Effects of Dietary Vitamin C on the Physiological Responses and Disease Resistance to Ph Stress and Aeromonas Hydrophila
|
|
- Florence Price
- 6 years ago
- Views:
Transcription
1 Turkish Journl of Fisheries nd Aqutic Sciences 16: (216) ISSN DOI: / v16_2_22 RESEARCH PAPER Effects of Dietry Vitmin C on the Physiologicl Responses nd Disese Resistnce to Ph Stress nd Aeromons Hydrophil Infection of Meglorm Amlycephl Bo Liu 1,2, Jinjun Wn 1, Xinping Ge 1,2,, Jun Xie 1,2,, Qunln Zhou 2, Linghong Mio 2, Mingchun Ren 2, Lingkun Pn 2 1 Ministry of Agriculture, Chinese Acdemy of Fishery Sciences, Freshwter Fisheries Reserch Center, Key Open Lortory for Genetic Breeding of Aqutic Animls nd Aquculture Biology, Wuxi Chin. 2 Nnjing Agriculture University, Wuxi Fishery College, Wuxi Chin. Corresponding Author: Tel.: ; E-mil: gexp@ffrc.cn, xiej@ffrc.cn Received 28 Jnury 216 Accepted 1 April 216 Astrct We evluted the effect of vitmin C (Vit C) supplementtion on the resistnce of Meglorm mlycephl to Aeromons hydrophi1 infection under ph stress. Fish were rndomly divided into six groups: control group (fed with sl diet) nd five tretment groups (fed with sl diet supplemented with 33.4, 65.8, 133.7, nd 51.5 mg/kg Vit C, respectively). After 9 dys, fish were exposed to comined stressors, first ph 9.5 followed y A. hydrophil infection. The results showed tht mg/kg vit C improved complement 4 (C4), nti-superoxide nion free rdicl (ASAFER) nd het shock protein (HSP) 7 compred with the control group; nd mg/kg vit C enhnced complement 3 (C3), HSP6, HSP7 nd HSP9 compred to the control group efore stress. After ph stress nd A. hydrophil infection, hemogloin, ASAFER nd HSP6, HSP7, HSP9 in the groups fed with nd mg/kg vit C were still significntly higher, while serum cortisol in the group fed with mg/kg vit C ws lower compred to the control group 15 dys fter ph stress. The cumultive mortlity of the control group ws higher thn tht of the five tretment groups t 12, 24 h fter A. hydrophil infection. The results of this study suggest tht mg/kg vit C in diet could hve potentil to stimulte immune response, nd enhnce resistnce ginst high ph stress nd A. hydrophil infection of Wuchng rem. Keywords: Aeromons hydrophil; ph stress; Vitmin C; Physiologicl response; Meglorm mlycephl. Introduction Wuchng rem (Meglorm mlycephl) is principl species in Chinese freshwter polyculture systems. Its production in Chin ws pproximtely.72 million tons in 212 (Ministry of Agriculture of the People s Repulic of Chin, 213). However, s one of the most widely cultured freshwter fish in Chin, Wuchng rem hs fced n incresing disese outrek cused y pthogenic cteri. This hs een resulted in considerle economic loss in Chin (He et l. 26).The min reson could e due to dverse environmentl stress fctors (including ph), which my ffect the metolism of qutic nimls (Wendelr 1997), osmotic cpcity (Pn et l. 27), gill function nd morphology (Wilkie et l.1994) nd immune system (Yin et l.1995; Rotlnt et l.1997; Ndong et l 27 ; Le Moullc et l.,2).this my render fish vulnerle to pthogenic cteril infection nd led to the outreks of infectious diseses followed y economic losses in fish frming industry (Ojolick et l.1995; Lvill-Pitogo et l.1998; Li nd Chen 28). Pulished y Centrl Fisheries Reserch Institute (CFRI) Trzon, Turkey in coopertion with Jpn Interntionl Coopertion Agency (JICA), Jpn Aeromons spp. is uiquitous cteri, ntive to qutic environments nd consists of two mjor groups, the psychrophilic nd mesophilic groups (Monfort et l.199; Topić Popovic et l. 2). In prticulr, Aeromons hydrophil hs een reported s n importnt pthogen for humns nd for lower vertertes, including mphiins, reptiles nd fish (Jnd nd Aott 1998). A. hydrophil is responsile for hemorrhgic septicemi nd cuses high levels of mortlity nd significnt economic loss in fish culture (Kozinsk et l. 22; Vivs et l. 24; Ogr et l.1998; Wng nd Silv1999). Vitmin C (vit C), lso known s L-scoric cid, is n essentil micronutrient for norml growth nd physiologicl function of fish. Previous studies demonstrted tht vit C hve een proved to ply key roles in enhncing helth nd growth performnce of fish (Ai et l. 26; Eo nd Lee 28; Tewry nd Ptr 28), improving reproduction (Emt et l. 2; Lee nd Drowski 24), modulting stress (Özkn et l. 212; Ming et l. 212; Brros l. 214), elevting immune cpcity (Sohn et l. 2; Ortuno et l. 23; Ai et l. 26; Nyk et l. 27; Eo nd Lee, 28; Tewry nd Ptr 28), nd
2 422 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) enhncing disese resistnce (Sohn et l.2; Brros l. 214). In our previous study, feed supplemented with mg/kg mg/kg vit C improved the growth performnce nd non-specific immunity of M. mlycephl (Wn et l., 213). At present, the effect of vit C on the physiologicl responses under the comined stress of high ph level nd A. hydrophil infection of M. mlycephl hs een hrdly found in reserch reports. Our ojective ws to further evlute the effect of dietry vit C supplementtion on the non-specific immune responses to ph stress nd cteril infection in M. mlycephl. Firstly fish were fed diets with or without vit C, nd secondly fish were exposed to high ph stress condition. Then fish were chllenged with A. hydrophil nd mesured hemtologicl prmeters [white lood cell (WBC), red lood cell (RBC), nd hemogloin (HGB)], serum physiologicl prmeters [cortisol, complement 3 (C3), nd complement 4 (C4)) nd heptic oxidiztion indices (superoxide dismutse ctivity (SOD), ntisuperoxide nion free rdicl (ASAFR), mlondildehyde content (MDA)], nd three heptic het shock proteins (HSP6, 7, 9) mrna expressions. Our results provide insight in to the physiologicl responses nd moleculr mechnisms underlying the protective effect of vit C in M. mlycephl under ph stress nd A. hydrophil infection. Mterils nd Methods Fish, Vitmin C, nd Diets The use of the experimentl fish ws ccording to the recommendtions of the Guidelines for the Cre nd Use of Lortory Animls of Chin. Helthy juvenile M. mlycephl (verge weight 6.4±.5 g) were provided y freshwter fisheries reserch institute of Jingsu province, Chin. A totl of 45 fish were stocked in 18 round fierglss tnks (φ82 7mm, N= 25 fish/tnk). Prior to the experiment, Wuchng rem were cclimted with the commercil diet (Wuxi Tongwei Feed Co., Ltd., Chin) in the tnks for 22 dys. After tht, fish were rndomly divided into six groups (N=3 tnks / group): one control nd five tretment groups. Triplicte groups of M. mlycephl (3 tnks, 25 individuls per tnk) were fed with the sl diet (See Tle 1) nd the sl diet supplied with 33.4, 65.8, 133.7, nd 51.5 mg/kg vit C, respectively. The sl prcticl diet ws formulted to contin out 32.12% crude protein nd 6.68% lipid. Six diets were formulted to contin., 3., 6., 12., 24. nd 48. mg scoric cid per kg diet, respectively. Coted-scoric cid (CAA) (95% scoric cid equivlent, Roche, Swiss) ws used s the vit C source. However, the nlyzed scoric cid levels were.2, 33.4, 65.8, 133.7, nd 51.5 mg kg -1 diets. Vrious feedstuffs were seprtely pulverized nd screened through 6 mesh size sieve; nd first mixed clcium dihydrogen phosphte, soy lecithin, choline chloride, ethoxyquin, minerl nd vitmin premix (vitmin C free) nd then evenly mixed with vit C; nd t lst evenly mixed ulk feed ingredients. The diets were prepred t the reserch fcilities of Fishery Mchinery nd Instrument Reserch Institute with 1. mm grnulr wet pellet. The moisture of feed ws out 1% nd ws kept t - 2 until used. Fish Husndry Fish were cultured in tnk with utomtic thermo-regulted recirculting system. The tnks were supplied with erted nd recycled wter t rte of 2 L min -1. During the experimentl period, fish were hnd fed three times dy (8:-9:, 11:- 12:, nd 15:-16:) t feeding rte of 2.%- 4.% ody weight. The tnks were supplied with continul oxygen. During the experiment, wter temperture ws mesured twice dy (t 8: nd 16:), nd other wter qulity prmeters were checked once week. The men wter qulity indices were: wter temperture rnged 26-28, dissolved oxygen (DO) > 6 mg L -1, NH 3 -N <.5 mg L -1, ph The mount of feed ws djusted every two weeks to ccount for incresing ody weight. After 9 dys, fish from ech tnk were counted nd weighed. Chllenge Experiment The Ph Chllenge Experiment At the end of the rering experiment nd ccording to previously descried method (Li nd Chen 28), fter first smpling (efore stress, d), the rest fish from six groups (3 tnks/group) were rered for ph stress (high ph level: 9.5) for 15 dys in the fierglss tnks (φ82 7mm) with running wter nd the flow rte ws 2 L/min. The men wter qulity indices were: wter temperture rnged 27±1, DO > 6 mg/l, nd NH 3 -N <.5 mg/l. The wter ph level ws djusted y dding 4N NOH twice dy (8:, 16:). A. Hydrophil Chllenge Experiment After 15d ph stress (mentioned on the ove), fter second smpling (15 d ph stress) 18 fish from ech group (3 tnks/group) were chllenged with A. hydrophil. The seven dy LC 5 ws determined y intrperitonel injection of 48 fish with grded concentrtions of A. hydrophil (1 5,1 6,1 7,1 8 nd 1 9 CFU/ml) t 24, nd the result showed tht the LC 5 on dy 7 ws out CFU/ml. According to our previous study s method (Liu et l. 212), A. hydrophil ws ctivted twice nd diluted with sterile norml sline to finl concentrtion of 1 1 7
3 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) 423 Tle 1. Formultion nd composition of experimentl diet Ingredients (%) Proximte composition (%) Csein (vitmin C free) 27.5 Crude protein Geltin 6.5 Crude lipid 6.68 Clcium dihydrogen phosphte 2.75 Nitrogen-free extrct c Soyen oil 6. Lysine 2.26 Soy lecithin 1. Methionine.79 Choline chloride (5%).15 Vitmin premix(vitmin C free).5 Minerl premix.5 Dextrin 1. α-strch 25. Microcrystlline cellulose 9.5 Croxyl-methy cellulos 11. Ethoxyquin Totl.5 1. Vitmin premix (IU or per kg premix): Vitmin A, 9 IU; Vitmin D, 25 IU; Vitmin E,45 mg; Vitmin K3, 22mg; Vitmin B1,32 mg; Vitmin B2,19 mg; Vitmin B6,5 mg; Vitmin B12,116 mg; Pntothente,1 mg; Folic cid,65 mg; Choline,6 mg; Biotin,5 mg; Inositol,15 mg; Nicin cid,25 mg. Minerl premix (per kg premix): CuSO 4 5H 2O,2.5g; FeSO 4 7H 2O,28g; ZnSO 4 7H 2O,22g; MnSO 4 4H 2O,9g; N 2SeO 3,.45g; KI,.26g; CoC l2 6H 2O,.1g. c Nitrogen-free extrct,%=1%-(moisture + CP + EE + CF+ Ash)%, nd the others re mesured ccording to Feed Industry Stndrd of Chin. CFU/mL. The cteril suspension (1. ml, per 1 ody weight) ws injected into the dominl cvity, nd then mortlity ws checked t h, 12h nd 24h fter chllenge. Serum nd Liver Smple Collection nd Mesurement Serum nd liver smples were collected from 9 individuls in ech group (3 fish/tnk) prior to stress ( d) nd 15 d fter high ph stress, nd 1d fter the chllenge, respectively. At ech smpling point, fish were rpidly netted nd plced into the dose of 15 mg/l of MS-222. The lood from three fish rndomly smpled from ech tnk ws collected y cudl venipuncture using 1 ml medicl syringes. After collection, 2 µl whole lood ws used for nlyzing lood WBC, RBC nd HGB. The remining whole lood ws llowed to clot t 4 for 1-2 h. Following centrifugtion (3 g, 1 min, 4 ), the serum ws removed nd frozen t -2 until used. The dominl cvity of fish ws immeditely cut open fter lood collection. Aout.1 g liver ws frozen in liquid nitrogen nd stored t -8 for determintion of gene expression. Another piece of liver ws stored t -2 for the nlysis. Mesurement of Blood nd Liver Smples Blood WBC, RBC nd HGB Mesurement Blood WBC, RBC nd HGB were directly mesured using n Auto Hemtology Anlyzer (BC- 53Vet, Mindry, P.R. Chin) with test kit from Shenzhen Mindry Medicl Interntionl Co. Ltd. (P.R. Chin) using previously descried method (Cui et l. 213). Serum Cortisol, C3 nd C4 Mesurement The levels of cortisol were mesured y the utomtic chemiluminescence immunossy nlyzer MAGLUMI 1 (Shenzhen, Chin) using ssy kits purchsed from Shenzhen New Industries Biomedicl Engineering Co., Ltd, Chin, following previously descried method (Cui et l.213; Zhou et l. 213). Serum C3 nd C4 ctivities were mesured using the immunoturidimetric method nd the kits were purchsed from Zhejing Yilikng Biotech Co., Ltd (P.R. Chin), following previously descried method (Cui et l.213). Heptic SOD, ASAFR nd Mlondildehyde Mesurement Heptic smples were homogenized in ice-cold phosphte uffer (1:1 dilution) (phosphte uffer sline:.64 M, ph 7.4). The homogente ws then centrifuged for 1 min (4, 4 g) nd liquots of the superntnt were used to quntify heptic SOD, ASAFR nd MDA. Heptic SOD ctivity, ASAFR ctivity nd MDA content were mesured using the xnthine oxidse method (Grnelli et l. 1995), xnthine oxidse method (Kong et l. 24) nd rituric cid colorimetry (Drpe et l.1993), respectively. We mesured the heptic protein content using the Folin method with ovine serum lumin s stndrd. These kits for the detection were purchsed from Nnjing Jincheng Bioengineering Institute of Chin. Rel-time PCR Mesurement of Heptic HSP6, HSP7 nd HSP9 We used M. mlycephl cdna sequences in GenBnk to design the primers for HSP6, HSP7,
4 424 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) HSP9 nd et-ctin (Tle 2). All primers were synthesized y Shnghi Biocolor, BioScience & Technology Compny, Chin. The totl RNA ws extrcted from liver tissue of 5-1 mg using Trizol regent (Dlin Tkr Co. Ltd., Chin). Generlly, the purified RNA hd OD 26 /OD 28 rtio of RNA smples were treted with RQ1 RNse-Free DNse (Dlin Tkr Co. Limited, Chin) to void genomic DNA mplifiction. We generted cdna from 5 ng DNse-treted RNA using ExScript TM RT-PCR Kit (Dlin Tkr Co. Ltd., Chin). The reverse trnscription PCR rection solution consisted of 5 ng RNA, 2 μl 5 Buffer,.5 μl dt-ap Primer (5 mm),.25 μl ExScript TM RTse (2 U μl -1 ), nd DEPC H 2 O, up to finl volume of 1 μl. The rection conditions were s follows: 42 for 4 min, 9 for 2 min, nd 4 therefter. We used rel-time quntittive PCR to determine mrna levels with n SYBR Green one fluorescence kit, following previously descried method (Liu et l., 212). Rel-time quntittive PCR ws performed in Mini Opticon Rel-Time Detector (Bio-Rd, USA). The fluorescent quntittive PCR rection solution consisted of 12.5 μl SYBR premix Ex Tq TM (2 ),.5 μl PCR Forwrd Primer (1 μm),.5 μl PCR Reverse Primer (1 μm), 2. μl RT rection mix (cdna solution), 9.5 μl dh 2 O. The rection conditions were s follows: 95 for 1s, followed y 45 cycles consisting of 95 for 5s, 62 for 15s, 72 for 1s, plte red, nd finl step t 72 for 3 min. After the progrm finished, the C t vlues of the trget genes (three HSPs) nd chosen reference gene (etctin) were otined from ech smple. We mesured the stndrd eqution nd correltion coefficient y constructing stndrd curve using seril dilution of cdna; HSP6: Y=-.31x+1.65, R 2 =.991; HSP7: Y=-.361x+13.38, R 2 =.995; HSP9: Y=-.314x+1.29, R 2 =.996; Bet-ctin: Y=-.34x+9.817, R 2 =.99; Y is the logrithm of the strting templte to se 1, x is the C t vlues. The reltive expression level of gene could e clculted y doule-stndrd curves method (Tng nd Ji 28). Dt Sttistics nd Anlysis We used SPSS (version 11.5) softwre followed y Turkey s- test nd Independent-Smples t-tests to determine the differences. Diverse little letters ove histogrm rs show the significnt differences (P<.5) mong different dosge groups of ech smpling point in Turkey s- test. Significnt differences (P<.5) etween vlues otined efore nd fter stress or infection re mrked y sterisks ove histogrm rs in Independent-Smples t-tests. All the results were expressed s mens ± stndrd error of mens ( X ± SEM). Results Effect of vit C on Survivl of M. Amlycephl The cumultive mortlity ws clculted for 24 h (Figure 1). At the conclusion of the experiment (24 h post chllenge), the totl ccumulted percentges of mortlities were 1% in the control, nd 61.11%, 61.11%, 44.44%, 38.34% nd 55.56% in the group of 33.4, 65.8, 133.7, nd 51.5 mg/kg vit C, respectively. Higher cumultive mortlity ws oserved in the control group compred to the five tretment groups t 12 nd 24 h fter A. hydrophil infection (P<.5, Figure 1). Reltively, smll numer of deth occurred in the groups fed with nd mg/kg vit C 24 h fter A. hydrophil infection compred to the other groups. Effects of vit C on lood WBC, RBC nd HGB in M. Amlycephl The effects of vit C on lood WBC, RBC nd HGB in fish re shown in Figure 2. Before stress, the lood WBC count ws significntly reduced in the groups of mg/kg vit C compred with the control group (P<.5, Figure 2A). After ph stress, significntly higher lood WBC count ws mesured in the groups of 65.8, 133.7, nd mg/kg vit C thn pre-stress level (P<.5, Figure 2A). After infection, lood WBC count ws only significntly reduced in the group of 51.5 mg/kg vit C compred with pre-stress level (P<.5, Figure 2A). Before stress, there ws no significnt effect on the lood RBC count nd HGB content etween the five tretment groups nd the control group (P>.5, Figure 2B, 2C). After ph stress, the groups of 65.8, 133.7, mg/kg vit C hd significntly higher Tle 2. Primer sequences for RT-PCR nlysis of HSP nd β-ctin genes Genes Primer sequences (5' 3') Product size (nt) Gene ccession Bet- ctin (F) TCTGCTATGTGGCTCTTGACTTCG (R) CCTCTGGGCACCTGAACCTCT 132 AY HSP6 (F) 5 -TGCTGTCTACTGCTGAAGCCGTTGT-3 (R) 5 -CCATCACTCAGTTTCGGCAGGTTT KC HSP7 (F) 5 -CGACGCCAACGGAATCCTAAAT-3 (R) 5 -CTTTGCTCAGTCTGCCCTTGT-3 92 EU HSP9 (F) 5 -TGCGGGACAACTCCACCAT-3 (R) 5 -TCCAATGAGAACCCAGAGGAAAGC-3 98 KC521466
5 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) Mortlity (%) Control 33.4 mg/kg Vit C 65.8 mg/kg Vit C mg/kg Vit C mg/kg Vit C 51.5 mg/kg Vit C 2 h 12h 24h Infection time Figure 1. Effects of vit C on disese resistnce gin A.hydrophil infection of M.mlycephlin. Note: Dt re expressed s mens ± SEM (n =3). Diverse little letters show significnt differences (P<.5) in different dosge groups of ech smpling point in Turkey s- test. RBC count nd HGB content compred with the prestress level (P<.5, Figure 2B, 2C). The groups of mg/kg vit C hd significntly higher RBC count compred with the control group 15d post-stress (P<.5, Figure 2B, 2C). In ddition, the groups of 133.7, mg/kg vit C hd significntly higher HGB content compred with the control group 15d post-stress (P<.5, Figure 2B, 2C). After infection, significntly lower RBC count ws mesured in the 65.8 mg/kg vit C group compred with its preinfection level (P<.5, Figure 2B), while HGB content ws significntly lower in the groups of 33.4, nd 51.5 mg/kg vit C compred with preinfection level (P<.5, Figure 2C). Effects of Vit C on Serum Cortisol, C3 nd C4 in M. Amlycephl The effects of vit C on the serum cortisol, C3 nd C4 concentrtions in fish re shown in Figure 3. Before stress, there ws no significnt effect on the serum cortisol concentrtion in the five tretment groups compred to the control group (P>.5, Figure 3A). After ph stress, serum cortisol concentrtion incresed nd it ws significntly higher in the control nd the group of 33.4 mg/kg vit C 15 d post ph stress thn pre-stress level (P<.5, Figure 3A). In ddition, serum cortisol concentrtions were significntly lower in the tretment group of mg/kg vit C 15d poststress compred with the control group (P<.5, Figure 3A). After infection, serum cortisol concentrtion ws significntly improved in the group of 33.4 mg/kg vit C compred with its pre-stress level (P<.5, Figure 3A). Before stress, serum C3 concentrtion ws significntly improved in the group of nd 51.5 mg/kg vit C compred with the control group (P<.5, Figure 3B). After ph stress, serum C3 concentrtion ws significntly lower thn pre-stress level in the control nd ll the tretment groups 15d post-stress (P<.5, Figure 3B). Serum C3 concentrtion ws significntly improved in the group of 33.4 nd mg/kg vit C compred to the control group 15d post-stress (P<.5, Figure 3B). After infection, there ws no significnt effect on serum C3 concentrtion in the five tretment groups compred to the control group (P<.5, Figure 3B). Before stress, serum C4 concentrtion ws significntly improved in the group of mg/kg vit C compred with the control group (P<.5, Figure 3C). After ph stress, serum C4 concentrtion ws significntly lower thn pre-stress level in the control nd ll tretment groups post-stress (P<.5, Figure 3C). After infection, serum C4 concentrtion ws lso significntly lower thn pre-infection level in the tretment groups of 33.4, 65.8 nd133.7 mg/kg vit C 1d fter infection (P<.5, Figure 3C). In ddition, the serum C4 concentrtion ws significntly higher in the group of 51.5 mg/kg vit C thn tht of the group of 33.4, 65.8 nd mg/kg vit C 1d fter infection (P<.5, Figure 3C). Effects of Vit C on Serum SOD, ASAFR nd MDA in M. Amlycephl We exmined the effect of vit C on the heptic nti-oxidiztion cpcity in fish, nd the results re shown in Figure 4. Before stress, SOD ctivity ws significntly elevted in the group of mg/kg vit C compred with the control group. After ph stress, SOD ctivity ws significntly lower thn pre-stress levels in the control group nd ll tretment groups 15d post-stress (P<.5, Figure 4A). Furthermore, SOD ctivity in the group of mg/kg vit C ws significntly higher thn the control group (P<.5, Figure 4A). After infection, there ws no significnt effect on the serum SOD ctivity in the five tretment groups compred to the control group (P>.5, Figure 4A). However, SOD ctivity ws significntly lower thn pre-infection levels in ll tretment groups 1d fter infection (P<.5, Figure 4A). Before stress, the groups of 65.8, mg/kg
6 426 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) Quntity of white lood cell (1^9 /L Control 33.4 mg/kg Vit C 65.8 mg/kg Vit C mg/kg Vit C mg/kg Vit C 51.5 mg/kg Vit C A Before stress fter ph stress fter infection 2.5 Quntity of red lood cell (1^9 /L B Before stress fter ph stress fter infection 1 Content of hemogloin (g /L) Before stress fter ph stress fter infection C Figure 2 Effects of vrious levels of vit C on the WBC (A), RBC (B) nd HGB (C) of M.mlycephl fter ph stress nd A. hydrophil infection. Note: Dt re expressed s men ± SEM (n = 9). Letters indicte significnt differences (P<.5) in different dosge groups of ech smpling point in Turkey s- test. Asterisks indicte significnt differences (P<.5) etween vlues otined pre-stress nd post-stress or post-infection in t-test. shows ll the fish died 24 h fter infection. vit C hd significntly higher ASAFR concentrtions compred to the control group (P<.5, Figure 4B). After ph stress, ASAFR concentrtion ws significntly lower thn pre-stress levels in the control group nd the tretment groups of 33.4, 65.8, 133.7, mg/kg vit C (P<.5, Figure 4B). Furthermore, ll the tretment groups except the group of 33.4 mg/kg vit C hd lso significntly higher ASAFR concentrtions compred to the control group 15 d fter ph stress (P<.5, Figure 4B). After infection, ASAFR concentrtion ws significntly lower thn pre-infection levels in ll tretment groups 1d fter infection (P<.5, Figure 4B). Before stress, there ws no significnt difference in MDA content etween the tretment group nd control group (P>.5, Figure 4C). After ph stress, there ws no significnt difference in MDA content yet (P>.5, Figure 4C).After infection, MDA content ws significntly higher thn pre-infection level in the group of 33.4 mg/kg vit C 1d fter infection (P<.5, Figure 4C). In ddition, MDA content ws significntly lower in the group of 65.8 mg/kg vit C thn tht of the group of 33.4 mg/kg vit C (P<.5, Figure 4C). Effects of Vit C on the Reltive Level of Heptic HSP6, HSP7 nd HSP9 Mrn in M. Amlycephl We lso exmined the effect of vit C on heptic HSP6, HSP7 nd HSP9 mrna expressions in fish (Figure 5). Before stress, the expression level of HSP6 mrna ws significntly higher in the tretment group of mg/kg vit C thn tht of the
7 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) Control 33.4 mg/kg Vit C 65.8 mg/kg Vit C mg/kg Vit C mg/kg Vit C 51.5 mg/kg Vit C Cortisol content (ng/ml) A 1 Before stress fter ph stress fter infection.6 Complement level C3 (g/l c c c c.1 B Before stress fter ph stress fter infection.2 Complement level C4 (g/l) C Before stress fter ph stress fter infection Figure 3. Effects of vrious levels of vit C on the serum on serum cortisol (A), C3 (B) nd C4 (C) of M.mlycephl fter ph stress nd A. hydrophil infection. Note: Dt re expressed s men ± SEM (n = 9). Legends re the sme s Figure 2. shows ll the fish died 24 h fter infection. control group (P<.5, Figure 5A). After ph stress, HSP6 mrna expression ws significntly higher thn pre-stress levels in the control group nd the group of 33.4, 65.8 mg/kg vit C 15d fter ph stress (P<.5, Figure 5A). Furthermore, heptic HSP6 mrna expression ws significntly enhnced in the group of 65.8, 133.7, nd 51.5 mg/kg vit C compred to the control group (P<.5, Figure 5A). After infection, HSP6 mrna expression ws significntly higher thn pre-infection level in the group of 33.4, 65.8 nd 51.5 mg/kg vit C 1d fter infection (P<.5, Figure 5A). In ddition, the group of mg/kg vit C improved the HSP6 mrna expression compred with the others group of 33.4, 65.8, 133.7nd 51.5 mg/kg vit C 1d fter infection (P<.5, Figure 5A). Before stress, the expression level of HSP7 mrna ws significntly higher in the tretment group of 133.7, nd 51.5 mg/kg vit C thn tht of the control group (P<.5, Figure 5B). After ph stress, HSP7 mrna expression ws significntly higher thn pre-stress level in the control group nd the group of 33.4,133.7 nd 51.5 mg/kg vit C 1d fter ph stress (P<.5, Figure 5A). Furthermore, heptic HSP7 mrna expression ws significntly higher in the group of 133.7, nd 51.5 mg/kg vit C compred to the control group (P<.5, Figure 5B). After infection, HSP7 mrna expression ws significntly higher thn pre-infection stress level in the tretment groups 1d fter infection (P<.5, Figure 5B). In ddition, HSP7 mrna expression ws significntly higher in the group of mg/kg vit C thn tht of the others group of 33.4, 65.8, 133.7nd 51.5 mg/kg vit C (P<.5, Figure 5B).
8 428 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) 3 Control 33.4 mg/kg Vit C 65.8 mg/kg Vit C mg/kg Vit C Superoxide dismutse ctivity (U/mg protein) mg/kg Vit C 51.5 mg/kg Vit C 5 A Before stress fter ph stress fter infection 7 Content of nti-superoxide nion (U/mg protein) B 5 Before stress fter ph stress fter infection 4 35 Mlondildehyde content (nmol/mg protein) C Before stress fter ph stress fter infection Figure 4. Effects of vrious levels of vit C on the serum SOD (A), ASAFR (B) nd MDA (C) levels of M.mlycephl fter ph stress nd A. hydrophil infection. Note: Dt re expressed s men ± SEM (n = 9). Legends re the sme s Figure 2 shows ll the fish died 24 h fter infection. Before stress, the expression level of HSP9 mrna ws significntly higher in the tretment group of mg/kg vit C thn tht of the control group (P<.5, Figure 5C). After ph stress, HSP9 mrna expression ws significntly higher thn prestress level in the control group nd the group of 33.4, nd 51.5 mg/kg vit C (P<.5, Figure 5A). Furthermore, heptic HSP9 mrna expression ws significntly higher in the entire tretment groups compred with the control group 15d fter ph stress (P<.5, Figure 5B). After infection, HSP9 mrna expression ws only significntly higher thn preinfection level in the tretment group of mg/kg vit C 1d fter infection (P<.5, Figure 5C). Discussion In quculture qutic nimls re consistently ffected y vrious stress fctors such s mient ph nd temperture, stocking density, nd so on. Besides, low or high ph hs een shown to ffect the growth of qutic niml nd reduce the resistnce ginst pthogen such s Virio lginolyticus (Li nd Chen, 28), Enterococcus (Cheng nd Chen 1998), Lctococcus grviee (Cheng et l. 23). Dietry vit C reduced disese susceptiility in Mrigl or Asin ctfish (Sohn et l., 22; Kumri nd Shoo, 25). Erlier studies in our lortory lso suggested tht resistnce ginst A. hydrophil infection could e enhnced in M. mlycephl y the supplementtion of dietry vit C or Chinese her extrcts (Ming et l., 212). Herein, we found similr phenomenon in the sme species, eing more susceptile to A. hydrophil infection when the fish were rered t high ph (9.5), nd the totl ccumulted percentges of mortlities of M. mlycephl in the control ws significntly higher
9 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) 429 Reltive level of HSP6 mrna (ritrry units) Control 33.4 mg/kg Vit C 65.8 mg/kg Vit C mg/kg Vit C mg/kg Vit C 51.5 mg/kg Vit C A Before stress fter ph stress fter infection B Reltive level of HSP 7 mrna (ritrry units) d c cd cd Before stress fter ph stress fter infection C Reltive level of HSP 9 mrna (ritrry units) Before stress fter ph stress fter infection Figure 5. Effects of vrious levels of vit C on the reltive expression levels of liver HSP6 (A), HSP7 (B) nd HSP9 (C) mrna of M.mlycephl fter ph stress nd A. hydrophil infection. Note: Dt re expressed s men ± SEM (n = 9). Legends re the sme s Figure 2 shows ll the fish died 24 h fter infection. thn the vit C tretment groups t 12, 24 h fter A. hydrophil infection. Furthermore, ll fish died in the control group when fish were exposed to the comined stresses of 15d ph 9.5 nd 1d A. hydrophil infection. It indicted tht the supplementtion of 33.4, 65.8, 133.7, nd 51.5 mg/kg vit C in the diets for M. mlycephl hd certin effect on resistnce to pthogenic cteri. These fcts lso indicted tht chnges in environmentl prmeters (high ph) might trigger disese outreks y reducing the immune defense mechnisms of the host. With respect to the immune prmeters, ph chnge might led to immunodepression. For exmple, Cheng nd chen (2) nd Cheng et l. (23) reported tht totl hemocyte count nd phenoloxidse ctivity of M. rosenergii decresed when prwns were trnsferred to ph 5. nd ph 9.5. The relted immune prmeters such s totl hemocyte count, phenoloxidse ctivity, respirtory urst, superoxide dismutse ctivity, glutthione peroxidse ctivity, nd lysozyme ctivity of Litopeneus vnnmei significntly decresed when shrimps were trnsferred to sewter t ph 6.8 (Lin et l. 21). In the present study, Wuchng rems were exposed to the comined stresses of 15d ph 9.5 nd 1d A. hydrophil infection nd it showed tht decresing trends of serum C3, C4 in the group of 33.4, 65.8, mg/kg vit C, nd heptic SOD, ASAFR in in ll group nd incresing trends of serum cortisol, heptic HSPs gene expression. Furthermore, WBC, RBC, HGB, C3, C4, SOD, ASAFR in some groups were lso lower thn the pre-stress level, while serum cortisol, MDA, nd heptic HSPs gene expression were higher thn the pre-stress level in
10 43 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) some groups. Therefore, the immunity of M. mlycephl decresed when fish ws sujected to the comined stresses of high ph nd cteril infection. However, the lood WBC count ws significntly reduced in the groups of mg/kg vit C compred with the control group efore stress, nd the group of mg/kg vit C hd significntly improved lood RBC count nd HGB content compred to the control group fter ph stress. Similrly, Lin et l. (21) demonstrted tht 2-6 mg/ L Spirulin pltensi extrct reduced totl hemocyte count of L.vnnmei under low ph stress. Yeh et l. (21) lso reported tht 6 mg/l Grcilri tenuistipitt extrct could reduce the totl hemocyte count, hyline cells, grnulr cells under comined stresses of Virio lginolyticus nd temperture chnge compred to those of control shrimp. These evidences suggested tht vit C s n immunostimulnt could impct on the hemtologicl prmeters such s lood RBC, WBC nd HGB nd enhnce immune cpcity. Cortisol is secreted in response to stressors to moilize energy stores nd is generlly thought to hve negtive effect on the immune system, therey incresing disese susceptiility (Trip et l.1987; Steinhgen 1989). Erlier studies in our lortory found tht serum concentrtions of cortisol significntly incresed under high temperture nd pthogenic infection in Wuchng rem (Liu et l. 21; Liu et l. 212) nd high dose of 7 mg/kg vit C reduced the serum cortisol concentrtions (Ming et l. 212). In the present study, serum cortisol concentrtions were significntly reduced in the tretment groups of mg/kg vit C fter ph stress compred with the control group. Some similr results were lso oserved in gilthed serem (Sprus urt L.) under crowding stress (Montero et l.1999) nd multiple stress (Ortuno et l. 23). Serum lterntive complement ctivity cn e severely depressed y vrious stress conditions in fish (Ortuno et l. 22; Boshr et l. 26), nd my e good indictor of fish immunocompetence in stressed nimls (Tort L et l., 1996). In conformity with these reports, this study showed tht serum C3 nd C4 concentrtions in ll the groups t 15d post-stress were significntly lower thn pre-stress level. In ddition, serum C4 concentrtion in the tretment groups of 33.4, 65.8 nd mg/kg vit C t 1d fter infection ws lso significntly lower thn preinfection level. However there ws no effect on serum C3 concentrtion fter infection compred to prestress level. This indicted tht nlysis of C3 might not necessrily e susceptiility of cteri for fish. Therefore further studies will e needed to ddress the effect of vit C on the specific pthwys nd complement components under comined stresses of high ph nd A. hydrophil infection of M. mlycephl. In ddition, the serum complement concentrtion of fish hs een reported to e significntly enhnced y orl dministrtion of vit C-supplemented diets (Chen et l. 23; Ortuno et l. 23). Similrly, in the present study, nd 51.5 mg/kg vit C in the diet elevted the serum C3, nd mg/kg vit C in the diet elevted the serum C4 concentrtion efore stress. The supplementtion of 33.4 nd 133.7mg/kg vit C in the diet lso improved the serum C3 concentrtion compred to the control group fter ph stress. The serum C4 concentrtion ws significntly higher in the group of 51.5 mg/kg vit C thn tht of 33.4, 65.8, mg/kg vit C. These evidences indicted tht dietry vit C cn increse the C3 nd C4 concentrtions following high ph stress nd cteril infection. These findings indicte tht the role of vit C in stress nd disese resistnce in fish. Some stress fctors nd pthogenic infection is often ssocited with n increse in free rdicl content, which my led to n increse in lipid peroxidtion content nd lipid peroxidtion injury. Decreses in respirtory ursts nd SOD ctivity were oserved in white shrimp exposed to ph 6.5, nd ph 1.1 (Li nd Chen, 28). Similrly, SOD ctivity ws significntly decresed under the comined stresses of ph stress nd Fenneropeneus chinensis (H et l. 29). In rt, vit C enhnced plsm glutthione, superoxide dismutse, nd glutthione peroxidse levels, reduced MDA content, nd prevented dietic rts from oxidtive stress (Aksoy et l. 25). In fish, dietry supplementtion with vit C significntly enhnced SOD nd ctlse ctivities, nd reduced MDA content (Ming et l. 212; Wn et l. 213). Consistent with these studies, mg/kg vit C significntly improved the SOD ctivity, nd the dose of mg/kg vit C lso significntly improved ASAFR concentrtions compred to the control group efore stress. Furthermore, 65.8, mg/kg vit C significntly enhnced the SOD ctivity nd ASAFR concentrtion fter ph stress. In ddition, MDA content ws significntly lower in the group of 65.8 mg/kg vit C thn tht of 33.4 mg/kg vit C. Tken ll together, our results suggest tht the dose of mg/kg vit C reduces the potentil for oxidtive dmge following ph stress nd A. hydrophil infection in M. mlycephl. In ddition, ethoxyquin is llowed in fish feed s ft stilizer nd prevent the oxidtion of lipid nd vit C cn lso improve the ntioxidnt cpcity of fish. The reltionship etween vit C nd ethoxyquin for fish feed remins to e further investigted. Het shock proteins (HSPs) re conserved proteins induced y het nd numerous noxious stimuli, including high temperture, viruses, nd pthologic stresses (Lindquist nd Grig, 1998; Bsu et l.22). HSP6, HSP7 or HSP9 hs numer of functions, including the mintennce of cellulr homeostsis nd the protection of n individul following stress or pthogenic stress in qutic nimls (Dene et l. 24; Cellur et l. 26;
11 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) 431 Rungrssmee et l. 21; Go et l. 28; Qu et l. 211). In fish, Ming et l. (212) found tht dietry vit C enhnced the expression levels of HSC7 nd HSP7 mrna efore or fter high temperture stress. In rt, Hn et l. (211) reported tht dietry vit C lso enhnced the expression levels of HSP7 mrna. In the present study, the expression levels of HSP6, HSP7 nd HSp9 mrna in the tretment group of mg/kg vit C were significntly higher thn those in the control group efore stress. After stress, the group of 133.7, 251.5nd 51.5 mg/kg vit C still improved the expression levels of HSP6, HSP7 nd HSp9 mrna compred to the control group. Additionlly, HSP6 nd HSP7 mrna expressions were significntly higher in the group of mg/kg vit C thn tht of the group of 33.4 mg/kg vit C fter 1d infection. Thus, our results suggest tht the dose of mg/kg vit C could elevte the HSPs gene expression nd enhnce tolernce to stressors y inducing the cellulr stress response following ph stress nd A. hydrophil infection in M. mlycephl. Conclusions Supplementtion of diet with mg/kg vit C ws ssocited with less mortlity compred to the control fish when Wuchng rems were trnsferred to ph 9.5wter, nd then chllenged with A. hydrophil. Supplementtion of diet with mg/kg vit C incresed lood RBC, HGB, C3, C4, nd heptic SOD, ASAFR nd HSP6, 7, 9 gene expressions. Furthermore, we noted decrese in serum cortisol content in fish fed with 251.5mg/kg dietry vit C. All in ll, our results suggest tht the dose of mg/kg vit C in the diet cn increse non-specific immune nd nti-oxidtion cpcities, nd enhnce resistnce ginst high ph stress nd pthogenic cteril infection in Wuchng rem. Acknowledgements This work ws supported y the Modern Agriculture Industril Technology System specil project-the Ntionl Technology System for Conventionl Freshwter Fish Industries (CARS-46), y the Specil Fund for Agro-scientific Reserch in the Pulic Interest (2132) nd y the Ntionl Nonprofit Institute Reserch Grnt of Freshwter Fisheries Reserch Center, Chinese Acdemy of Fishery Sciences (214A8XK2) nd the Three New Projects of Fishery in Jingsu province (D213-5). References Ai, Q.H., Mi, K.S., Tn, B.P., Xu, W., Zhng, W.B.,M, H.M., Liufu, Z.G. 26. Effects of dietry vitmin C on survivl, growth, nd immunity of lrge yellow croker, Pseudoscien croce. Aquculture, 61: doi:1.116/j. quculture Aksoy, N., Vurl, H., Suncu, T., Arsln, O., Aksoy, S. 25. Beneficil effects of vitmins C nd E ginst oxidtive stress in dietic rts. Nutrition Reserch, 25: doi:1.116/j.nutres Brros., M.M., Flcon, D.R., de Oliveir, Orsi. R., Pezzto, L.E., Fernndes, Jr A.C., Guimrães, I.G., Fernndes Jr, A., Pdovni, G.R., Srtori, M.M.P Nonspecific immune prmeters nd physiologicl response of Nile tilpi fed β-glucn nd vitmin C for different periods nd sumitted to stress nd cteril chllenge. Fish Shellfish Immun, 39: doi: 1.116/j.fsi Bsu, N., Todghm, A.E., Ackermn, P.A., Bieu, M.R., Nkno, K., Schulte, P.M., Iwm, G.K. 22. Het shock protein genes nd their functionl significnce in fish. Gene, 295: doi:1.116/s (2)687-x Boshr, H., Li, J., Sunyer, J.O. 26. Recent dvnces on the complement system of teleost fish. Fish Shellfish Immun, 2: doi:1.116/j.fsi Cellur, C., Touin, M., Prrinello, N., Roch, P.26. HSP7 gene expression in Mytilus glloprovincilis hemocytes is triggered y moderte het shock nd Virio nguillrum, ut not y V. splendidus or Micrococcus lysodeikticus. Dev Comp Immun, 3: doi:1.116/j.dci Chen, R.G., Lochmnn, R., Goodwin, A., Prveen, K., Drowski, K., Lee, K.J. 23. Alterntive complement ctivity nd resistnce to het stress in golden shiners (Notemigonus crysoleucs) re incresed y dietry vitmin C levels in excess of requirement for prevention of deficiency signs. J Nutr, 133: Cheng, W., Chen, J.C.2. Effects of ph, temperture nd slinity on immune prmeters of the freshwter prwn Mcrorchium rosenergii. Fish Shellfish Immun, 1: doi:1.16/fsim Cheng, W., Chen, J.C., Enterococcus-like infections in Mcrorchium rosenergii re excerted y high ph nd temperture ut reduced y low slinity. Dis Aqut Org, 34: doi: /do3413 Cheng, W., Chen, S.M., Wng, F.I., Hsu, P.I., Liu, C.H., Chen, J.C. 23. Effects of temperture, ph, slinity nd mmoni on the phgocytic ctivity nd clernce efficiency of gint freshwter prwn Mcrorchium rosenergii to Lctococcus grviee. Aquculture, 219: doi:1.116/s (3)17-6 Cui, S.L., Liu, B., Xu, P., Xie, J., Wn, J.J., Zhou, M Effects of emodin on growth, hemotologicl prmeters nd HSP7 mrna expression of Wuchng rem (Meglorm mlycephl) t two tempertures. Act Hydroilogyic Sinic., 37: Dene, E.E., Li, J., Woo, N.Y., 24.Modulted het shock protein expression during pthogenic Virio lginolyticus stress of se rem. Dis Aqut Orgn, 62: doi: /do6225 Drpe,H.H., Squires, E.J., Mhmoodi, H., Wu, J., Agrwl, S., Hdley, M A comprtive evlution of thiorituric cid methods for the determintion of mlondildehyde in iologicl mterils. Free Rdicl Bio Med, 15: doi: 1.116/ (93)935-S Emt, A.C., Borlongn, I.G., Dmso, J.P. 2. Dietry vitmin C nd E supplementtion nd reproduction of milkfish Chnos chnos Forsskl. Aquc Res,
12 432 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) 31: doi: 1.116/ (93)935-S Eo, J., Lee, K.L.28. Effect of dietry scoric cid on growth nd non-specific immune responses of tiger puffer, Tkifugu ruripes. Fish Shellfish Immun, 25: doi: 1.116/j.fsi Go. Q., Zho, J., Song, L., Qiu, L., Yu, Y., Zhng, H., Ni, D. 28. Moleculr cloning, chrcteriztion nd expression of het shock protein 9 gene in the hemocytes of y scllop Argopecten irrdins. Fish Shellfish Immun., 24: doi: 1.116/j.fsi Grnelli, K., Bjorck, L., Appelqvist, L.A The vrition of superoxide dismutse (SOD) nd xnthine oxidse (XO) ctivities in milk using n improved method to quntitte SOD ctivity. J Sci Food Agric, 67: H, C.X., Liu, P., He,Y.Y., Li, J., Li, X. 29. Effects of high ph on immune enzymes of Hunghi No.1 popultion of shrimp Fenneropeneus chinensis. J Fishery Sci Chin, 16: Hn, X.B., Xie, J.Z., B, C.F., Wng, G.C Effect of dietry vit C on the heptic the expression levels of HSP7 mrna of rt. Shndong Medicine, 51: He, L.J., Lio, L.K., Yun, J.F., Tng, H.Y., Wu, Q., Zhng, G.W., 26. Pthologicl oservtion of cteril septicemi in Meglorm mlycephl. J Southwest Univ, 3: Jnd, J.M., Aott, S.L Evolving concepts regrding the genus Aeromons: n expnding pnorm of species, disese presenttions, nd unnswered questions. Clin Infect Dis, 27: doi: 1.186/ Kong, X.H., Wng, G.Z., Ai, C.X., Li, S.J. 24. Comprtive study on content of rective oxygen species nd ctivity of ntisuperoxide nion free rdicl in different orgns nd tissues o f mud cr, Scyll serrt. Mrine Sciences, 28:1-4. Kozinsk, A., Figuers, M.J., Chcon, M.R., Soler, L.22. Phenotypic chrcteristics nd pthogenicity of Aeromons genomospecies isolted from common crp (Cyprinus crpio L.). J Appl Microiol, 93: doi: 1.146/j x Kumri, J., Shoo, P. K. 25. High dietry vitmin C ffects growth, non-specific immune responses nd disese resistnce in Asin ctfish, Clris trchus. Mol Cell Biochem, 28: doi: 1.17/s z Lvill-Pitogo, C.R., Leno, E.M., Pner, M.G Mortlities of pond-cultured juvenile shrimp,peneus monodon, ssocited with dominnce of luminescent viriosis in the rering environment. Aquculture 164: doi:.116/s (98)198-7 Le Moullc, G., Hffner, P. 2. Environmentl fctors ffecting immune responses in crustce. Aquculture, 191: doi: 1.116/S ()422-1 Lee, K.J., Drowski, K., 24. Long-term effects nd interctions of dietry vitmins C nd E on growth nd reproduction of yellow perch, Perc flvescens. Aquculture, 23: doi: / Li, C.C., Chen, J.C. 28. The immune response of white shrimp Litopeneus vnnmei nd its susceptiility to Virio lginolyticus under low nd high ph stress. Fish Shellfish Immun, 25: doi:1.116/j.fsi Lin, Y.C., Tyg, C.M., Hung,.CL., Tsui, W.C., Chen, J.C. 21. White shrimp Litopeneus vnnmeitht hd received the hot-wter extrct of Spirulin pltensis showed erlier recovery in immunity nd upregultion of gene expressions fter ph stress. Fish Shellfish Immun, 29: doi:1.116/j.fsi Lindquist, S., Crig, E.A The het shock proteins. Annu Rev Genet, 22: doi: /nnurev.genet Liu, B., Ge, X.P., Xie, J., Xu, P., Cui, Y.T., Ming, J.H., Zhou, Q.L., Pn, L.K., 212. Effects of nthrquinone extrct from Rheum officinle Bil on the physiologicl responses nd HSP7 gene expression of Meglorm mlycephl under Aeromons hydrophil infection. Fish Shellfish Immun, 32:1-7. doi: 1.116/j.fsi Liu, B., Xie, J., Ge, X.P., Xu, P., Wng, A.M., He, Y.J., Zhou, Q.L., Pn, L.K., Chen, R.L. 21. Effects of nthrquinone extrct from Rheum officinle Bil on the growth performnce nd physiologicl responses of Mcrorchium rosenergii under high temperture stress. Fish Shellfish Immun, 29: doi: 1.116/j.fsi Ming, J.H., Xie, J., Xu, P., Ge, X.P., Liu, W.B., Ye, J.Y Effects of emodin nd vitmin C on growth performnce, iochemicl prmeters nd two HSP7s mrna expression of Wuchng rem (Meglorm mlycephl Yih) under high temperture stress. Fish Shellfish Immun, 32: doi: 1.116/j.fsi Ministry of Agriculture of the People's Repulic of Chin, 213. Chinese Fisheries Yerook. Chinese Agriculturl Press, Beijing. Monfort, P., Bleux, B Dynmics of Aeromons hydrophil, Aeromons sori, nd Aeromons cvie in sewge tret-ment pond. Appl Environ Microiol, 56: Montero, D., Mrrero, M., Izquierdoc, M.S., Roinc, L., Vergrc, J.M., Tortd, L Effect of vitmin E nd C dietry supplementtion on some immune prmeters of gilthed serem (Sprus urt) juveniles sujected to crowding stress. Aquculture, doi: 1.116/S (98)387-1 Nyk, S.K., Swin, P., Mukherjee, S.C.27. Effect of dietry supplementtion of proiotic nd vitmin C on the immune response of Indin mjor crp, Leo rohit (Hm.). Fish Shellfish Immun, 23: doi:1.116/j.fsi Ndong, D., Chen, Y.Y., Lin, Y.H., Vseehrn, B., Chen, J.C., 27. The immune response of tilpi Oreochromis mossmicus nd its susceptiility to Streptococcus inie under stress in low nd high tempertures. Fish Shellfish Immun, 22: doi: 1.116/j.fsi Ogr, W.O., Muthi, P.G., Kuri, H.F.A., Sorum, H., Kguny, D.K., Nduthu, D.I., Colquhoun, D Motile eromonds ssocited with rinow trout (Oncorhynchus mykiss) mortlity in Keny. Bull Eur Assoc Fish Pthol, 18:7-9. Ojolick, E.J., Cusck, R., Benfey, T.J., Kerr, S.R Survivl nd growth of ll-femle diploid nd triploid rinow trout (Oncorhynchus mykiss) rered t chronic high temperture. Aquculture, 131: doi: 1.116/ (94)338-O Ortuno, J., Esten, M.A., Meseguer, J.22. Lck of effect of comining different stressors on immune responses of serem (Sprus urt L.). Vet Immunol
13 B. Liu et l. / Turk. J. Fish. Aqut. Sci. 16: (216) 433 Immunopthol, 84: doi:1.116/s (1)387-7 Ortuno, J., Esten, M.A., Meseguer, J.23. The effect of dietry intke of vitmins C nd E on the stress response of gilthed serem (Sprus urt L.). Fish Shellfish Immun, 14: doi:1.16/fsim Özkn, F., Gündüz, S.G., Berköz, M., Hunt, A.Ö., Ylm, S.212. The protective role of scoric cid (vitmin C) ginst chlorpyrifos-induced oxidtive stress in Oreochromis niloticus. Fish Physiol Biochem, 38: doi: 1.17/s Pn, L.Q., Zhng, L.J., Liu, H.Y. 27. Effects of slinity nd ph on ion-trnsport enzyme ctivities, survivl nd growth of Litopeneus vnnmei postlrve. Aquculture,273: doi:1.116/j.quculture Qu, M., Shi, X.F., Zhng, Z.W., Ding, S.X Cloning of HSP6 gene from Epinephelus kr nd its express chrcteriztion efore nd fter virionic stressed. Act Ocenologic Sinic, 33: Rotlnt, J., Pvlidis, M., Kentouri, M., Ad, M.E., Tort, L Non-specific immune responses in the red porgy Pgrus pgrus crowding stress. Aquculture, 156: doi:1.116/s (97)75-6 Rungrssmee, W., Leeltnwit, R., Jirvnichpisl, P., Klinung, S., Kroonuthisiri, N. 21. Expression nd distriution of three het shock protein genes under het shock stress nd underexpos ure to Virio hrveyi in Peneus monodon. Dev Comp Immunol, 34: doi:1.116/j.dci Sohn, K.S., Mohn, C.V., Shnkr, K.M. 22. Effect of dietry vitmin C on the disese susceptiility nd inflmmtory response of mrigl, Cirrhinus mrigl (Hmilton) to experimentl infection of Aeromons hydrophil. Aquculture, 27: doi:1.116/s (1)793-1 Steinhgen, D., Kruse, P., Ko rting, W Effects of immunosuppressive gents on common crp infected with the hemoflgellte Trypnoplsm orreli. Dis Aqut Orgn, 7: doi: /do767 Tng, Y.K., Ji, Y.Y. 28. The processing method study of rel-time PCR dt. Biotechnology, 18: Tewry, A., Ptr, B.C. 28. Use of vitmin C s n immunostimulnt. Effect on growth, nutritionl qulity, nd immune response of Leo rohit (Hm.). Fish Physiol Biochem, 34: doi: 1.17/s z Topić, Popovic., N., Teskeredzić, E., Strunjk-Perović, I., Coz-Rkovc, R. 2. Aeromons hydrophil isolted from wild freshwter fish in Croti. Vet Res Commun, 24: doi: 1.123/A: Tort, L., Gomez, E., Montero, D., Sunyer, J.O Serum hemolytic nd gglutinting ctivity s indictors of fish immunocompetence. Their suitility in stress nd dietry studies. Aquculture Int, 4: doi: 1.17/BF Trip, R.A., Mule, A.G., Schreck, C.B., Kttri, S.L Cortisol medited suppression of Slmonid lymphocyte responses in vitro.dev. Comp.Immunol, 11: doi:1.116/145-35x(87)945- Vivs, J., Crrcedo, B., Riñ, J., Rzquin, B.E., López- Fierro, P., Acost, F., Nhrro, G.J., Villen, A. 24. Behvior of n Aeromons hydrophil roa live vccine in wter microcosms. Appl. Environ. Microiol, 7: doi: /AEM Wn, J.J., Liu, B., Ge, X.P., Xie, J., Cui, S.L., Zhou, M.213. Effects of dietry vitmin C on growth performnce, hemtology nd muscle physiochemicl indexes of juvenile Wuchng rem (Meglorm mlycephl). J. Shnghi Ocen Univ., 22: Wng, C., Silv, J.L Prevlence nd chrcteristics of Aeromons species isolted from processed chnnel ctfish. J Food Prot, 62:3-34. Wendelr Bong, S.E The stress response in fish. Physiol Rev, 77: Wilkie, M.P., Wood, C.M The effects of extremely lkline wter (ph 9.5) on rinow trout gill function nd morphology. J.Fish Biol, 45: doi: DOI: /j t1288.x Yeh, S.T., Li, C.C., Tsuei, W.J., Chen, J.C.21. The protective immunity of white shrimp Litopeneus vnnmei tht hd een immersed in the hot-wter extrct of Grcilri tenuistipitt nd sujected to comined stresses of Virio lginolyticus nd temperture chnge. Fish Shellfish Immun, 29: doi: 1.116/j.fsi Yin, Z., Lm, T.J., Sin, Y.M The effects of crowding stress on the non-specific immune response in fncy crp (Cyprinus crpiol.). Fish Shellfish Immun, 5: doi:1.116/s (95)852-2 Zhou, M., Liu, B., Ge, X.P., Xie, J., Cui, Y.T., Wn, J.J., Cui, S.L.213. Effects of Vitmin E on serum iochemicl indexes nd ntioxidnt cpcity of Wuchng rem ( Meglorm mlycephl) under cute high temperture stress nd recovery. J Fisheries Chin, 37:
Freshwater Fisheries and Germplasm Resources Utilization, , Wuxi, China.
Turkish Journl of Fisheries nd Aqutic Sciences 12: 95-916 (212) www.trjfs.org ISSN 133-2712 DOI: 1.4194/133-2712-v12_4_18 Comprison Study of the Effects of Anthrquinone Extrct nd Emodin from Rheum officinle
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationReplacing Fish Meal with Soybean Meal and Brewer s Grains with Yeast in Diets for Australian Red Claw Crayfish, Cherax quadricarinatus
Replcing Fish Mel with Soyben Mel nd Brewer s Grins with Yest in Diets for Austrlin Red Clw Cryfish, Cherx qudricrintus Lur A. Muzinic*, Kenneth R. Thompson, & Crl D. Webster Introduction Soyben mel (SBM)
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationImmunological and Bactericidal Effects of Turmeric (Curcuma longa Linn.) Extract in Pacific White Shrimps (Litopenaeus vannamei Boone)
Ksetsrt J. (Nt. Sci.) 44 : 850-858 (2010) Immunologicl nd Bctericidl Effects of Turmeric (Curcum long Linn.) Extrct in Pcific White Shrimps (Litopeneus vnnmei Boone) Kittim Vnichkul 1, Nontwith Areechon
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More informationEffect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens
Interntionl Journl of Poultry Science 7 (12): 1232-1236, 2008 ISSN 1682-8356 sin Network for Scientific Informtion, 2008 Effect of Different Dietry Energy Sources on Induction of Ftty Liver-Hemorrhgic
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationEffect of Probiotics (Lactobacillus and Bifidobacterium) on Growth Performance and Hematological Profile of Clarias gariepinus Juveniles
World Journl of Fish nd Mrine Sciences 5 (): 0-08, 203 ISSN 2078-4589 IDOSI Pulictions, 203 DOI: 0.5829/idosi.wjfms.203.05.0.6582 Effect of Proiotics (Lctocillus nd Bifidocterium) on Growth Performnce
More informationSupporting information
Supporting informtion Multiple Univrite Dt Anlysis Revels the Inulin Effects on the High-ft-diet Induced Metolic Altertions in Rt Myocrdium nd Testicles in the Pre-oesity Stte Yixun Dun #, Ynpeng An #,
More informationJournal of Applied Biological Sciences 9 (2): 37-42, 2015 ISSN: , E-ISSN: ,
Journl of Applied Biologicl Sciences 9 (2): 37-42, 15 ISSN: 17-11, E-ISSN: 2146-8, www.noel.gen.tr The Effects of Blnced Diets with Soy Ben Extrct or Met nd Bone mel on Muscle nd Liver Tissue Protein nd
More informationRecent advances in cryopreservation od salmonid fish semen. Andrzej Ciereszko
Recent dvnces in cryopreservtion od slmonid fish semen Andrzej Ciereszko Institute of Animl Reproduction nd Food Reserch, Polish Acdemy of Sciences in Olsztyn, Polnd Justifiction for the studies Poor performnce
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationEffects of Different Sources and Levels of Selenium on Performance, Thyroid Function and Antioxidant Status in Stressed Broiler Chickens
Interntionl Journl of Poultry Science 8 (6): 583-587, 2009 ISSN 1682-8356 Asin Network for Scientific Informtion, 2009 Effects of Different Sources nd Levels of Selenium on Performnce, Thyroid Function
More informationThe Ever Changing World of Feed Additives in The Poultry Industry
The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of
More informationEffects of Dietary Protein and Energy on Growth Performance and Carcass Characteristics of Betong Chickens (Gallus domesticus) During Growing Period
Interntionl Journl of Poultry Science 9 (5): 468-472, 2010 ISSN 1682-8356 Asin Network for Scientific Informtion, 2010 Effects of Dietry Protein nd Energy on Growth Performnce nd Crcss Chrcteristics of
More informationAquaculture protein levels
Ž. Aquculture 189 2000 287 292 www.elsevier.nlrlocterqu-online Whole-ody mino cid pttern of F4 humn growth hormone gene-trnsgenic red common crp ž Cyprinus crpio/ fed diets with different protein levels
More informationNozzi Valentina, Graber Andreas, Mathis Alex, Schmautz Zala, Junge Ranka
Nozzi Vlentin, Grer ndres, Mthis lex, Schmutz Zl, Junge Rnk Interntionl conference quponics reserch mttes Ljuljn, 22-24 Mrch 216 Some nutrients from the quculture effluents re present in insufficient quntities
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationEFFECTS OF MANNAN-OLIGOSACCHARIDE ON GROWTH, SURVIVAL AND DISEASE RESISTANCE OF NILE TILAPIA (OREOCHROMIS NILOTICUS LINNAEUS) FRY
8 th Interntionl Symposium on Tilpi in Aquculture 2008 345 EFFECTS OF MANNAN-OLIGOSACCHARIDE ON GROWTH, SURVIVAL AND DISEASE RESISTANCE OF NILE TILAPIA (OREOCHROMIS NILOTICUS LINNAEUS) FRY C. SAMRONGPAN*,
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationScholarly Research Exchange
Scholrly Reserch Exchnge Volume 9 Article ID 7959 doi:1.3814/9/7959 Reserch Article Different Dietry Levels of Protein to Lipid Rtio Affected Digestive Efficiency, Skeletl Growth, nd Muscle Protein in
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationEnhanced glutathione peroxidases (GPx) activity in young barley seedlings enriched with selenium
Africn Journl of Biotechnology Vol. 10(55), pp. 11483-11487, 21 Septemer, 2011 Aville online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB11.1480 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationToxicity of Silver Nanoparticles to Marine Microalgae Chlorella Vulgaris Xue-jiao ZHANG 1,2,*, Ting-wan ZHANG 1,2 and Romana MANZOOR 1,2
2017 Interntionl Conference on Energy, Power nd Environmentl Engineering (ICEPEE 2017) ISBN: 978-1-60595-456-1 Toxicity of Silver Nnoprticles to Mrine Microlge Chlorell Vulgris Xue-jio ZHANG 1,2,*, Ting-wn
More informationEffect of processing on in vitro bioaccessibility of phenolics, flavonoids and antioxidant activity of vegetables with/without yoghurt
Effect of processing on in vitro ioccessiility of phenolics, flvonoids nd ntioxidnt ctivity of vegetles with/without yoghurt Assoc. Prof. Dr. Esr ÇAPANOĞLU GÜVEN Deprtment of Food Engineering Istnul Technicl
More informationThe Effect of Replacement of Fish Oil (FO) By Canola Oil (CO) On Blood Serum Enzymes of the Rainbow Trout (Oncorhynchusmykiss)
5, TextRod Puliction ISSN: 9-7 Journl of Applied Environmentl nd Biologicl Sciences www.textrod.com The Effect of Replcement of Fish Oil (FO) By Cnol Oil (CO) On Blood Serum Enzymes of the Rinow Trout
More informationThe Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes
The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationIbrahim, I. Hamid Animal Production Research Center-Khartoum North, Sudan
Interntionl Journl of Poultry Science 13 (8): 484-488, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 Investigtions into the Addition of Herl Methionine (Phytonin) As Sustitute of Synthetic
More informationChoice Feeding of Two Different Broiler Strains Using Diets with Constant Energy Level 1
Interntionl Journl of Poultry Science 7 (8): 726-737, 2008 ISSN 1682-8356 Asin Network for Scientific Informtion, 2008 Choice Feeding of Two Different Broiler Strins Using Diets with Constnt Energy Level
More informationThe effects of Momordica charantia on obesity and lipid profiles of mice fed a high-fat diet
Nutrition Reserch nd Prctice 2015;9(5):489-495 c2015 The Koren Nutrition Society nd the Koren Society of Community Nutrition http://e-nrp.org The effects of Momordic chrnti on obesity nd lipid profiles
More informationSUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis
SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song
More informationResearch Article The Composition Analysis of Maca (Lepidium meyenii Walp.) from Xinjiang and Its Antifatigue Activity
Hindwi Journl of Food Qulity Volume 2017, Article ID 2904951, 7 pges https://doi.org/10.1155/2017/2904951 Reserch Article The Composition Anlysis of Mc (Lepidium meyenii Wlp.) from Xinjing nd Its Antiftigue
More informationProducts for weaners Benzoic acid or the combination of lactic acid and formic acid
Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationTHE USE OF SOY PRODUCTS AND OTHER PLANT PROTEIN SUPPLEMENTS IN AQUACULTURE FEEDS
THE USE OF SOY PRODUCTS AND OTHER PLANT PROTEIN SUPPLEMENTS IN AQUACULTURE FEEDS by DEAN M. AKIYAMA Americn Soyben Assocition 541 Orchrd Rod, # 11-03 Lit Towers Singpore Aquculture feed production worldwide
More informationJournal of Coastal Life Medicine
Journl of Costl Life Medicine 2017; 5(8): 325-329 325 Journl of Costl Life Medicine journl homepge: www.jclmm.com Originl rticle https://doi.org/10.12980/jclm.5.2017j7-104 2017 y the Journl of Costl Life
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationPreliminary investigation of antimicrobial effects of pomegranate (Punica granatum L.) leathery exocarp extract against some serious phytopathogens
Preliminry investigtion of ntimicroil effects of pomegrnte (Punic grntum L.) lethery exocrp extrct ginst some serious phytopthogens Elshfie H.S. 1,*, Skr S.H. 2, Mng S.M. 1, Frisullo S. 3, Cmele I. 1 1
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationRelationship between food availability, glycerol and glycogen levels in lowtemperature challenged rainbow smelt Osmerus mordax
866 The Journl of Experimentl Biology, 866-87 Published by The Compny of Biologists 7 doi:.4/jeb.749 Reltionship between food vilbility, glycerol nd glycogen levels in lowtemperture chllenged rinbow smelt
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More informationEffects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle
Effects of Recominnt Bovine Somtotropin Administrtion t Breeding on the Cow, Conceptus nd Susequent Offspring Performnce of Beef Cttle V. R. G. Mercdnte 1, F. M. Cirico 1, D. D. Henry 1, P. L. P. Fontes
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationInvasive Pneumococcal Disease Quarterly Report July September 2018
Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationTHE INFLUENCE OF MILK THISTLE SEED CAKES ON BROILER CHICKENS PERFORMANCE PARAMETERS
THE INFLUENCE OF MILK THISTLE SEED CAKES ON BROILER CHICKENS PERFORMANCE PARAMETERS STASTNIK ONDREJ 1, DETVANOVA LENKA 2, KARASEK FILIP 1, STENCLOVA HANA 1, KALHOTKA LIBOR 2, PAVLATA LEOS 1, MRKVICOVA
More informationEffects of Sini San used alone and in combination with fluoxetine on central and peripheral 5-HT levels in a rat model of depression
Online Sumissions:http://www.journltcm.com J Trdit Chin Med 2013 Octoer 15; 33(5): 674-681 info@journltcm.com ISSN 0255-2922 2013 JTCM. All rights reserved. EXPERIMENTAL STUDY TOPIC Effects of Sini Sn
More information(Huso huso) (P< (P> .(P< .(P<
(Huso huso) Vhid_tghizdeh54@yhoo.com ( ) ( (P> P>.(.( Huso huso (O. mykiss (Wtne & Pongmneert, 1993) (Ymmoto et l., 1995) O. mykiss) Hung, 1989 Acipenser ruthenus Hrdy, 2008 A. erii (Ronyi et l., 2002)
More informationB. Koven 1*, E. Gisbert 2, O. Nixon 1, I. Meiri-Ashkenazi 1, A. Gaon 1, M.M. Solovyev 3,4, A. Tandler 1, H. Rosenfeld 1
DESIGNING WEANING DIETS BASED ON THE ONTOGENY OF DIGESTIVE TRACT ENZYME ACTIVITY DURING THE CARNIVOROUS-OMNIVOROUS TRANSITION IN GREY MULLET (MUGIL CEPHALUS) JUVENILES B. Koven 1*, E. Gisert 2, O. Nixon
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationBlood parameters of Caspian brown trout (Salmo trutta caspius) fingerlings affected by dietary L-ascorbyl-2- polyphosphate
Irnin Journl of Fisheries Sciences 15(3) 1167-1186 2016 Blood prmeters of Cspin rown trout (Slmo trutt cspius) fingerlings ffected y dietry L-scoryl-2- polyphosphte Downloded from jifro.ir t 17:07 +0430
More informationGoal: Evaluate plant health effects while suppressing dollar spot and brown patch
Newer Fungicide Products Alone nd In Rottion on Chicgo Golf Green Reserchers: Chicgo District Golf Assoc. Derek Settle, Tim Sibicky, nd Nick DeVries Gol: Evlute plnt helth effects while suppressing dollr
More informationAquatic Toxicology 162 (2015) Contents lists available at ScienceDirect. Aquatic Toxicology. journal homepage:
qutic Toxicology 162 (2015) 39 53 ontents lists ville t ScienceDirect qutic Toxicology journl homepge: www.elsevier.com/locte/qutox Trnscriptionl nd iochemicl mrkers in trnsplnted Perc flvescens to chrcterize
More informationEffect of 1-Methylcyclopropene on the Physiology and Yield of Cotton. Derrick Oosterhuis Eduardo Kawakami and Dimitra Loka University of Arkansas
Effect of 1-Methylcyclopropene on the Physiology nd Yield of Cotton Derrick Oosterhuis Edurdo Kwkmi nd Dimitr Lok University of Arknss Cotton Crop Gossypium hirsutum Unique out cotton Perennil grown s
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationPhysical training prevents oxidative stress in L-NAME-induced hypertension rats
cell iochemistry nd function Cell Biochem Funct 2013; 31: 136 151. Pulished online 7 Septemer 2012 in Wiley Online Lirry (wileyonlinelirry.com) DOI:.02/cf.2868 Physicl trining prevents oxidtive stress
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationAOAC Official Method Determination of Isoflavones in Soy and Selected Foods Containing Soy
45.4.14 AOAC Officil Method 2001.10 Determintion of Isoflvones in Soy nd Selected Foods Contining Soy Extrction, Sponifiction, nd Liquid Chromtogrphy First Action 2001 (Applicble to the determintion of
More informationFood Chemistry. Lijun You a, Mouming Zhao a, *, Joe M. Regenstein b, Jiaoyan Ren a. abstract. Contents lists available at ScienceDirect
Food Chemistry 124 (211) 188 194 Contents lists ville t ScienceDirect Food Chemistry journl homepge: www.elsevier.com/locte/foodchem In vitro ntioxidnt ctivity nd in vivo nti-ftigue effect of loch (Misgurnus
More informationPaper-based skin patch for the diagnostic screening of cystic fibrosis
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 2015 Supplementry informtion Pper-bsed skin ptch for the dignostic screening of cystic fibrosis Xun Mu,*
More informationby PSP Volume 22 No Fresenius Environmental Bulletin
by PSP Volume 22 No 7. 213 Fresenius Environmentl Bulletin TISSUE-SPECIFIC EFFECT OF MERCURY ON ANTIOXIDANT DEFENSE SYSTEM AND PROTECTIVE ROLE OF SELENIUM ON MERCURY-INDUCED OXIDATIVE STRESS IN BLUE MUSSEL
More informationEFFECT OF PHOTOPERIOD AND TRYPTOPHAN AMINO ACID SUPPLEMENTATION ON PINEAL GLAND HORMONE (MELATONIN) AND ITS RELATION TO PERFORMANCE IN LOCAL STRAIN.
Egypt. Poult. Sci. Vol (30) (IV): (927-960) EFFECT OF PHOTOPERIOD AND TRYPTOPHAN AMINO ACID SUPPLEMENTATION ON PINEAL GLAND HORMONE (MELATONIN) AND ITS RELATION TO PERFORMANCE IN LOCAL STRAIN. 1- EFFECT
More informationEFFECT OF METHANOL EXTRACT OF ALOE VERA ON ACETIC ACID-INDUCED COLON ULCER
EFFECT OF METHANOL EXTRACT OF ALOE VERA ON ACETIC ACID-INDUCED COLON ULCER 4. EFFECT OF METHANOL EXTRACT OF ALOE VERA ON ACETIC ACID -INDUCED COLON ULCER 4.1 INTRODUCTION Aloe rdensis Miller (Aloe ver)
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationEFFECT OF ANESTHETICS ON STRESS AND THE INNATE IMMUNE SYSTEM OF GILTHEAD SEABREAM (SPARUS AURATA)
The Isreli Journl of Aquculture Bmidgeh 56(1), 24, 5-13 5 EFFECT OF ANESTHETICS ON STRESS AND THE INNATE IMMUNE SYSTEM OF GILTHEAD SEABREAM (SPARUS AURATA) Keren Bressler nd Benny Ron* Isrel Ocenogrphic
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationGeographical influence on digit ratio (2D:4D): a case study of Andoni and Ikwerre ethnic groups in Niger delta, Nigeria.
Journl of Applied Biosciences 27: 1736-1741 ISSN 1997 5902 Geogrphicl influence on digit rtio (2D:4D): cse study of Andoni nd Ikwerre ethnic groups in Niger delt, Nigeri. Gwunirem, Isrel U 1 nd Ihemelndu,
More information