong ll groups. Correltions between the reltive bundnce of ech mrna of embryos recovered from heifers fed the different diets nd the corresponding pyruvte metbolism dt were clculted with the Person product moment correltion. Results Superovultory response (number of corpor lute t slughter) ws greter (P <.) when heifers were offered 3 kg per dy (15.5 ± 1.) thn when they were offered d libitum concentrtes (12.3 ± 1.4). The superovultory response for both citrus beet pulp (14.4 ± 1.5) nd brley (13.3 ± 1.5) ws not different (P >.5). Heifers offered 3 kg concentrtes per dy produced greter numbers of trnsferble embryos (4. ±.7) compred with heifers offered d libitum concentrtes (2. ±.; P<.5). Heifers offered citrus beet pulp produced greter numbers of trnsferble embryos (4. ±.7) thn heifers offered brley (2.9 ±.5; P<.5). Detils hve been reported by Ykub et l. (1999). Reltive bundnce of N/K-ATPse α1 nd Cu/Zn-SOD trnscripts in embryos For ll primer pirs, the number of PCR cycles ws kept within the liner rnge of mplifiction (De Sous et l., 199b; Wrenzycki et l., 1999). Globin RNA, dded before RNA isoltion s n internl stndrd, ws effectively mplified t 3 31 PCR cycles (Fig. 1), showing liner increse in the mount of PCR products s function of RNA input up to 1 fg (Fig. 1b). Trnscripts for N/K-ATPse α1, Cu/Zn-SOD, nd exogenously supplied α-globin were mplified from bovine embryos developed in vivo from heifers on 3 kg per dy or d libitum diets of citrus beet pulp or brley re shown (Fig. 2,b). In embryos derived from heifers fed the pulp-bsed diets, the reltive bundnces of both trnscripts were not ffected by either dy of collection or quntity of diet (Fig. 3). In embryos derived from heifers fed the brley-bsed diets, the reltive bundnces of the N/K-ATPse trnscripts were lso not chnged by these min effects, while the reltive bundnces of the Cu/Zn-SOD trnscripts were ffected by dy of collection (significntly lower in dy thn in dy 7 embryos) nd by the quntity of diet (Fig. 3b). No interctive effects were observed for dy of collection nd quntity of diets in the reltive bundnce of both trnscripts. Reltive intensity (rbitrry units) () Cycle number 1 (b) [globin RNA] RNA input (fg) Fig. 1. Vlidtion of the semi-quntittive RT PCR ssy in terms of the number of cycles using n mount of 2 fg globin RNA () or different mounts of globin RNA using 3 PCR cycles (b).

8 74 C. Wrenzycki et l. () Dy 3 kg d lib Dy 3 kg d lib Negtive controls N/K-ATPse (d) Dy 3 kg d lib Dy 7 3 kg d lib Dy 3 kg d lib Negtive controls 7 N/K-ATPse (b) Cu/Zn-SOD (e) Cu/Zn-SOD (c) α-globin (f) α-globin Fig. 2. Detection of genetrnscripts in bovine morule nd blstocysts developed in vivo from heifers on 3 kg per dy or d libitum dily intkes of citrus beet pulp ( c) or brley (d f). Representtive ethidium bromide-stined gels showing mplifiction of 33 bp product representing N/K-ATPse α1 trnscript (,d), 24 bp product representing the Cu/Zn-SOD trnscript (b,e), nd 257 bp product representing the exogenously supplied α-globin trnscript (c,f), mplified from dy (lnes 1 nd 2), dy 7 (d f, lnes 3 nd 4) nd dy ( c, lnes 3 nd 4; d f, lnes 5 nd ) from heifers on 3 kg per dy ( c, lnes 1 nd 3; d f, lnes 1, 3 nd 5) or d libitum ( c, lnes 2 nd 4; d f, lnes 2, 4 nd ) diets. As negtive controls, trnscript-specific PCR ws performed on liquots of mock reverse trnscriptions on blnk map squres run through the RNA isoltion procedure ( c: lne 5) nd wter ( c: lne ), while RNA (d f: lne 7) or reverse trnscriptse (d f: lne ) ws omitted during the RT rection. d lib: d libitum. [ 14 C]pyruvte metbolism by individul bovine embryos The effects of dy of collection (Fig. 4), quntity of diets (Fig. 4b), nd type of diets (Fig. 4c) on the utiliztion of [2-14 C]pyruvte by bovine embryos produced in vivo is shown. Pyruvte metbolism ws ffected by dy of collection nd showed significnt increse in dy embryos compred with dy 7 nd dy embryos. Diet quntity did not ffect pyruvte utiliztion, wheres pyruvte metbolism ws significntly incresed in the brley diet group compred with the pulp diet group. No interctive effects were observed for dy of collection, quntity of diets nd type of diets in pyruvte metbolism. The reltive bundnces of the Cu/Zn-SOD trnscript nd pyruvte metbolism showed negtive significnt correltion (r =.4, P.5) in embryos collected from heifers fed brley diets. Discussion The present study is the first to investigte the effects of quntity nd type of diet on mrna expression nd energy metbolism in preimplnttion bovine embryos. Altertions in the reltive mounts of specific gene trnscripts in bovine oocytes produced in vitro nd embryos during preimplnttion development hve been determined using sensitive semi-quntittive RT PCR ssy (Lequrre et l., 1997; De Sous et l., 199; Wrenzycki et l., 1999). Furthermore, this technique hs been used to determine the effects of different culture conditions on the mount of mrna expression of vrious developmentlly importnt genes (Wrenzycki et l., 199b, 1999). Vritions in the detected mounts of different mrnas my be ttributed to the mrna structure or the intrcellulr environment ffecting the stbility nd turnover rte of the mrna (Ross,

9 Bovine embryo gene expression nd diet 75 Reltive mrna bundnce () N/K-ATPse Cu/Zn-SOD Dy of collection (b) (c) (d) 3 kg d lib 199) s well s the methodology used to detect rre trnscripts. Polydenyltion my increse the presence of messenger fter reverse trnscription with n oligo-dt primer by incresing the probbility tht such primer will nnel to the trnscript (Moore et l., 199; De Sous et l., 3 kg d lib N/K-ATPse Cu/Zn-SOD Quntity of pulp-bsed diet 7 N/K-ATPse Cu/Zn-SOD Dy of collection b 3 kg d lib N/K-ATPse Cu/Zn-SOD Quntity of brley-bsed diet 3 kg b 7 d lib Fig. 3. Vritions in the reltive bundnce of mrna in bovine morule nd blstocysts developed in heifers on diets of citrus beet pulp (,b) or brley (c,d) ffected by dy of collection (,c) or quntity of diets (b,d). The men reltive mrna bundnce (± SEM) ws determined for N/K-ATPse α1, nd Cu/Zn-SOD from embryos in three independent RNA isoltion RT PCR experiments. Significnt differences re denoted by different superscripts (P.5). d lib: d libitum. b Metbolism of [ 14 C]pyruvte (pmol per embryo per 3 h) () (b) (c) 199b). However, the increse of most gene trnscripts results from synthesis de novo fter the mjor ctivtion of the bovine embryonic genome t the 1-cell stge (Telford et l., 199). Despite nlysis by independent lbortories with slight modifictions in methodology in the present study, the differences tend to be similr within the experimentl subgroups. During preimplnttion development, the formtion of the blstocyst is medited by fluid trnsfer cross the outer blstomeres through the ctivity of N/K-ATPse. N/K- ATPse is composed of two subunits, of which the α (ctlytic) subunit represents the physiologicl role of the enzyme (Jorgensen, 19), while the β (nonctlytic, glycolysted) subunit is thought to fcilitte the processing nd insertion of the α subunit into the plsm membrne (Geering, 1991). The functionl expression of the α subunit is regulted fter trnscription during preimplnttion 7 b Dy of collection 3 kg d lib Quntity of diet pulp b brley Type of diet Fig. 4. Pyruvte metbolism by individul embryos produced in vivo from heifers on diets of citrus beet pulp nd brley ffected by () dy of collection, (b) quntity of diets or (c) type of diet.

10 7 C. Wrenzycki et l. development (Kidder, 1992). As no differences in the reltive bundnce of the α1 trnscripts were found in embryos from ll tretment groups, this trnscript seems to possess n enormous plsticity to vrious environments, or cts rther independent from environmentl fctors. Free oxygen rdicls (FOR) hve been implicted in embryonic rrest nd cell deth (Johnson nd Nsr-Esfhni, 1994). FOR production is physiologicl process tht occurs within cells when electrons lek to oxygen during electron trnsfer rections. This hs pronounced effects on DNA, RNA nd protein synthesis, nd pertubtes cell membrnes, increses intrcellulr ph nd disturbs mitochondril function. While there re numerous non-enzymtic ntioxidnt gents, specific ntioxidnt enzymes re ble to detoxify O 2, H 2 O 2, nd orgnic peroxides (Johnson nd Nsr-Esfhni, 1994), tht is, Cu/Zn-SOD ctlyses the dismuttion rection, removing O 2 species. The significnt increse of Cu/Zn-SOD trnscripts recovered from heifers fed brley-bsed diets, either d libitum or restricted, my be cused by oxidtive stress s result of d libitum feeding of the donor nimls. In ddition, it hs been proposed tht het shock proteins, such s HSP 7, re induced by FOR (Donti et l., 199). The trnscription of this gene is induced by suboptiml culture conditions in mouse embryos (Christins et l., 1995) nd bovine preimplnttion embryos (Wrenzycki et l., 199b, 1999). The differences between embryos collected on different developmentl dys my be ttributed to vrying cell numbers. Evidence indictes tht the rte of energy substrte utiliztion by preimplnttion embryos is n pproprite predictive prmeter for embryo vibility (Rieger, 194; Grdner nd Leese, 19, 19; Rondeu et l., 1995). Rdiolbelled energy substrtes hve been used extensively in studies of bovine embryo metbolism (Rieger, 194, 1992; Rieger nd Guy, 19; Jved nd Wright, 1991; Tiffin et l., 1991; Rieger et l., 1992, b). Furthermore, peroxidtive dmge of mitochondril lipids results in shift in the cells from oxidtive use of pyruvte in the Krebs cycle to metbolize succinte (Johnson nd Nsr-Esfhni, 1994). The effects of nutrition on preimplnttion embryo development my reflect the generl energy blnce, while other effects my be ttributed to those of specific nutrients, such s vitmins or minerls. When defining nutritionl effects, the response to nutrition t one stge of the reproductive cycle my hve profound responses t lter stge. Effects on the preovultory development of the oocyte will crry over into the periovultory period (Downing et l., 1995; Thoms et l., 1997) nd these nutritionl effects could continue to ffect pre- nd post-fertiliztion events within the oviduct (Rbiee et l., 1997). The uterine phse of development is ffected by nutritionl fctors either indirectly, by effects on progesterone secretion, or directly t the uterus. In sheep, effects on circulting progesterone concentrtions my be n importnt mechnism by which nutrition nd metbolic stte lter embryo survivl (Prr et l., 197, 1993). Furthermore, in superovulted ewes infused with glucose, decrese in ovultion rte nd embryo qulity ws found (Ykub et l., 1997). The correltion dt demonstrte tht feeding the brleybsed diet d libitum to the donor heifers led to decresed pyruvte utiliztion nd n increse in the reltive bundnce of the Cu/Zn-SOD trnscript in dy embryos. The correltion indictes tht the incresed mounts of Cu/Zn-SOD mrna re due to cellulr stress in these embryos. This hypothesis is supported by the fct tht, in embryos derived from heifers fed brley-bsed diets, pyruvte uptke is significntly incresed compred with tht in embryos from heifers fed pulp-bsed diets. Reduced development of bovine embryos grown in vitro under serumfree conditions is lso ssocited with incresed pyruvte uptke (Eckert et l., 1999). Furthermore, significntly smller number of trnsferble embryos ws recovered from brley-fed compred with pulp-fed donor nimls (Ykub et l., 1999) indicting tht there is negtive ssocition between the brley diet nd erly embryonic development. In ddition, oxidtive stress cused by d libitum feeding of the donor nimls my lso led to significntly decresed number of trnsferble embryos compred with donor nimls fed restricted diets (Ykub et l., 1999). In conclusion, for the first time, differences in gene expression nd metbolic substrte metbolism in in vivo derived embryos collected from heifers fed different quntities nd types of diet were determined. These differences observed in embryos collected on the sme dy of development cn be ttributed to the composition nd quntity of diet fed to the donor niml. The type of diet my lso lter oocyte development nd mturtion nd embryonic development by ltertion of the microenvironment. As result of these metbolic chnges, trnscription nd trnsltion of key developmentl genes my be ltered with effects on erly development. The present findings chrcterize embryos produced in vivo t the moleculr level, nd indicte tht these moleculr mrkers cn be used to differentite between popultions of embryos produced under different nutritionl regimens, nd to determine conditions conducive to the production of good qulity embryos. References Armstrong DT (1993) Recent dvnces in superovultion in cttle Theriogenology Betts DH, McPhee DJ, Kidder GM nd Wtson AJ (1997) Oubin sensitivity nd expression of N/K-ATPse α- nd β-subunit isoform genes during bovine erly development Moleculr Reproduction nd Development Blnchrd T, Ferguson J, Love L, Tked T, Henderson B, Hsler J nd Chlup W (199) Effect of dietry crude-protein type on fertiliztion nd embryo qulity in diry cttle Americn Journl of Veterinry Reserch Bolnd MP, Crosby TF nd Gordon I (197) Morphologicl normlity of cttle embryos following superovultion using PMSG Theriogenology Bolnd MP, Goulding D nd Roche JF (1991) Alterntive gondotropins for superovultion in cttle Theriogenology Bungrtz L nd Niemnn H (1994) Assessment of the presence of dominnt follicle nd selection of diry cows suitble for superovultion by single ultrsound exmintion Journl of Reproduction nd Fertility Cheng J-F, Rid L nd Hrdison RC (19) Isoltion nd nucleotide sequence of rbbit globin gene cluster ψζ-α1-αψ. Absence of pir of α-globin genes evolving in concert Journl of Biologicl Chemistry Christins E, CmpionE, Thompson EM nd Renrd J-P (1995) Expression of the HSP 7.1 gene, lndmrk in erly zygotic ctivity in the mouse embryo is restricted to the first burst of trnscription Development

11 Bovine embryo gene expression nd diet 77 De Sous PA, Westhusin ME nd Wtson AJ (199) Anlysis of vrition in reltive mrna bundnce for specific gene trnscripts in single bovine oocytes nd erly embryos Moleculr Reproduction nd Development De Sous PA, Wtson AJ nd Schultz RM (199b) Trnsient expression of trnsltion initition fctor is conservtively ssocited with embryonic gene ctivtion in murine nd bovine embryos Biology of Reproduction Donti YRA, Slosmn DO nd Poll BS (199) Oxidtive injury nd the het shock response Biochemicl Phrmcology Downing JA nd Scrmuzzi RJ (1991) Nutrient effects on ovultion rte, ovrin function nd the secretion of gondotrophin nd metbolic hormones in sheep Journl of Reproduction nd Fertility Supplement Downing JA, Joss J nd Scrmuzzi RJ (1995) Ovultion rte nd the concentrtions of gondotrophins nd metbolic hormones in ewes infused with glucose during the lte lutel phse of the oestrus cycle Journl of Endocrinology Eckert J, Pugh PA, Thompson JG, Niemnn H nd Tervit R (199) Exogenous protein ffects developmentl competence nd metbolic ctivity of bovine preimplnttion embryos in vitro. Reproduction, Fertility nd Development Grdner DK (199) Chnges in requirements nd utiliztion of nutrients during mmmlin preimplnttion embryo development nd their significnce in embryo culture Theriogenology Grdner DK nd Leese HJ (19) Non-invsive mesurement of nutrient uptke by single cultured preimplnttion mouse embryos Humn Reproduction Grdner DK nd Leese HJ (19) The role of glucose nd pyruvte trnsport in regulting nutrient utiliztion by preimplnttion mouse embryos Development Geering K (1991) The functionl role of the bet subunit in the mturtion nd intrcellulr trnsport of N/K-ATPse FEBS Letters Goulding D, Willims DH, Roche JF nd Bolnd MP (1994) Effect of exogenous progesterone on superovultory response in heifers inseminted with fresh or frozen semen Journl of Reproduction nd Fertility Goulding D, Willims DH, Roche JF nd Bolnd MP (199) Fctors ffecting superovultion in heifers treted with PMSG Theriogenology Hrvey MB, Arcelln-Pnlilio MY, Zhng X, Schultz GA nd Wtson AJ (1995) Expression of genes encoding ntioxidnt enzymes in preimplnttion mouse nd cow embryos nd primry bovine oviduct cultures employed for embryo coculture Biology of Reproduction Ho Y, Doherty AS nd Schultz RM (1994) Mouse preimplnttion embryo development in vitro: effect of sodium concentrtion in culture medi on RNA synthesis nd ccumultion nd gene expression Moleculr Reproduction nd Development Ho Y, Wigglesworth K, Eppig JJ nd Schultz RM (1995) Preimplnttion development of mouse embryos in KSOM: ugmenttion by mino cids nd nlysis of gene expression Moleculr Reproduction nd Development Ho YS nd Crpo JD (197) Sequences of cdna nd deduced mino cid of rt copper-zinc-contining superoxide dismutse Journl of Biologicl Chemistry Jved MH nd Wright RW, Jr (1991) Determintion of pentose phosphte nd Embden Meyerhof pthwy ctivities in bovine embryos Theriogenology Johnson MH nd Nsr-Esfhni MH (1994) Rdicl solutions nd culturl problems: could free oxygen rdicls be responsible for the impired development of preimplnttion mmmlin embryos in vitro? BioEssys Jorgensen PL (19) Structure, function nd regultion of the N/K-ATPse in the kidney Kidney Interntionl Kno I, Ngi F, Stoh K, Ushiym K, Nko T nd Kno K (199) Structure of the α1 subunit of horse N,K-ATPse gene FEBS Letters Kelly P, Duffy P, Roche JF nd Bolnd MP (1997) Superovultion in cttle: effect of FSH type nd method of dministrtion of folliculr growth, ovultory response nd endocrine pttern Animl Reproduction Science Kidder GM (1992) The genetic progrm for preimplnttion development Developmentl Genetics Kidder GM (1993) Genes involved in clevge, compction nd blstocyst formtion. In Genes in Mmmlin Reproduction pp Ed. RBL Gwtkin. Wiley Liss, New York Koerber S, Sntos AN, Tetens F, Küchenhoff A nd Fischer B (199) Incresed expression of NADH Ubiquinone oxidoreductse chin 2 (ND2) in preimplnttion rbbit embryos cultured with 2% oxygen concentrtion Moleculr Reproduction nd Development Lthm KE, Scott CD, Doherty AS nd Schultz RM (1995) Igf2r nd Igf2 gene expression in ndrogenetic, gynogenetic, nd prthenogenetic preimplnttion mouse embryos: bsence of regultion by genomic imprinting Genes nd Development Lequrre AS, Grisrt B, Moreu B, Schuurbiers N, Mssip A nd Dessy F (1997) Glucose metbolism during bovine preimplnttion development: nlysis of gene expression in single oocytes nd embryos Moleculr Reproduction nd Development Mntovni R, Enright WJ, Kene MG, Roche JF nd Bolnd MP (1993) Effect of nutrition nd dose of follicle stimulting hormone (FSH) on superovultory response in beef heifers Proceedings of 9th Scientific Meeting of Assocition Europeene de Trnsfert Embyonnire, Lyon p. 234 Moloney AP, Almildi AA, Drennn MJ nd Cffrey PJ (1994) Rumen nd blood vribles in steers fed grss silge nd rolled brley or sugr cne mollsses-bsed supplements Animl Feeding Science Technology Moore GD, Aybe T, Kopf GS nd Schultz RM (199) Temporl pttern of gene expression of G1-S cyclins nd cdks during the first nd second mitotic cell cycles in mouse embryos Moleculr Reproduction nd Development Morit Y, Tsutsumi O, Ok Y nd Tketni Y (1994) Glucose trnsporter GLUT 1 mrna expression in the ontogeny of glucose incorportion in mouse preimplnttion embryos Biochemicl nd Biophysicl Reserch Communiction Murphy MG, Enright WJ, Crowe MA, McConnell K, Spicer LJ, Bolnd MP nd Roche JF (1991) Effect of dietry intke on pttern of growth of dominnt follicles during the oestrus cycle in beef heifers Journl of Reproduction nd Fertility Noln R, O Clllghn D, Duby RT, Lonergn P nd Bolnd MP (199) The influence of short-term nutrient chnges on follicle growth nd embryo production following superovultion in beef heifers Theriogenology Overström EW (199) In vitro ssessment of embryo vibility Theriogenology Prr RA, Dvis IF, Firclough RJ nd Moss MA (197) Overfeeding during erly pregnncy reduces peripherl progesterone concentrtion nd pregnncy in sheep Journl of Reproduction nd Fertility Prr RA, Dvis IF, Miles MA nd Squires TJ (1993) Feed intke ffects metbolic clernce rte of progesterone in sheep Reserch in Veterinry Science Rbiee AR, Len IJ, Gooden JM, Miller BG nd Scrmuzzi RJ (1997) An evlution of trnsovrin uptke of metbolites using rterio venous difference methods in diry cttle Animl Reproduction Science Rieger D (194) The mesurement of metbolic ctivity s n pproch to evluting vibility nd dignosing sex in erly embryos Theriogenology Rieger D (1992) Reltionships between energy metbolism nd development of erly mmmlin embryos Theriogenology Rieger D nd Guy P (19) Mesurement of the metbolism of energy substrtes in individul bovine blstocysts Journl of Reproduction nd Fertility Rieger D, Loskutoff NM nd Betteridge KJ (1992) Developmentlly relted chnges in the uptke nd metbolism of glucose, glutmine nd pyruvte by cttle embryos produced in vitro. Reproduction, Fertility nd Development Rieger D, Loskutoff NM nd Betteridge KJ (1992b) Developmentlly relted chnges in the metbolism of glucose nd glutmine by cttle embryos produced nd co-cultured in vitro. Journl of Reproduction nd Fertility Rondeu M, Guy P, Goff AK nd Cooke GM (1995) Assessment of embryo potentil by visul nd metbolic evlution Theriogenology Rosenkrns CF, Jr nd First NL (1994) Effect of free mino cids nd vitmins on clevge nd developmentl rte of bovine zygotes in vitro. Journl of Animl Science Ross J (199) Control of messenger RNA stbility in higher eukyotes Trends in Genetics SAS (199) SAS User s Guide: Sttistics SAS Institute, Cry, NC Shim C, Kwon HB nd Kim K (199) Differentil expression of lminin chinspecific mrna trnscripts during mouse preimplnttion embryo development Moleculr Reproduction nd Development

12 7 C. Wrenzycki et l. Shull GE, Greeb J nd Lingrel JB (19) Moleculr cloning of 3 distinct forms of the N +,K + -ATPse lph-subunit from rt brin Biochemistry Slon BK, Rowlinson P nd Armstrong DG (19) Milk production in erly lcttion diry cows given grss silge d libitum: influence of concentrte energy source, crude protein content nd level of concentrte llownce Animl Production Tkhshi Y nd First NL (1992) In vitro development of bovine one-cell embryos: influence of glucose, lctte, pyruvte, mino cids nd vitmins Theriogenology Telford NA, Wtson AJ nd Schultz GA (199) Trnsition from mternl to embryonic control in erly mmmlin development: comprison of severl species Moleculr Reproduction nd Development Temeles GL, Rm PT, Rothstein JL nd Schultz RM (1994) Expression ptterns of novel genes during mouse preimplnttion embryogenesis Moleculr Reproduction nd Development Thoms MG, Bo B nd Willims GL (1997) Dietry fts vrying in their ftty cid composition differentilly influence folliculr growth in cows fed isoenergetic diets Journl of Animl Science Tiffin GJ, Rieger D, Betteridge KJ, Ydv BR nd King WA (1991) Glucose nd glutmine metbolism in prettchment cttle embryos in reltion to sex nd stge of development Journl of Reproduction nd Fertility Thompson JG, Prtridge RJ, Houghton FD, Cox CI nd Leese HJ (199) Oxygen uptke nd crbohydrte metbolism by in vitro derived bovine embryos Journl of Reproduction nd Fertility Wtson AJ (1992) The cell biology of blstocyst development Moleculr Reproduction nd Development Wrenzycki C, Herrmnn D, Crnwth JW nd Niemnn H (199) Expression of the gp junction gene connexin43 (Cx43) in preimplnttion bovine embryos derived in vitro or in vivo. Journl of Reproduction nd Fertility Wrenzycki C, Herrmnn D, Crnwth JW nd Niemnn H (199) RNA expression of developmentlly importnt genes in preimplnttion bovine embryos produced in TCM supplemented with bovine serum lbumin (BSA) Journl of Reproduction nd Fertility Wrenzycki C, Herrmnn D, Lemme E, Korswe K, Crnwth JW nd Niemnn H (199b) Determintion of the reltive bundnce of vrious developmentlly importnt gene trnscripts in bovine embryos generted in vitro or in vivo using semi-quntittive RT PCR ssy Stellite Workshop Proceedings, Embryo Development In Vitro Current Chllenges nd Future Concepts, Boston pp Wrenzycki C, Herrmnn D, Crnwth JW nd Niemnn H (1999) Altertions in the reltive bundnce of gene trnscripts in preimplnttion bovine embryos cultured in medium supplemented with either serum or PVA Moleculr Reproduction nd Development 53 1 Ykub H, Willims SA, O Cllghn D nd Bolnd MP (1997) Effect of dietry intke nd glucose infusion on ovultion rte nd embryo qulity in superovulted ewes Journl of Reproduction nd Fertility Abstrct Series 19 Abstrct 151 Ykub H, O Cllghn D nd Bolnd MP (1999) Effect of type nd quntity of concentrte on superovultion nd embryo yield in beef heifers Theriogenology