Intracerebral Infusion of Antisense Oligonucleotides Into Prion-infected Mice

Transcription

1 Cittion: Moleulr Therpy Nulei Aids (212) 1, e9; doi:1.138/mtn Amerin Soiety of Gene & Cell Therpy All rights reserved /11 Intrererl Infusion of Antisense Oligonuleotides Into Prion-infeted Mie Krh Nzor Frierg 1, Gene Hung 2, Ed Wnewiz 2, Kurt Giles 1,3, Chris Blk 2, Sue Freier 2, Frnk Bennett 2, Stephen J DeArmond 1,4, Yevgeniy Freymn 1, Pierre Lessrd 1, Sin Ghemmghmi 1,3 nd Stnley B Prusiner 1,3 Mie defiient for the ellulr prion protein (PrP C ) do not develop prion disese; ordingly, gene-sed strtegies to diminish PrP C expression re of interest. We synthesized series of hemilly modified ntisense oligonuleotides (ASOs) trgeted ginst mouse Prnp messenger RNA (mrna) nd identified those tht were most effetive in deresing PrP C expression. Those ASOs were lso evluted in srpie-infeted ultured ells (SN2) for their effiy in diminishing the levels of the diseseusing prion protein (PrP S ). When the optiml ASO ws infused intrererlly into FVB mie over 14-dy period eginning 1 dy fter infetion with the Roky Mountin Lortory (RML) strin of mouse prions, prolongtion of the inution period of lmost 2 months ws oserved. Whether ASOs n e used to develop n effetive therpy for ptients dying of Creutzfeldt Jko disese remins to e estlished. Moleulr Therpy Nulei Aids (212) 1, e9; doi:1.138/mtn.211.6; dvne online pulition 7 Ferury 212 Introdution Over the pst 3 dedes, distint protein hs een found to umulte in the rins of ptients suffering from eh of the neurodegenertive diseses. Muttions hve een found in the respetive genes enoding the prtiulr etiologi proteins responsile for the fmilil forms of the neurodegenertive diseses. Inresing evidene rgues tht eh of the disese-using proteins undergo posttrnsltionl modifition in self-perpetuting proess. This prion-like mehnism leds to the umultion of the modified, etiologi proteins. In Creutzfeldt Jko disese of humns, srpie of sheep, ovine spongiform enephlopthy, nd hroni wsting disese, the ellulr prion protein (PrP C ) undergoes refolding into the disese-using isoform (PrP S ). The progressive umultion of PrP S in the rin leds to entrl nervous system (CNS) dysfuntion tht is ompnied y neuronl vuoltion nd stroyti gliosis. In some ses, myloid plques omposed of PrP S re found within the CNS ut suh plques re not n oligtory feture of these disorders. Mny lines of evidene onverged to rgue tht PrP S is the sole omponent of the infetious prion prtile. Lter, knokout of the PrP gene enoding PrP C ws found to render mie resistnt to experimentl srpie. This finding suggested tht ptients dying of Creutzfeldt Jko disese would enefit from therpeutis tht lower the levels of PrP C nd/or PrP S. Both RNA interferene (RNAi) nd ntisense oligonuleotides (ASOs) hve een used to lower the levels of PrP C nd PrP S in srpie-infeted ultured ells (SN2). RNAi moleules hve een found to lower PrP mrna levels nd hene PrP C. 1 4 In SN2 ells s well s in the rins of srpie-infeted mie, the levels of PrP S were lso lowered y exposure to sequene-speifi RNAi moleules. In ontrst to the RNAi results, ASOs re onfounded y the ility of these polymers to lower PrP S levels in SN2 independent of their sequene. 5,6 Tretment of prion diseses using trnsgeni (Tg) mie with induile PrP C expression systems hve een performed. 7,8 Tg(NFH-Cre/MloxP) mie were inoulted with the Roky Mountin Lortory (RML) prions t 3 4 weeks of ge. 7 Cre-medited reomintion t 1 12 weeks of ge ws effetively used to suppress neuronl PrP C expression ut not tht in other CNS ells. Shutting off PrP C expression in neurons, even fter mie developed signs of neurologi dysfuntion, reversed spongiform degenertion nd prevented linil disese. Surprisingly, mie remined symptomti even though their rins were inundted with extrneuronl PrP S deposits. In igeni Tg(tTA:PrP +/ )3 mie, PrP C expression ws regulted y orl doxyyline dministrtion. 8 PrP C expression ws redued y 95% in the rins of igeni mie ompred to wild-type mie, whih extended survivl times following prion inoultion from ~15 to ~43 dys when the mie eventully developed linil disese. In these mie, PrP C suppression prevented pyrmidl nerve ell deth nd enhned the lerne of PrP S deposits. Reently, single injetion of smll hirpin RNA trgeting PrP into the hippompus of Tg37 mie proteted the thlmus nd ortex, rin regions distl to the injetion site, from prion-indued neurodegenertion nd prolonged survivl time from 85 to 15 dys even though PrP C expression ws redued only t the order of the injetion site. 4 1 Institute for Neurodegenertive Diseses, University of Cliforni Sn Frniso, Sn Frniso, Cliforni, USA; 2 Isis Phrmeutils, In., Sn Frniso, Cliforni, USA; 3 Deprtment of Neurology, University of Cliforni Sn Frniso, Sn Frniso, Cliforni, USA; 4 Deprtment of Pthology, University of Cliforni Sn Frniso, Sn Frniso, Cliforni, USA Correspondene: Stnley B Prusiner, Institute for Neurodegenertive Diseses, Deprtment of Neurology, University of Cliforni Sn Frniso, 513 Prnssus Ave, HSE-774, Sn Frniso, Cliforni , USA. E-mil: stnley@ind.usf.edu Reeived 3 Novemer 211; epted 3 Novemer 211

2 2 ASO Infusion in Prion-infeted Mie Designed, synthesized nd sreened 78 ntisense oligonuleotides, ginst mouse Prnp mrna trnsript. Seleted top 1 ASOs In vivo dose-response nd tolerility studies Uninfeted FVB mie.end ell Dose-response of top 1 leds Single-dose ICV infusion for 21 dys of two led ASOs Uninfeted FVB mie.end ell In vitro proof-of-onept studies with top 3 ASOs N2 nd SN2 ell lines Dose-response of two led ASOs to identify top ASO hit Proof-of-onept studies using top ASO hit Uninfeted FVB mie 12 1 Prion-infeted FVB mie % UTC ontrol Oligos UTC TSS CDS Exons , 1,5 2, % UTC ontrol UTC 6.25 nm 12.5 nm 25. nm 5. nm 1. nm 2. nm Figure 1 Identifition of ASOs tht diminish mouse Prnp mrna expression mesured y qrt-pcr. () Experimentl design. () Prnp mrna expression 24 hours post-trnsfetion with 78 ntisense oligonuleotides (12 nmol/l) trgeting mouse Prnp mrna in.end ells. ASOs re displyed reltive to their position on the 2,26-p mouse Prnp mrna (Aession NM_1117). () Dose-response of Prnp mrna expression using the 1 most-effetive ASOs in.end ells. ASO onentrtions rnged from nmol/l, s indited. Prnp mrna is expressed s perentge ompred to untrnsfeted ontrol (UTC). ASO, ntisense oligonuleotide; p, se pir; ICV, intrererl ventriulr; mrna, messenger RNA; qrt-pcr, quntittive rel time-pcr. Moleulr Therpy Nulei Aids

3 ASO Infusion in Prion-infeted Mie 3 Severl linilly desirle dvntges over lentivirl injetions of RNAi moleules re offered y the intrererl ventriulr (ICV) delivery of ASOs tht re fully phosphorothioted (PS). The five se ps t eh end of the 2mer ASO were methoxyethyl-modified to inrese poteny nd stility s well s to derese proinflmmtory effets. The PS modifition in the kone of DNA, in whih one non-ridging oxygen tom is repled with sulfur tom, inreses nulese resistne, resulting in enhned stility oth in vitro nd in vivo. In ddition, the PS modifition improves tissue distriution nd ell uptke in vivo. The methoxyethyl modifition inreses the ffinity of the ASOs for RNA nd protets the 2mer from exonulese degrdtion, resulting in n extended durtion of tion in tissues due to longer metoli hlf-life. 9 One introdued into the ells, hyridiztion of the ASO to the trget mrna results in RNse H levge of the messge nd suppression of gene expression. 1 Here, we report on ASOs trgeting mouse Prnp mrna tht suppress PrP C expression nd inhiit PrP S formtion in ell ulture nd srpie-infeted mie. Intrventriulr infusion of n ASO, for 14 dys eginning 1 dy fter inoultion with RML prions, extended inution periods in prion-infeted mie y lmost 2 months. Results Strtegy. We synthesized nd sreened 78 ASOs with methoxyethyl gpmer hemistry trgeting the mouse (Mo) PrP messge in mouse endothelil ell line designted.end. From this pnel, we identified the 1 most tive ASOs for PrP trnsript knokdown y dose response. The three mosteffetive ASOs,, nd were then sreened for effiy in reduing PrP C nd PrP S in N2 nd SN2 ells, respetively. These three ASOs were injeted intrperitonelly (ip) in uninfeted FVB mie to evlute tolerne s well s to verify in vivo trnsript nd protein knokdown in the liver. Next, the three ASOs were tested for RNA nd protein knokdown in the rin y intrererl dministrtion into the left lterl ventrile through nnul using n implnted Alzet osmoti pump. Of the three most effetive ASOs, ws hosen for further study in srpie-infeted mie (Figure 1). In vitro sreening. High-throughput sreening of 78 ASOs y quntittive rel-time (qrt) PCR identified the 1 with the gretest mrna knokdown effiy (Figure 1). These 1 ASOs were then evluted y mesuring the dose- dependent responses in.end ells; ASOs were dded t inresing onentrtions (6.5 2 nmol/l) in the presene of the lipofetmine trnsfetion regent (Figure 1). ASOs,, nd hd the gretest poteny, with PrP mrna levels redued y 94, 97, nd 97%, respetively, t the 2-nmol/l dose ompred to ells treted with non sequene-speifi ontrol ASO 923 (Tle 1). Bsed on redutions in PrP mrna levels in.end ells, ASOs,, nd were sreened in N2 ells. These ASOs trget three sites in the 3 untrnslted region (UTR) of MoPrP mrna (NM_1117.1; Figure 2). Furthermore, this experimentl senrio etter mimis in vivo delivery of the drug into the rin. Cells were ultured for 3 dys in the Tle 1 Perentge inhiition of Prnp mrna expression in mouse.end ells y different doses of ASOs ompred to ontrol ells treted with ASO 923 mrna inhiition (%) Dose (nmol/l) ASO ASO ASO Arevitions: ASO, ntisense oligonuleotide; mrna, messenger RNA;, phosphte-uffered sline. ontinuous presene of 5 nmol/l of eh ASO nd lystes were olleted t 2, 7, 14, nd 28 dys for nlysis of PrP C expression y western immunolots, whih were quntified y densitometry (Figure 2). ASO redued PrP C levels more rpidly thn the other two ASOs, with 6% redution oserved following 7 dys of exposure nd 84% redution y 14 dys. Control ASO 923 eliited low levels of non sequene-speifi redution of PrP C expression, y ~2% t 7, 14, nd 28 dys. Antisense inhiition of PrP 27-3 in SN2 ells. To determine whether ASO-medited PrP C suppression ffets PrP S levels in prion-infeted ells, SN2 ells were ultured in the presene of 5 nmol/l of eh led ASO nd lystes olleted t 2, 7, 14, nd 28 dys. Following 2 dys of tretment, levels of PrP 27-3, the protese-resistnt ore of PrP S, were redued y 81% with ASO, y 63% with ASO, nd y 57% with ASO (Figure 2). After 7 dys of exposure to ASOs,, or, PrP 27-3 ws not detetle. Cells exposed to the ontrol ASO 923 for 2 dys showed 41% redution in PrP 27-3, nd 95% redution in PrP 27-3 fter 7 dys. We nd others hd previously reported the redution in PrP S levels y sequene-srmled PS oligonuleotides. 5,6 Following 28 dys of exposure to eh of the four ASOs inluding the ontrol ASO 923, PrP S ws undetetle. To determine whether these oservtions were speifi to SN2 ells, these experiments were lso performed with prion-infeted GT1 ells, SGT1. PrP 27-3 in this ell line ws ompletely eliminted fter 7 dys of exposure to eh of ASOs inluding the ontrol ASO 923 (dt not shown). To determine the ASO onentrtion t whih PrP C nd PrP S levels were suppressed y 5% (hlf mximl effetive onentrtion (EC 5 )) in N2 nd SN2 ells, we treted ells with ASO t onentrtions rnging from 2 to 25 nmol/l, olleted lystes fter 7 dys, then mesured PrP C nd PrP S levels y western lot. Inresing ASO onentrtions redued the level of PrP 27-3 in SN2 ells in n exponentil mnner (Figure 2d). The EC 5 vlues for ASO were 5 nmol/l for PrP C nd 4 nmol/l for PrP S. The ontrol ASO 923 hd n EC 5 of 1 nmol/l for PrP S due to non sequene-speifi effets (Figure 2). It is noteworthy tht ASO ws only le to redue PrP C levels y 6% in ultured N2 ells t onentrtion ove 5 nnol/l (Figure 2d). This redution ws sequene-speifi in ontrst to the redution of PrP S, whih exeeded 95% with less thn 1 nmol/l of ASO.

4 4 ASO Infusion in Prion-infeted Mie ASOs redued PrP C levels in vivo. Bsed on our findings in ell ulture, we investigted whether ASOs,, nd would e well-tolerted nd effetive in diminishing mrna nd PrP C levels in vivo. We dministered eh ASO to eight groups of five FVB mie for 21 dys vi ip injetions. Phosphte-uffered sline () nd ontrol ASO 847, whih trgets PTEN protein, were used s ontrols. The ASOs nd were dministered ip twie weekly for 3 weeks, in doses of either 5 mg/kg/week or 1 mg/kg/ week (Figure 3). None of the mie showed negtive effets through the ourse of ASO dministrtion. All of the nimls PrP (%) d 5 UTR PrP 27-3 (%) ORF Time (dys) 3 UTR ASO ASO ASO 2 dys 28 dys dys 7 dys 14 dys 28 dys 923 PrP (%) N2 SN Dose (nmol/l) SN2 PK+ N Dose (nmol/l) remined helthy until they were killed t 21 dys. Routine linil serum hemistry ws performed nd no normlities were oserved (dt not shown). Prnp mrna expression in liver ws determined y qrt- PCR; PrP C expression ws mesured y enzyme-linked immunosorent ssy (ELISA) using nti-prp HuM-F D18 for detetion. The gretest Prnp mrna nd PrP C diminutions in liver were found with the ASO : on 5 or 1 mg/kg/week, respetive redutions of 75 nd 85% in PrP mrna (Figure 3), nd of 65 nd 72% in PrP C, were found (Figure 3). ASO t 5 mg/kg/week redued Prnp mrna y 3% nd PrP C y ~5% in liver, s mesured y qrt-pcr nd immunolotting, respetively. Intrererl ventriulr delivery of ASOs redued rin PrP C. Enourged y the sfety profile nd the effetive redution of PrP C y the ASOs in liver following systemi dministrtion, we next hrterized the tolerility nd phrmology of ASOs in the CNS vi intrererl ventriulr (ICV) dministrtion (Figure 3d). Two led ASOs nd were ontinuously infused into the right lterl ventrile (Figure 3e, region 3) of FVB mie using implnted Alzet osmoti pumps, t dose of 75 μg/dy for 21 dys, fter whih mie were killed within 24 hours. A ontrol group of mie ws treted with in the sme mnner for the sme time period. The ASOs were well-tolerted; neither toxi side effets nor rin sesses were oserved. Histopthologil nlysis of setion of the midrin, posterior to the nnultion site, showed no normlities (dt not shown). mrna nd PrP C levels were evluted using different rin regions. RNA ws isolted from portion of rin djent to the nnulted lterl ventrile nd ventrl to the nnultion site (Figure 3e, region 2). For PrP C, portion of the rin nterior to nd on the ipsilterl side of nnultion (Figure 3e, region 1) ws homogenized in (1% w/v) nd nlyzed y densitometry of western lots. PrP mrna mesured y qrt- PCR ws ~6% lower in mie reeiving either ASO or ompred to mie infused with (Figure 3f). Administrtion of ASO nd resulted in 3% nd ~7% less PrP C, respetively, in the rin ompred to mie reeiving ontrol injetions s shown y immunolotting (Figure 3g,h). Next, we onduted dose-response study to determine the poteny nd tolerle dose ompred to our previous, single-dose study for whih 75 μg ws dministered per Figure 2 ASOs trgeting mouse Prnp mrna redued PrP C nd PrP S expression in N2 nd SN2 ells. () The three led ASOs,, nd identified in.end ells re displyed reltive to their positions on the 2,26-p mouse Prnp mrna (Aession NM_1117). All fll within exon 4 outside of the oding sequene in the 3 UTR. (,) Kinetis of PrP C suppression in N2 ells is shown in nd protese-resistnt PrP S in SN2 ells is shown in exposed to 5 nmol/l of eh ASO for 2, 7, 14, nd 28 dys. ASO 923 nd were used s ontrols. (d) Dose-response urves of PrP C in N2 nd PrP S in SN2 ells inuted with 25 nmol/l of ASO. In d, PrP levels were quntified y densitometry of snned western lot films using NIH Imge J softwre nd expressed s perentges reltive to ells treted with. Protein stndrds shown re 36, 3, nd 22 kilodltons. ASO, ntisense oligonuleotide; mrna, messenger RNA; ORF, open reding frme;, phosphte-uffered sline; PrP C, ellulr prion protein; PrP S, disese-using prion protein. Moleulr Therpy Nulei Aids

5 ASO Infusion in Prion-infeted Mie 5 y d y IP delivery er PrP y e ICV f g PrP h 3 2 Figure 3 Administrtion of ASOs trgeting mouse Prnp mrna redued PrP C expression in the livers ( ) nd rins (d h) of FVB mie. ASOs were dministered y intrperitonel inoultions for liver studies (n = 4 per dose) nd y ICV infusion (n = 4) for rin studies. (,d) Experimentl design. ASOs were dministered for 21 dys t the speified doses, fter whih time, mie were killed, tissues tken, nd mrna nd protein levels were nlyzed. (,f) Prnp mrna levels were mesured y qrt-pcr; (,g,h) PrP C levels were nlyzed y pture ELISA using ntiody D18 () or y densitometry (g) of western lots proed with ntiody D18 (h). (e) Brin mp showing speifi rin regions tht were nnulted (region 3), hrvested for protein (region 1), nd RNA (region 2). (g,h) ASO more effetively redued PrP C levels in rin ompred to ASO. Different lnes represent four different nimls. Bottom pnel of western lot ws proed with tin. Protein stndrds shown re 36, 3, nd 22 kilodltons. For ll pnels, PrP expression levels re shown s perentges reltive to those mesured in mie treted with. ELISA, enzyme-linked immunosorent ssy; ICV, intrererl ventriulr; ip, intrperitonel; mrna, messenger RNA;, phosphte-uffered sline; PrP C, ellulr prion protein; qrt-pcr, quntittive rel time-pcr. dy. ASO nd, t doses of 25, 5, 75 nd 1 μg/ dy, were ontinuously infused vi ICV into the right lterl ventrile for 14 dys (Figure 4). A ontrol group of mie reeived vi ICV delivery for the sme time period. Mie were killed 24 hours fter the end of the infusion. With the exeption of 1 μg/dy of ASO, ll other doses were well-tolerted y the mie. PrP mrna levels were nlyzed in rin setion posterior to the nnultion site (Figure 3e, region 2) y qrt-pcr (Figure 4). PrP mrna expression levels deresed in n ASO dose-dependent mnner. Delivery of ASO t 5 μg/dy redued PrP mrna levels y ~6% while ASO t 1 μg/dy deresed PrP mrna y 7%. Histolots of oronl ryosetions showed tht PrP C suppression ws most mrked on the nnulted side of the rin, ut ws lso found on the ontrlterl side (Figure 4). Mie infused with ASO t 75 μg/dy showed the most pronouned derese in PrP C expression ompred to those reeiving. A midrin setion (Bregm 2.92 mm) tken from mouse treted with 75 μg/dy of ASO ws fixed nd stined with the ASO ntiody (Figure 4d, rown stining). The ASO dispersed from the injetion site, trvelling distne of 2.92 mm Bregm to the midrin nd penetrted neurons ilterlly. Together, these results demonstrte tht ASO dministered in vivo to the rin y ICV infusion is well-tolerted nd redues oth Prnp mrna nd PrP C. ASO tretment of prion-inoulted mie. On dy, mie were inoulted on the right side of the rin with RML prions. The next dy, ICV infusion of ASO (75 μg/d) or ws initited on the left side of the rin nd ontinued for 14 dys. At 5 dpi (36 dys fter ICV tretment ended), six mie (three from the treted group nd three from the ontrol group) were killed in order to mesure the levels of PrP C nd PrP S (Figure 5). Another group of mie (eight from the tretment group nd six ontrols) were oserved until they developed signs of neurologil dysfuntion (Figure 6). In mie killed t 5 dpi, histolots showed tht ASO tretment diminished PrP C expression (Figure 5) nd PrP S levels (Figure 5) ompred to -infused ontrol mie. PrP C expression ws primrily redued on the left side where ASO ws relesed from the tip of the nnul. As shown, PrP C ws redued in the sustnti nigr, stritum, ererl ortex, hippompus, udte nuleus, mygdl, nd the periquedutl region (Figure 5). A less mrked redution ws oserved in the pons nd ereellum (dt not shown). It ppers tht there is phrmologilly signifint grdient from the ipsilterl to ontrlterl side (Figure 5, ottom row). To exmine in situ PrP S deposition, PrP C ws degrded y limited digestion with proteinse K followed y GdnHCl denturtion of PrP 27-3 efore immunostining (Figure 5). In the rins of -treted mie killed t 5 dpi, PrP S deposits were visile in the white mtter trts (orpus llosum, stritum), septum, hippompus, nd midrin 1 nd 2. The most intense immunostining of PrP S ws seen in the thlmus t the site of inoultion. In the mie reeiving ASO nd

6 6 ASO Infusion in Prion-infeted Mie mrna(%) 6 Dy 1 14 ICV infusion Dose response 25, 5, 75 or 1 g/dy Killing ASO ASO g/dy d ASO ASO 923, PrP S deposits were miniml, inditing tht the ASO inhiited prion replition nd propgtion ilterlly. Western immunolotting of rin homogentes reveled tht only ASO treted FVB mie hd deresed PrP C expression (Figure 5d, top proteinse K (PK) ), wheres oth ASO nd ASO 923 tretment resulted in diminished signls for PrP S (Figure 5d, ottom PK+, two different gels with different nimls). Densitometry of western lots quntified ~5% redution of totl PrP expression throughout the rins of ASO treted mie ompred to mie infused with nd to mie treted with ASO 923 (Figure 5e, top). PrP S levels were redued y 96% in ASO treted mie nd y 92% in ASO 923 treted mie (Figure 5e, ottom). Although oth sequene-speifi ASO nd non sequene- speifi ASO 923 redued PrP S levels eqully well in the rins of prion-inoulted mie t 5 dpi, only ASO redued the PrP C sustrte. The treted mie killed t 126 dpi showed more dvned pthologil deposition of PrP S thn those killed t 5 dpi desried ove. Histolots of symptomti ontrol mie nd symptomti ASO-treted mie t 126 dpi Lethl ASO Figure 4 Dose-dependent redution of mouse Prnp mrna nd PrP C y ASOs dministered y ICV infusion. () Experimentl design. Doses of 25, 5, 75, or 1 μg/dy were dministered y ICV delivery for 14 dys, nd Prnp mrna nd PrP C levels nlyzed t dy 14. () PrP mrna levels were quntified y qrt-pcr nd expressed s the reltive perentge mesured in -treted ontrols. () Regionl expression of PrP C in oronl ryosetions (1 μm) t the level of the septum, shown y histolotting with ntiody D18. (d) Immunohistohemistry of hippompl oronl setion stined with nti-ps ntiody tht detets the PS modifition in the ASO. Arrow indites the nnultion side. ASO, ntisense oligonuleotide; ICV, intrererl ventriulr; mrna, messenger RNA;, phosphte-uffered sline; PrP C, ellulr prion protein; PS, phosphorothiote; qrt-pcr, quntittive rel-time PCR. reveled undnt PrP S in ontrol mie ut muh less PrP S in ASO-treted mie (Figure 6d). At the level of the septum (Bregm mm), PrP S ws diminished in the frontl ererl ortex nd stritum/udte nuleus on the side of the nnul. At the level of the hippompus, the PrP S signl ws depressed ilterlly in the ererl ortex, hippompus, nd mygdl. The ASO treted mie killed t 126 dpi showed onsiderle PrP S in the right thlmus where they hd een inoulted with RML prions; they lso hrored PrP S deposits in the right orpus llosum. At the level of midrin 1 (Bregm 2.92 mm), no PrP S ws deteted in the ererl ortex, sustnti nigr, ventrl hippompus, or periquel qudut. In the rin stem (midrin/ pons/medull), PrP S levels were redued ~5% ompred to -treted mie (Figure 6d). Immunohistohemil stining for PrP S showed more intense stining in the hippompus on the ontrlterl side of nnultion (dt not shown). In survivl study, six ontrol, prion-inoulted mie tht reeived developed neurologil dysfuntion with men inution period of 136 ± 4 dys. Eight mie treted with ASO hd men inution period of 193 ± 1 dys, representing 4% prolongtion in the inution time (Figure 6). One ASO-treted mouse exhiited signs of CNS dysfuntion t 132 dpi while the other seven ASO-treted mie suumed to disese etween dpi. ASO dministrtion for 14 dys sustntilly redued PrP S levels in prion-infeted mie, even 112 dys fter tretment esed (126 dpi) t the time of killing (Figure 6d). ASO-treted mie exhiited PrP C levels tht were slightly lower thn those found in -treted, ontrol mie t 126 dpi (see Figure 6). A persistent, ASO-indued redution in PrP C expression ws oserved in periventriulr regions s well s the hippompus nd ereellum. Delyed infusion of ASO. To ssess the effetiveness of ASOs in mie with n estlished prion infetion, we egn infusing ASO t 6 dpi. At this point in the inution period, FVB mie remin symptomti ut their rins show PrP S umultion s well s initil hnges of stroyti gliosis. 11 Beginning 6 dys fter intrererl inoultion with RML prions, the FVB mie reeived either 75 μg/dy of ASO (n = 24) or (n = 8) y ICV. While 75 μg/dy of ASO ws well-tolerted in uninfeted FVB mie for 14 dys, this dose ws toxi in prion-infeted mie, whih hd to e killed fter 11 dys. The toxiity of ASO ppers to e relted to the stge of prion disese euse similr ICV infusion strted 1 dpi ws well-tolerted (ompre Figures 6 nd 7). This illness ws likely unrelted to prion disese. Tht the illness oserved in prion-infeted FVB mie t 11 dys fter ICV infusion ws relted to ASO is supported y the well-tolerted injetion of in ontrol, infeted mie tht survived for 2 months following dys of ICV infusion nd developed signs of srpie t 131 ± 1 dys (n = 4). The rins of ICV-infused mie were tken t 71 dpi nd exmined y immunohistohemistry to detet vuoltion nd PrP S plque deposition (Figure 7) s well s y histolotting in order to mesure PrP C nd PrP S (Figure 7,d). In mie reeiving, PrP S deposition ws widely distriuted Moleulr Therpy Nulei Aids

7 ASO Infusion in Prion-infeted Mie 7 Dy RML y + 1 d e Figure 5 ASO redued PrP C expression nd interfered with PrP S deposition in prion-infeted FVB mie. () Experimentl design. On dy, FVB mie were inoulted with RML prions on the right side of the rin. At dy 1, ASO, ASO 923, or ws delivered ICV t 75 μg/dy for 14 dys on the left side of the rin. Mie were killed t dy 5 dpi, rin setions tken nd nlyzed for PrP C nd PrP S levels. (,) Histolot nlysis ws performed on 1-μm setions t the level of the septum, hippompus, midrin 1 nd 2 regions, nd stined with the D18 ntiody. Setions were left undigested to visulize totl PrP levels s shown in or sujeted to GdnHCl denturtion nd PK digestion to visulize PrP S levels s shown in. (d) Western lots show totl PrP (top) nd PrP S (ottom); eh lot shows two different ASO-treted nimls. (e) Densitometry of western lots using NIH Imge J softwre, then expressed reltive to PrP levels in the rins of mie treted with. Protein stndrds shown re 36, 3, nd 22 kd. ASO, ntisense oligonuleotide; ICV, intrererl ventriulr;, phosphte-uffered sline; PrP C, ellulr prion protein; PrP S, disese-using prion protein. on oth sides of the rin while those treted with ASO exhiited onsiderly less PrP S. Notly, muh of the PrP S remining fter ASO infusion ws found in plque-like deposits long the orpus llosum (Figure 7). Histolots prepred from rins of ASO treted mie showed ilterl redutions of PrP C in the septum, hippompus, nd midrin 1 region, leit with greter suppression on the nnulted, left side (Figure 7). PrP S levels were lso redued ilterlly in the hippompus, sustnti nigr, ventrl hippompus, ererl ortex, midrin, nd rin stem fter tretment with ASO (Figure 7d). PrP S ws lered from the thlmus, mygdl, nd udte nuleus on the nnulted, left side, ut persisted in the orpus llosum nd the thlmus on the ontrlterl right side. The ontrol FVB mie reeiving the infusion nd killed t 71 dpi showed PrP C nd PrP S deposits throughout their rins. Disussion The dul tion of ASO (i) speifi degrdtion of Prnp mrna nd (ii) nonspeifi redution of PrP S omplites ny interprettion of the studies desried here. The PrP-speifi ASO suppressed PrP C expression y inding to Prnp mrna nd rendering these trnsripts suseptile to digestion y RNse H. 1 Independent of the ASO sequene, these PS-DNA oligonuleotides redued PrP S levels, s previously reported for SN2 ells. 5,6 The mehnism y whih ASOs diminish PrP S remins to e determined; it is unler whether ASOs exert their ntiprion tion y inhiiting nsent PrP S formtion or elerting PrP S lerne. In SN2 ells, the EC 5 vlue for ASO in lowering PrP C levels ws 5 nmol/l nd in reduing PrP S levels ws 4 nmol/l. In erlier studies, the EC 5 vlue for CpG PS-DNA 22mer ws 4, nmol/l for lowering PrP C

8 ASO Infusion in Prion-infeted Mie 8 Dy ICV infusion!ge OTHER MICE for SURvivl Killing Inoulte RML s Rion disese mouse model s Mg/dy s!3/ OR "3!SYMPTOMATIC ANIMALS ) "3!3/ "3 d "3 #EREBELLUM -IDBRAIN (IPPOCAMPUS 3EPTUM 4IME FROM INOCULATION DAys) Figure 6 Tretment with ASO redued PrPS in the rin nd extended inution periods y 42%. () Experimentl design. On dy, FVB mie were inoulted with RML prions on the right side of the rin. At dy 1, either ASO or ws delivered ICV t 75 μg/dy for 14 dys on the left side of the rin. At dy 126, some mie were killed, nd their rins nlyzed for PrPC nd PrPS. () Survivl urves of FVB mie treted with (lk) or ASO (gry). (,d) Mie were killed t 126 dpi, their rins nlyzed y histolotting for () totl PrP nd (d) PrPS. Setions were left undigested s shown in or sujeted to GdnHCl denturtion nd PK digestion s shown in d. Memrnes were stined with the D18 ntiody. ASO, ntisense oligonuleotide;, phosphte-uffered sline; PrPS, disese-using prion protein. nd ws 7 nmol/l for reduing PrPS.6 This 22mer ws not seleted for its Prnp mrna-lowering tivity ut rther for its ility to prolong the inution times of mie inoulted ip with RML prions.12 While only sequene-speifi ASOs trgeting mouse Prnp redued PrPC levels, oth sequene-speifi ASOs nd srmled ASO 923 lered PrPS in SN2 ells (Figure 2). Dose-response experiments in SN2 ells reveled tht slightly higher onentrtions of ASO 923 were required to redue PrPS levels ompred to those found with Moleulr Therpy Nulei Aids sequene-speifi ASO (Figure 2d). In ddition, longer tretment periods with ASO 923 were required to hieve the sme level of knokdown s ASO (Figure 2). A similr sequene-independent redution in PrPS levels ws oserved in vivo (Figure 5d,e). Together, the results suggest tht PrP-trgeted, PS-modified ASOs n redue rin prion levels y two independent mehnisms: redution of Prnp mrna nd diminution of PrPS. The in vivo studies with ASOs reported here rgue tht the redution in PrPS ws greter thn the diminution in PrPC; however, we nnot dedue

9 ASO Infusion in Prion-infeted Mie 9 RML 6 y n PrP S levels were redued y 95% when mesured 36 dys fter removl of the nnul (Figure 5e). Although ASO dministrtion signifintly impeded PrP S replition nd extended survivl times y lmost 2 months, it did not eliminte PrP S nd the mie eventully suumed to prion disese (Figure 6). Interestingly, t 112 dys fter removl of the nnul, redued levels of PrP C nd PrP S persisted, ontending tht ASO ws still present t suffiiently high onentrtions to e iologilly tive (Figure 6,d). + Figure 7 Tretment with ASO t the midpoint of disese reversed PrP S deposition ut used typil illness. () Experimentl design. On dy, FVB mie were inoulted with RML prions. Beginning t 6 dpi, ASO ws delivered vi ICV t 75 μg/dy for 11 dys, when they developed typil illness. Mie were killed t 71 dpi nd their rins nlyzed for () PrP C nd (,d) PrP S. () Immunohistohemistry for PrP S ws performed on formlin-fixed, prffin-emedded tissue setions through the hippompus y the hydrolyti utolving method nd with ref HuM-P. (,d) Histolots indite tht oth PrP C nd PrP S were redued following dministrtion of ASO. Redution of PrP C ppered more prominent on the nnultion side, wheres PrP S depletion ourred ilterlly. Setions were left undigested to visulize totl PrP levels s shown in or sujeted to GdnHCl denturtion nd PK digestion to visulize PrP S levels s shown in d, then stined with the D18 ntiody. Br in represents 5 μm nd pplies to ll the imges in the pnel. ASO, ntisense oligonuleotide;, orpus ollosum; hp, hippompus; ICV, intrererl ventriulr; n, neoortex;, phosphte-uffered sline; PrP C, ellulr prion protein; PrP S, disese-using prion protein. from our dt the reltive ontriution of PrP C suppression to reduing the level of PrP S. The long tissue hlf-life of the ASOs (2 4 dys in vivo) (ISIS unpulished dt) nd their ility to suppress PrP C nd PrP S expression for more thn 1 dys following nnul removl re noteworthy. When ASO ws dministered immeditely following prion inoultion for 14 dys, d Intrventriulr infusion of ASOs. ASOs dispensed diretly into the ventriulr system vi the CSF of the lterl ventrile hve een previously reported to e n effetive wy to hieve widespred delivery throughout the rin nd penetrte the neurl tissue of rodents, dogs, nd non-humn primtes. 13 Approximtely hlf of the nnulted FVB mie died shortly fter surgery mny of these deths were due to hippompl lesions resulting from identl intrprenhyml theter implnttion. These mie were exluded from the study s well s the inution time lultions. Those rin regions ner the tip of the nnul were exposed to the highest levels of ASO, nd redutions in PrP C nd PrP S ourred up to distnes of 5.88 mm Bregm. ICV injetion of ASO through nnul on the left side of the rin produed greter redutions of PrP S thn PrP C on the ontrlterl, right side where the prions were inoulted into the thlmus (Figure 6,d). The greter redution in PrP S levels ompred to PrP C is redily explined y the sequene-independent, ASO-medited diminution in PrP S demonstrted in ultured ells (Figure 2d). Our findings re onsistent with results from n erlier study reported y one of us (S.B.P.) where PS-DNA (22mers) ontining methylted CpG motif (non-immune retive) nd srmled CpG motifs eqully diminished PrP S levels in SN2 ells, inditing sequene-independent redution of PrP S. 6 The EC 5 vlues for these 22mers were 5 μmol/l for PrP C nd 7 nmol/l for PrP S. Biossys with treted ell extrts demonstrted tht the prion titers were redued in the PS-DNA treted SN2 ells. In the work presented here, the EC 5 vlue of the sequenespeifi ASO ws 1-fold lower for PrP C (5 nmol/l) redution thn previously reported for the CpG motif 22mers (5 μmol/l). In ddition, we did not oserve signifint redution of PrP C with the srmled ASO 923, rguing tht the PrP C redution we oserved with ASO resulted from degrdtion of the Prnp trnsripts. In nother study, series of rndom-sequene, singlestrnded PS-DNA 4mers ws dded to SN2 ells, resulting in diminished levels of PrP S. 5 When Tg(SHPrP)7 mie were given dily ip doses of one rndom-sequene PS-DNAs eginning 3 dys efore ip inoultion with SH prions, the inution times were prolonged from 88 to 33 dys. After prion inoultion, the Tg7 mie reeived ip injetions of the rndom-sequene PS-DNAs three times per week for 4 weeks. Sine PS-DNAs dministered ip did not trverse the lood-rin rrier, it is likely tht the prolongtion of inution periods reported in these studies ws due to systemi degrdtion of PrP S outside of the CNS. In the study desried here, we intrererlly inoulted RML prions into the right thlmus nd 1 dy lter inserted

10 1 ASO Infusion in Prion-infeted Mie nnul on the left side of the rin, through whih we infused ASO for 14 dys. This ASO tretment protool inresed the inution time from 136 to 193 dys (Figure 6). In the ASO treted mie tht were killed t 126 dpi, the PrP S levels were redued throughout the rin ompred to the untreted ontrols, exept in the right thlmus where oth ontrol nd treted mie hd een inoulted. It is instrutive to ompre the prolongtion of the inution time y ICV infusion of ASO treted mie with tht of Prnp +/ mie where PrP C levels were redued ~5%. In oth ses, the mie hd diminished PrP C from very erly in the inution period. In studies y one of us (S.B.P.), Prnp +/ /FVB mie inoulted with RML prions developed CNS dysfuntion etween 4 nd 465 dys fter intrererl inoultion ompred to wt mie exhiiting neurologi signs t 146 dys. 14 In nother study, Prnp +/ mie developed CNS dysfuntion etween 26 nd 35 dys fter reeiving RML prions i. 15 Reently, third study using the sme gene knokout showed signs of neurologil disese etween 24 nd 3 dys fter intrererl inoultion of RML prions. 16 In the third study, prion titers were mesured in the rins of Prnp +/ mie using endpoint titrtions in ultured ells. At 1 dys fter intrererl inoultion, the rin titers were found to reh mximum ut more thn nother 15 dys pssed efore signs of rin dysfuntion were oserved. The uthors rgued tht n isoform other thn PrP S is neurotoxi nd tht this lterntive form indues linil signs. Whether infusions of ASOs n help deipher the moleulr pthogenesis of prion disese is unknown t present. Conluding remrks. The sequene-independent inhiition of PrP S formtion omplited the interprettion of our findings using ASO. Delying the infusion of ASOs until 6 dys fter inoultion resulted in mny ute deths (Figure 7), whih prevented us from mesuring the ntiprion effet of these PS-modified oligonuleotides. We were lso unle to lower sustntilly the PrP C levels throughout the rin fter ICV infusion of ASO ; whether this pproh n e modified into n effetive therpeuti regimen remins to e determined. Mterils nd methods ASO synthesis. Twelve oligonuleotides orresponding to regions within the 3 UTR were synthesized nd purified s previously desried. 17 Oligonuleotides were PS-modified, himeri oligonuleotides omposed of five 2-O-(2-methoxy) ethyl modifitions on oth the 5 nd 3 ends, nd 1 oligodeoxynuleotides in the enter to support RNse H tivity. 18 Oligonuleotide sequenes were s follows: ASO (TATATTCTTATTGGCCCGGT), ASO (GCCTATGCTAAG- TTACATGT), nd ASO (CCAAGGGTCACACGGTAAGC). ASO 923 (CCTTCCCTGAAGGTTCCTCC) ws used s ontrol oligonuleotide euse it shres identil hemistry nd length to the PrP-trgeted ASOs, is not predited to hyridize to ny known humn or rt genes, nd ws previously shown not to hve detetle effets in tissue ulture or in mouse models. 19 Quntittive RT-PCR. Totl RNA ws isolted using n RNesy Mini prep kit (QIAGEN, Vleni, CA) ording to the mnufturer s protool. We omined 5 1 ng totl RNA with 1 nmol/l of eh of the gene-speifi, dul-leled proes, nd forwrd nd reverse primers in uffered solution onsisting of 1 TqMn Buffer A (Applied Biosystems, Foster City, CA), 5.5 mmol/l MgCl 2, 2 mmol/l onentrtions of eh dntp (Amershm Biosienes, Pistwy, NJ), 2 U RNse inhiitor,.625 U AmpliTq Gold, nd 6.25 U murine leukemi virus reverse trnsriptse. Exept for dntp solutions, ll regents ove were otined from Applied Biosystems. Quntittive RT-PCR retions were onduted nd nlyzed on n ABI Prism 77 Sequene Detetor (Applied Biosystems). Glyerldehyde 3-phosphte dehydrogense mrna levels were used s n internl referene for normliztion mong smples. Primer proe set sequenes for PrP were: forwrd, 5-TCTGTGTCCCCCATAGGCTAA-3; reverse, 5-AGAGCAACTGGTCTACTGTACATTTCC-3; proe, 5-CC CCTGGCACTGATGGGCCC-3. Cell ulture. For.END, N2 nd GT1 lines, ells were grown in 6-m dishes in miniml essentil medium until ttining 9 95% onfluene. Cells were trypsinized nd diluted tenfold into 6-mm pltes ontining 4 ml of miniml essentil medium. On the following dy, ASOs were dded to the ells t vrious onentrtions in their norml growth medi nd inuted for vrile periods of time. For.END ells, ells were wshed one with nd were trnsfeted using the lipofetmine trnsfetion regent (Invitrogen, Crlsd, CA) using 3 μl lipofetin/1 ml Optimem/1 nmol/l ASO. The trnsfetion mix ws removed fter 4 hours nd repled with norml growth medi. All inutions were performed t 37 C. Cells were hrvested in.5 ml old lysis uffer (1 mmol/l Tris-HCl, ph 8; 1 mmol/l NCl;.5% NP-4; nd.5% deoxyholte). RNA ws hrvested t different time points; for.end ells, RNA ws hrvested 24 hours fter trnsfetion. Stok.END nd N2 ells were mintined in miniml essentil medium. The ells were hrvested using 4 ml of.5% trypsin nd plted in 1:2 dilution, fed on dy 4, nd trypsinized gin in 1:3 dilution onto 1-m pltes on dy 6. All medi were supplemented with 1% fetl ovine serum, 2 mmol/l Glutmx (GIBCO BRL, Crlsd, CA), 1 units/ ml peniillin, nd 1 units/ml streptomyin in humidified 37 C inutor with 5% CO 2. Immunolotting. Confluent 6-m dimeter pltes (~4 1 6 ells) were wshed in nd then lysed y the ddition of 5 μl of lysis uffer. The nuler pellet ws removed, nd the protein onentrtion ws determined y iinhonini id ssy s reommended y the mnufturer (Piere, Rokford, IL). Proteinse K ws dded (1:5, PK:totl protein), nd the lyste ws inuted t 37 C for 1 hour. The retion ws stopped y the ddition of 2 mmol/l phenylmethnesulfonylfluoride. Insolule mteril ws preipitted y ultrentrifugtion t 48,g for 1 hour t 4 C. The pellet ws resuspended in loding uffer, oiled for 5 minutes, then run on 15% Tris HCl gel for western lot nlysis y using D18 s the detetion ntiody. Cpture enzymelinked immunosorent ssys with D18 were performed s previously desried. 2 Moleulr Therpy Nulei Aids

11 ASO Infusion in Prion-infeted Mie 11 Quntifition of PrP C levels. PrP C nd PrP S levels were quntified y either enzyme-linked immunosorent ssy or performing densitometry of snned western lots films using NIH Imge J softwre nd expressed s perentges reltive to tht mesured in ells treted with. Inoultion nd niml studies. All niml protools were pproved y the University of Cliforni Sn Frniso Institutionl Animl Cre nd Use Committee nd met ethil stndrds for niml experimenttion. Ip inoultions were performed in the domen. For therpeuti studies, FVB mie were nesthetized with isoflurne, then inoulted with 3 μl of mouse-dpted RML prions. Inoul were injeted diretly into the right thlmus. Mie were monitored thrie weekly. When they showed signs of prion disese, mie were euthnized. Brin nnultion nd Alzet pump insertion in the suutneous poket were performed on nesthetized nimls. Surgil plement of osmoti pumps nd hrvesting tissues for nlysis. FVB mie weighing t lest 2 g were pled in hmer for the indution of nesthesi using 3 5% isoflurne in n ir mixture. The niml ws pled in stereotxi pprtus (Kopf 942, two-hnnel digitl smll niml stereotx; Dvid Kopf Instruments, Tujung, CA); surgil plne of nesthesi ws mintined with 2.5% isoflurne y nose one fitted to the stereotxi instrument. A m midline inision ws mde in the slp from the posterior of the oipitl plte to the line onneting the eyes. A suutneous poket mesuring 5 6 m deep ws mde with lunt dissetion posterior from the inision over the left flnk. The preloded Alzet 22 pump with tuing tthed to the infusion nnul ws inserted pump-first into the suutneous poket, leving the nnul outside of the inision. The top t of the infusion nnul ws pled in nnul-holding pprtus (Plstis One, Ronoke, VA). The tuing of the nnul ws ligned with the hole in the skull nd dvned into the hole until the se ws ginst the skull. The inision ws losed y sutures. Histolot. Histolotting ws performed s desried previously. 21 Coronl ryosetions of 1-μm thikness were olleted t the level of the septum (Bregm mm). For prion-infeted FVB mie, dditionl ryosetions were tken from the hippompus (Bregm 1.64 mm), midrin 1 (Bregm 2.92 mm), midrin 2 (Bregm 4.2 mm), pons (Bregm 5.46 mm), nd ereellum (Bregm 5.88 mm). Setions were pled on glss slides, then trnsferred to nitroellulose memrnes tht were wetted in lysis uffer. Nitroellulose strips were immersed in 1 mmol/l NOH solution, inuted for 1 hour t room temperture, rinsed in tris-uffered sline nd Tween-2 (TBST), immersed gin in 1 mmol/l NOH solution, inuted for 1 hour t room temperture, rinsed in TBST, then immersed in 3 mol/l gunidine isothioynte solution for 1 minutes t room temperture, nd rinsed in TBST. Strips were loked in 5% nonft milk (mde in TBST) for 3 minutes t room temperture, stined with the nti-prp reominnt ntiody D18 followed y lkline phosphtse onjugted, got nti-humn seondry ntiody nd detetion with 5-romo-4-hloro-3-indolyl-phosphte/nitro lue tetrzolium (BCIP/NBT). Neuropthology. Brins were removed rpidly from euthnized nimls nd either immersion-fixed in 1% uffered formlin or frozen on dry ie for neuropthologil nlysis. For evlution of neurodegenertion, prffin-emedded rins setions (8 μm) were stined with hemtoxylin nd eosin. For immunohistohemistry, PrP S ws deteted on formlin-fixed, prffin-emedded tissue setions y the hydrolyti utolving method nd with ref HuM-P ginst PrP. 22 For evlution of retive stroyti gliosis, we used rit ntiserum to glil firillry idi protein (Dko, Crpinteri, CA) with peroxidse immunohistohemistry. 23 Aknowledgments. This work ws supported y grnts from the Ntionl Institutes of Helth (AG3122, AG177, nd AG2161) s well s y gifts from the Shermn Firhild Foundtion, Shott Foundtion for Puli Edution, nd Rinwter Chritle Foundtion. The uthors thnk the stff t the Hunters Point niml fility. 1. Tilly, G, Chpuis, J, Vilette, D, Lude, H nd Vilotte, JL (23). Effiient nd speifi down-regultion of prion protein expression y RNAi. Biohem Biophys Res Commun 35: Dude, N, Mrell, M nd Chry, J (23). Speifi inhiition of pthologil prion protein umultion y smll interfering RNAs. J Cell Si 116(Pt 13): Pfeifer, A, Eigenrod, S, Al-Khdr, S, Hofmnn, A, Mitteregger, G, Moser, M et l. (26). Lentivetor-medited RNAi effiiently suppresses prion protein nd prolongs survivl of srpie-infeted mie. J Clin Invest 116: White, MD, Frmer, M, Mirile, I, Brndner, S, Collinge, J nd Mllui, GR (28). Single tretment with RNAi ginst prion protein resues erly neuronl dysfuntion nd prolongs survivl in mie with prion disese. Pro Ntl Ad Si USA 15: Koisko, DA, Villnt, A, Lee, KS, Arnold, KM, Bertholet, N, Re, RE et l. (26). Potent ntisrpie tivities of degenerte phosphorothiote oligonuleotides. Antimiro Agents Chemother 5: Krpuj, MV, Giles, K, Geliter-Niv, S, Sott, MR, Lingpp, VR, Szok, FC et l. (27). Phosphorothiote oligonuleotides redue PrP levels nd prion infetivity in ultured ells. Mol Med 13: Mllui, G, Dikinson, A, Linehn, J, Klöhn, PC, Brndner, S nd Collinge, J (23). Depleting neuronl PrP in prion infetion prevents disese nd reverses spongiosis. Siene 32: Sfr, JG, DeArmond, SJ, Koiu, K, Deering, C, Didorenko, S, Bouzmondo-Bernstein, E et l. (25). Prion lerne in igeni mie. J Gen Virol 86(Pt 1): Bennett, CF nd Swyze, EE (21). RNA trgeting therpeutis: moleulr mehnisms of ntisense oligonuleotides s therpeuti pltform. Annu Rev Phrmol Toxiol 5: Wu, H, Lim, WF, Zhng, H, Fn, A, Sun, H nd Crooke, ST (24). Determintion of the role of the humn RNse H1 in the phrmology of DNA-like ntisense drugs. J Biol Chem 279: Tmgüney, G, Frnis, KP, Giles, K, Lemus, A, DeArmond, SJ nd Prusiner, SB (29). Mesuring prions y ioluminesene imging. Pro Ntl Ad Si USA 16: Sethi, S, Lipford, G, Wgner, H nd Kretzshmr, H (22). Postexposure prophylxis ginst prion disese with stimultor of innte immunity. Lnet 36: Smith, RA, Miller, TM, Ymnk, K, Moni, BP, Condon, TP, Hung, G et l. (26). Antisense oligonuleotide therpy for neurodegenertive disese. J Clin Invest 116: Prusiner, SB, Groth, D, Sern, A, Koehler, R, Foster, D, Torhi, M et l. (1993). Altion of the prion protein (PrP) gene in mie prevents srpie nd filittes prodution of nti-prp ntiodies. Pro Ntl Ad Si USA 9: Büeler, H, Reer, A, Siler, A, Fisher, M, Aguzzi, A nd Weissmnn, C (1994). High prion nd PrP S levels ut delyed onset of disese in srpie-inoulted mie heterozygous for disrupted PrP gene. Mol Med 1: Snderg, MK, Al-Doujily, H, Shrps, B, Clrke, AR nd Collinge, J (211). Prion propgtion nd toxiity in vivo our in two distint mehnisti phses. Nture 47: Cheruvllth, ZS, Cole, DL nd Rvikumr, VT (23). A novel solid support for synthesis of oligonuleotide 3 -phosphorothiote monoesters. Bioorg Med Chem Lett 13:

12 12 ASO Infusion in Prion-infeted Mie 18. MKy, RA, Mirgli, LJ, Cummins, LL, Owens, SR, Ssmor, H nd Den, NM (1999). Chrteriztion of potent nd speifi lss of ntisense oligonuleotide inhiitor of humn protein kinse C-lph expression. J Biol Chem 274: Drygin, D, Brone, S nd Bennett, CF (24). Sequene-dependent ytotoxiity of seondgenertion oligonuleotides. Nulei Aids Res 32: Ghemmghmi, S, Phun, PW, Perkins, B, Ullmn, J, My, BC, Cohen, FE et l. (27). Cell division modultes prion umultion in ultured ells. Pro Ntl Ad Si USA 14: Troulos, A, Jendrosk, K, Sern, D, Yng, S-L, DeArmond, SJ nd Prusiner, SB (1992). Regionl mpping of prion proteins in rins. Pro Ntl Ad Si USA 89: Murmoto, T, Kitmoto, T, Tteishi, J nd Goto, I (1992). The sequentil development of norml prion protein umultion in mie with Creutzfeldt-Jko disese. Am J Pthol 14: Murmoto, T, DeArmond, SJ, Sott, M, Telling, GC, Cohen, FE nd Prusiner, SB (1997). Heritle disorder resemling neuronl storge disese in mie expressing prion protein with deletion of n lph-helix. Nt Med 3: Moleulr Therpy: Nulei Aids is n open-ess journl pulished y Nture Pulishing Group. This work is liensed under the Cretive Commons Attriution-Nonommeril-No Derivtive Works 3. Unported Liense.To view opy of this liense, visit Supplementry Informtion ompnies this pper on the Moleulr Therpy Nulei Aids wesite ( Moleulr Therpy Nulei Aids