Supplemental Table 1 - Complete set of genes differentially expressed > 2-fold among strains in E11.5 XY gonads.

Size: px
Start display at page:

Download "Supplemental Table 1 - Complete set of genes differentially expressed > 2-fold among strains in E11.5 XY gonads."

Transcription

1 Supplemental Table 1 - Complete set of genes differentially expressed > 2-fold among strains in E11.5 XY gonads. Genes differentially expressed between C57BL/6J (B6) and 129S1/SvImJ (129). Note: Positive fold values reflect genes that are up regulated in C57BL/6J (B6) relative to 129S1/SvImJ (129). Fold Diff Gene symbol Genbank Acc Description Cd226 NM_ Mus musculus CD226 antigen (Cd226), transcript variant 1, mrna [NM_178687] G22Rik AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: g22 product:riken cdna G22 gene, full insert sequence. [AK016320] Trim12 BC Mus musculus tripartite motif protein 12, mrna (cdna clone MGC: IMAGE: ), complete cds. [BC094899] Ifi44 AK Mus musculus 0 day neonate kidney cdna, RIKEN full-length enriched library, clone:d630022o22 product:inferred: microtubule associated protein 44 {Mus musculus}, full insert sequence [AK085407] Il15 NM_ Mus musculus interleukin 15 (Il15), mrna [NM_008357] AK AK Mus musculus 15 days embryo male testis cdna, RIKEN full-length enriched library, clone: m19 product:unclassifiable, full insert sequence. [AK033168] Abcb1a NM_ Mus musculus ATP-binding cassette, sub-family B (MDR/TAP), member 1A (Abcb1a), mrna [NM_011076] N12Rik AK Mus musculus 6 days neonate head cdna, RIKEN full-length enriched library, clone: n12 product:unclassifiable, full insert sequence [AK017277] BC BC Mus musculus mrna similar to RIKEN cdna P18 gene (cdna clone MGC:28336 IMAGE: ), complete cds. [BC020150] E23Rik AK Mus musculus 3 days neonate thymus cdna, RIKEN full-length enriched library, clone:a630088n05 product:hypothetical Haem peroxidase, plant/fungal/bacterial containing protein, full insert sequence. [AK153779] Cc2d1b AK Mus musculus 13 days embryo forelimb cdna, RIKEN full-length enriched library, clone: a19 product:unclassifiable, full insert sequence. [AK031067] N17Rik AK Mus musculus NOD-derived CD11c +ve dendritic cells cdna, RIKEN full-length enriched library, clone:f630118j04 product:hypothetical Gram-positive cocci surface protein 'anchoring' hexapeptide/c-type lectin domain containing protein homolog [Mus AK AK Mus musculus 16 days neonate cerebellum cdna, RIKEN full-length enriched library, clone: e20 product:unclassifiable, full insert sequence. [AK035950] H15Rik NM_ Mus musculus RIKEN cdna H15 gene ( H15Rik), mrna [NM_028671] Trim16 NM_ Mus musculus tripartite motif protein 16 (Trim16), mrna [NM_053169] A930037O16Rik AK Mus musculus adult male corpora quadrigemina cdna, RIKEN full-length enriched library, clone:b230325o03 product:unclassifiable, full insert sequence. [AK080826] AA AA AA mm44g12.r1 Stratagene mouse melanoma (#937312) Mus musculus cdna clone IMAGE: ' similar to gb:d49382 Mouse Nedd5 mrna for DIFF6- or CDC3,10,11,12-like protein (MOUSE);, mrna sequence [AA067948] Prim2 NM_ Mus musculus DNA primase, p58 subunit (Prim2), mrna [NM_008922] AK AK Mus musculus 13 days embryo lung cdna, RIKEN full-length enriched library, clone:d430019n09 product:unclassifiable, full insert sequence. [AK084963] Zfyve26 AK Mus musculus 15 days embryo head cdna, RIKEN full-length enriched library, clone: b02 product:hypothetical arginine-rich region containing protein, full insert sequence. [AK132344] Psg23 NM_ Mus musculus pregnancy-specific glycoprotein 23 (Psg23), mrna [NM_020261] E2f6 AK Mus musculus 12 days embryo embryonic body between diaphragm region and neck cdna, RIKEN full-length enriched library, clone: e10 product:e2f transcription factor 6, full insert sequence. [AK035116] H21Rik BY BY RIKEN full-length enriched, adult male testis Mus musculus cdna clone H21 5'. [BY706809] Dtprp NM_ Mus musculus decidual/trophoblast prolactin-related protein (Dtprp), mrna [NM_010088] Svep1 AK Mus musculus adult male urinary bladder cdna, RIKEN full-length enriched library, clone: i21 product:polydomain protein, full insert sequence. [AK035333] E06Rik NM_ Mus musculus RIKEN cdna E06 gene ( E06Rik), mrna [NM_027600] A630033E08Rik BC Mus musculus RIKEN cdna A630033E08 gene, mrna (cdna clone MGC:90801 IMAGE: ), complete cds. [BC078460] J02Rik AK Mus musculus adult male thymus cdna, RIKEN full-length enriched library, clone: j17 product:unclassifiable, full insert sequence. [AK030876] TC TC Q8K0H2 (Q8K0H2) Chpt1 protein, partial (18%) [TC ] Fgl1 NM_ Mus musculus fibrinogen-like protein 1 (Fgl1), mrna [NM_145594] BC BC Mus musculus mrna similar to RIKEN cdna P18 gene (cdna clone MGC:28336 IMAGE: ), complete cds. [BC020150] M13Rik XM_ PREDICTED: Mus musculus RIKEN cdna M13 gene, transcript variant 1 ( M13Rik), mrna [XM_ ] Slc7a2 NM_ Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 (Slc7a2), mrna [NM_007514] NAP NAP Unknown Slco1a1 AY Mus musculus strain CAST [AY195869] Gcnt1 NM_ Mus musculus glucosaminyl (N-acetyl) transferase 1, core 2 (Gcnt1), mrna [NM_173442] Scfd1 AK Mus musculus 0 day neonate thymus cdna, RIKEN full-length enriched library, clone:a430027g07 product:unclassifiable, full insert sequence. [AK039908] AK AK Mus musculus 10 days neonate cortex cdna, RIKEN full-length enriched library, clone:a830023f09 product:unclassifiable, full insert sequence. [AK043715] Gng13 NM_ Mus musculus guanine nucleotide binding protein 13, gamma (Gng13), mrna [NM_022422] Klra10 NM_ Mus musculus killer cell lectin-like receptor subfamily A, member 10 (Klra10), mrna [NM_008459] 9.47 AK AK Mus musculus adult male corpora quadrigemina cdna, RIKEN full-length enriched library, clone:b230209n23 product:unclassifiable, full insert sequence. [AK045549] 9.45 Muc10 NM_ Mus musculus mucin 10, submandibular gland salivary mucin (Muc10), mrna [NM_008644] 9.06 TC TC R6RT43 ribosomal protein L29, cytosolic [validated] - rat {Rattus norvegicus;}, partial (87%) [TC ] 9.05 D830026I12Rik AK Mus musculus 16 days embryo head cdna, RIKEN full-length enriched library, clone:c130090d04 product:unclassifiable, full insert sequence. [AK081964] 9.01 AK AK Mus musculus adult male pituitary gland cdna, RIKEN full-length enriched library, clone: m15 product:unclassifiable, full insert sequence. [AK030581] 8.88 Mill1 NM_ Mus musculus MHC I like leukocyte 1 (Mill1), mrna [NM_153749] 8.79 A030004J04Rik NM_ Mus musculus RIKEN cdna A030004J04 gene (A030004J04Rik), mrna [NM_175424] 8.76 Ppcdc NM_ Mus musculus phosphopantothenoylcysteine decarboxylase (Ppcdc), mrna [NM_176831] 8.67 Kctd14 NM_ Mus musculus potassium channel tetramerisation domain containing 14 (Kctd14), mrna [NM_ ] 8.65 Oasl2 NM_ Mus musculus 2'-5' oligoadenylate synthetase-like 2 (Oasl2), mrna [NM_011854] 8.56 LOC XM_ PREDICTED: Mus musculus hypothetical LOC (LOC621121), mrna [XM_885498] 8.37 Aff3 NM_ Mus musculus AF4/FMR2 family, member 3 (Aff3), mrna [NM_010678] 8.07 LOC XM_ PREDICTED: Mus musculus similar to Spetex-2E protein (LOC673273), mrna [XM_ ] 8.03 Zfp74 AK Mus musculus ES cells cdna, RIKEN full-length enriched library, clone:c330018m05 product:similar to ZFP66P (FRAGMENT) [Mus musculus], full insert sequence. [AK049278] 7.94 Trim12 NM_ Mus musculus tripartite motif protein 12 (Trim12), mrna [NM_023835] B09Rik AK Mus musculus 12 days embryo embryonic body between diaphragm region and neck cdna, RIKEN full-length enriched library, clone: b09 product:unclassifiable, full insert sequence. [AK020441]

2 7.77 Ppp1r2 NM_ Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 2 (Ppp1r2), mrna [NM_025800] 7.74 ENSMUST ENSMUST Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: n21 product:cp431 (FRAGMENT) homolog [Rattus norvegicus], full insert sequence. [AK030254] 7.69 C330019L16Rik AK Mus musculus ES cells cdna, RIKEN full-length enriched library, clone:c330019l16 product:hypothetical protein, full insert sequence [AK049289] 7.61 BC BC ENSMUST [BC013672] 7.55 Ifi44 NM_ Mus musculus interferon-induced protein 44 (Ifi44), mrna [NM_133871] 7.52 Ereg NM_ Mus musculus epiregulin (Ereg), mrna [NM_007950] 7.41 Pggt1b AK Mus musculus 0 day neonate lung cdna, RIKEN full-length enriched library, clone:e030026l18 product:unclassifiable, full insert sequence. [AK087098] 7.36 Tbc1d4 AK Mus musculus 7 days neonate cerebellum cdna, RIKEN full-length enriched library, clone:a730045a14 product:unclassifiable, full insert sequence. [AK042979] 7.23 Fkbp9 NM_ Mus musculus FK506 binding protein 9 (Fkbp9), mrna [NM_012056] 7.08 Mid1 AY Mus musculus clone MEX2B-9 Mid1 mrna, partial sequence. [AY540038] J01Rik NM_ Mus musculus RIKEN cdna J01 gene ( J01Rik), mrna [NM_029101] 7.00 Rec8L1 NM_ Mus musculus REC8-like 1 (yeast) (Rec8L1), mrna [NM_020002] 6.87 ENSMUST ENSMUST PREDICTED: Mus musculus gene model 378, (NCBI) (LOC213454), mrna [XM_142049] 6.80 AK AK Mus musculus 3 days neonate thymus cdna, RIKEN full-length enriched library, clone:a630054f14 product:unclassifiable, full insert sequence. [AK042046] 6.74 Pdgfd BC Mus musculus platelet-derived growth factor, D polypeptide, mrna (cdna clone MGC:31518 IMAGE: ), complete cds. [BC030896] L04Rik AK Mus musculus adult male aorta and vein cdna, RIKEN full-length enriched library, clone:a530045m11 product:weakly similar to KIAA1751 PROTEIN (FRAGMENT) [Homo sapiens], full insert sequence. [AK040922] 6.67 Kcnc1 NM_ Mus musculus potassium voltage gated channel, Shaw-related subfamily, member 1 (Kcnc1), mrna [NM_008421] 6.46 AK AK Mus musculus 16 days neonate thymus cdna, RIKEN full-length enriched library, clone:a130006j09 product:neprilysin-like PEPTIDASE GAMMA homolog [Mus musculus], full insert sequence. [AK037317] 6.46 LOC XM_ PREDICTED: Mus musculus similar to Ig heavy chain V-I region HG3 precursor (LOC641008), mrna [XM_918291] 6.44 Nox1 NM_ Mus musculus NADPH oxidase 1 (Nox1), mrna [NM_172203] 6.41 Usp53 BC Mus musculus ubiquitin specific peptidase 53, mrna (cdna clone IMAGE: ), partial cds [BC022221] 6.37 AK AK Mus musculus 0 day neonate cerebellum cdna, RIKEN full-length enriched library, clone:c230053p15 product:unclassifiable, full insert sequence. [AK082480] L03Rik AK Mus musculus adult male diencephalon cdna, RIKEN full-length enriched library, clone: l03 product:riken cdna L03 gene, full insert sequence. [AK020382] 6.19 Mapk8 AK Mus musculus 10 days lactation, adult female mammary gland cdna, RIKEN full-length enriched library, clone:d730034n23 product:mitogen activated protein kinase 8, full insert sequence. [AK085745] 6.15 Lrrc46 NM_ Mus musculus leucine rich repeat containing 46 (Lrrc46), mrna [NM_027026] 6.12 AK AK Mus musculus adult male hippocampus cdna, RIKEN full-length enriched library, clone:c630005a03 product:unclassifiable, full insert sequence. [AK049867] 6.03 AK AK Mus musculus 0 day neonate lung cdna, RIKEN full-length enriched library, clone:e030001f11 product:unclassifiable, full insert sequence. [AK086785] 6.03 AK AK Mus musculus 15 days embryo head cdna, RIKEN full-length enriched library, clone:d930049f02 product:mitochondrial CARRIER-LIKE PROTEIN homolog [Mus musculus], full insert sequence. [AK086749] 5.94 Pop4 NM_ Mus musculus processing of precursor 4, ribonuclease P/MRP family, (S. cerevisiae) (Pop4), mrna [NM_025390] 5.77 AK AK Mus musculus adult male bone cdna, RIKEN full-length enriched library, clone: b20 product:unclassifiable, full insert sequence. [AK036620] 5.75 Smr2 U82379 Mus musculus MSG2epsilon salivary protein (Vcs2) mrna, complete cds. [U82379] 5.73 Scmh1 AK Mus musculus 12 days embryo spinal ganglion cdna, RIKEN full-length enriched library, clone:d130047m02 product:unclassifiable, full insert sequence. [AK083889] 5.72 AK AK Mus musculus 12 days embryo male wolffian duct includes surrounding region cdna, RIKEN full-length enriched library, clone: f13 product:unclassifiable, full insert sequence. [AK032760] G19Rik AK Mus musculus adult male hippocampus cdna, RIKEN full-length enriched library, clone:c630015g22 product:unclassifiable, full insert sequence [AK083124] 5.66 AK AK Mus musculus 0 day neonate eyeball cdna, RIKEN full-length enriched library, clone:e130016a22 product:hypothetical protein, full insert sequence [AK053413] 5.64 AK AK Mus musculus adult male urinary bladder cdna, RIKEN full-length enriched library, clone: m13 product:programmed cell death 1 ligand 1, full insert sequence. [AK035678] 5.60 AK AK Mus musculus 16 days neonate cerebellum cdna, RIKEN full-length enriched library, clone: n03 product:unclassifiable, full insert sequence. [AK036256] 5.58 Zbtb8os NM_ Mus musculus zinc finger and BTB domain containing 8 opposite strand (Zbtb8os), mrna [NM_025970] 5.56 Fancg NM_ Mus musculus Fanconi anemia, complementation group G (Fancg), mrna [NM_053081] 5.56 Myl1 NM_ Mus musculus myosin, light polypeptide 1 (Myl1), mrna [NM_021285] 5.55 Usmg2 AJ Mus musculus mrna for a stretch regulated skeletal muscle protein (Usmg2 gene). [AJ290944] M07Rik AK Mus musculus 10 day old male pancreas cdna, RIKEN full-length enriched library, clone: b09 product:hypothetical Thioredoxin-like structure containing protein, full insert sequence. [AK007800] 5.54 Acsbg2 NM_ Mus musculus acyl-coa synthetase bubblegum family member 2 (Acsbg2), mrna [NM_ ] 5.50 Afp NM_ Mus musculus alpha fetoprotein (Afp), mrna [NM_007423] 5.49 ENSMUST ENSMUST PREDICTED: Mus musculus similar to 60S ribosomal protein L11 (LOC628696), mrna [XR_003074] M06Rik AK Mus musculus 16 days embryo lung cdna, RIKEN full-length enriched library, clone: h10 product:gross passage A viral integration region 1, full insert sequence. [AK018404] 5.26 Iars2 AK Mus musculus 10 days neonate cortex cdna, RIKEN full-length enriched library, clone:a830026b15 product:similar to MITOCHONDRIAL ISOLEUCINE TRNA SYNTHETASE (FRAGMENT) [Homo sapiens], full insert sequence. [AK043729] 5.26 Catsper1 NM_ Mus musculus cation channel of sperm 1 (Catsper1), mrna [NM_139301] J12Rik AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: j12 product:weakly similar to PUTATIVE KERATIN-ASSOCIATED PROTEIN (KERATIN-ASSOCIATED PROTEIN 13) [Mus musculus], full insert sequence. [AK016107] 5.17 Olfml2a AK Mus musculus 6 days neonate skin cdna, RIKEN full-length enriched library, clone:a030009o20 product:unclassifiable, full insert sequence. [AK037205] D24Rik AK Mus musculus adult male medulla oblongata cdna, RIKEN full-length enriched library, clone: d24 product:unclassifiable, full insert sequence [AK018156] 5.14 AK AK Mus musculus 10 days neonate cortex cdna, RIKEN full-length enriched library, clone:a830081b01 product:unclassifiable, full insert sequence. [AK044018] 5.09 Car8 NM_ Mus musculus carbonic anhydrase 8 (Car8), mrna [NM_007592] O13Rik NM_ Mus musculus RIKEN cdna O13 gene ( O13Rik), mrna [NM_026096] 5.07 ENSMUST ENSMUST Mus musculus 3 days neonate thymus cdna, RIKEN full-length enriched library, clone:a630010a05 product:unclassifiable, full insert sequence. [AK041445] 5.04 Taf6l AK Mus musculus 12 days embryo spinal cord cdna, RIKEN full-length enriched library, clone:c530024j06 product:unclassifiable, full insert sequence [AK082962] 5.04 Usp53 AK Mus musculus adult male corpora quadrigemina cdna, RIKEN full-length enriched library, clone:b230326m20 product:kiaa1350 PROTEIN (FRAGMENT) homolog [Homo sapiens], full insert sequence. [AK045953] 5.03 Slc16a10 NM_ Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 10 (Slc16a10), mrna [NM_028247] 5.00 Rab3gap1 AK Mus musculus 16 days embryo head cdna, RIKEN full-length enriched library, clone:c130011b20 product:unclassifiable, full insert sequence. [AK081362] C01Rik NM_ Mus musculus RIKEN cdna C01 gene ( C01Rik), mrna [NM_ ] 4.97 Esx1 NM_ Mus musculus extraembryonic, spermatogenesis, homeobox 1 (Esx1), mrna [NM_007957] 4.95 Hnf4a NM_ Mus musculus hepatic nuclear factor 4, alpha (Hnf4a), mrna [NM_008261]

3 4.93 Gjb6 NM_ Mus musculus gap junction membrane channel protein beta 6 (Gjb6), transcript variant 1, mrna [NM_008128] 4.93 AK AK Mus musculus 12 days embryo embryonic body between diaphragm region and neck cdna, RIKEN full-length enriched library, clone: p18 product:hypothetical protein, full insert sequence. [AK034767] 4.92 Zic4 AK Mus musculus 17 days embryo head cdna, RIKEN full-length enriched library, clone: i10 product:zinc finger protein of the cerebellum 4, full insert sequence. [AK028305] 4.90 AK AK Mus musculus 15 days embryo head cdna, RIKEN full-length enriched library, clone:d930005i07 product:unclassifiable, full insert sequence. [AK086095] 4.90 Fut10 NM_ Mus musculus fucosyltransferase 10 (Fut10), transcript variant A, mrna [NM_ ] 4.90 Insig2 AK Mus musculus 16 days neonate cerebellum cdna, RIKEN full-length enriched library, clone: d21 product:unclassifiable, full insert sequence [AK036292] 4.90 AI XM_ PREDICTED: Mus musculus expressed sequence AI (AI848100), mrna [XM_975051] 4.88 Slc25a37 AK Mus musculus 12 days embryo embryonic body between diaphragm region and neck cdna, RIKEN full-length enriched library, clone: f12 product:mitochondrial CARRIER-LIKE PROTEIN homolog [Mus musculus], full insert sequence. [AK034948] 4.87 AK AK Mus musculus 0 day neonate lung cdna, RIKEN full-length enriched library, clone:e030003e06 product:unclassifiable, full insert sequence. [AK086825] 4.79 Myl1 AK Mus musculus adult male tongue cdna, RIKEN full-length enriched library, clone: n24 product:myosin light chain, alkali, fast skeletal muscle, full insert sequence. [AK009938] G14Rik AK Mus musculus 13 days embryo forelimb cdna, RIKEN full-length enriched library, clone: f16 product:cytosolic 5' nucleotidase, type 1A, full insert sequence [AK031182] 4.71 Tia1 AK Mus musculus adult male tongue cdna, RIKEN full-length enriched library, clone: d05 product:cytotoxic granule-associated RNA binding protein 1, full insert sequence. [AK009502] 4.71 Ppp1r14c AK Mus musculus 0 day neonate cerebellum cdna, RIKEN full-length enriched library, clone:c230042n14 product:hypothetical protein, full insert sequence. [AK082372] 4.67 Rabl2a NM_ Mus musculus RAB, member of RAS oncogene family-like 2A (Rabl2a), mrna [NM_026817] 4.61 AK AK Mus musculus 16 days neonate heart cdna, RIKEN full-length enriched library, clone:d830041m08 product:unclassifiable, full insert sequence. [AK086003] 4.57 Pold3 NM_ Mus musculus polymerase (DNA-directed), delta 3, accessory subunit (Pold3), mrna [NM_133692] 4.52 Tlx1 NM_ Mus musculus T-cell leukemia, homeobox 1 (Tlx1), mrna [NM_021901] 4.51 Polb BC Mus musculus polymerase (DNA directed), beta, mrna (cdna clone IMAGE: ), complete cds. [BC006681] 4.51 AK AK Mus musculus adult male spinal cord cdna, RIKEN full-length enriched library, clone:a330041l12 product:unclassifiable, full insert sequence. [AK039420] 4.45 Cdh10 AK Mus musculus 10 days neonate cerebellum cdna, RIKEN full-length enriched library, clone:b930096i11 product:unclassifiable, full insert sequence. [AK081174] 4.44 AK AK Mus musculus 6 days neonate skin cdna, RIKEN full-length enriched library, clone:a030008f11 product:unclassifiable, full insert sequence. [AK037194] 4.43 Morc1 AK Mus musculus 0 day neonate thymus cdna, RIKEN full-length enriched library, clone:a430057k11 product:microrchidia, full insert sequence. [AK040083] 4.42 Bpnt1 NM_ Mus musculus bisphosphate 3'-nucleotidase 1 (Bpnt1), mrna [NM_011794] 4.41 MGC58177 NM_ Mus musculus Similar to RIKEN cdna O03 gene (MGC58177), mrna [NM_198666] 4.41 Gorasp2 AK Mus musculus 12 days embryo embryonic body between diaphragm region and neck cdna, RIKEN full-length enriched library, clone: f20 product:inferred: golgi reassembly stacking protein 2, full insert sequence. [AK020521] 4.41 Rpgrip1 NM_ Mus musculus retinitis pigmentosa GTPase regulator interacting protein 1 (Rpgrip1), mrna [NM_023879] 4.38 Fbxl17 AK Mus musculus 15 days embryo head cdna, RIKEN full-length enriched library, clone:d930012n22 product:unclassifiable, full insert sequence [AK086201] 4.35 Plf2 NM_ Mus musculus proliferin 2 (Plf2), mrna [NM_011118] 4.34 AK AK Mus musculus 15 days embryo head cdna, RIKEN full-length enriched library, clone:d930018i20 product:unclassifiable, full insert sequence. [AK086288] M22Rik NM_ Mus musculus RIKEN cdna M22 gene ( M22Rik), mrna [NM_026084] 4.31 ENSMUST ENSMUST PREDICTED: Mus musculus immunoglobulin heavy chain (S107 family) (Igh-VS107), mrna [XM_ ] 4.28 NAP NAP Unknown 4.28 Pvalb NM_ Mus musculus parvalbumin (Pvalb), mrna [NM_013645] 4.28 Zfp672 AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: n19 product:weakly similar to zinc finger protein 37A, full insert sequence. [AK019676] 4.24 AK AK Mus musculus 10 days neonate cerebellum cdna, RIKEN full-length enriched library, clone:b930073n06 product:unclassifiable, full insert sequence [AK081043] 4.24 Rab27b NM_ Mus musculus RAB27b, member RAS oncogene family (Rab27b), mrna [NM_030554] 4.24 Sash1 NM_ Mus musculus SAM and SH3 domain containing 1 (Sash1), mrna [NM_175155] 4.22 AK AK Mus musculus adult female vagina cdna, RIKEN full-length enriched library, clone: j18 product:unclassifiable, full insert sequence. [AK036971] 4.22 Tmc1 AK Mus musculus adult male colon cdna, RIKEN full-length enriched library, clone: n17 product:hypothetical protein, full insert sequence. [AK033447] 4.21 AK AK Mus musculus 15 days embryo head cdna, RIKEN full-length enriched library, clone:d930007p05 product:unclassifiable, full insert sequence. [AK086142] 4.19 Ctsj NM_ Mus musculus cathepsin J (Ctsj), mrna [NM_012007] 4.15 AK AK Mus musculus adult retina cdna, RIKEN full-length enriched library, clone:a930007e04 product:vacuolar protein sorting 45 (yeast), full insert sequence. [AK044317] 4.15 Hunk NM_ Mus musculus hormonally upregulated Neu-associated kinase (Hunk), mrna [NM_015755] 4.13 AK AK Mus musculus 7 days embryo whole body cdna, RIKEN full-length enriched library, clone:c430020a21 product:unclassifiable, full insert sequence. [AK049532] 4.12 Ear5 NM_ Mus musculus eosinophil-associated, ribonuclease A family, member 5 (Ear5), mrna [NM_019398] 4.10 Elmo1 NM_ Mus musculus engulfment and cell motility 1, ced-12 homolog (C. elegans) (Elmo1), transcript variant 1, mrna [NM_080288] 4.09 Dclre1c NM_ Mus musculus DNA cross-link repair 1C, PSO2 homolog (S. cerevisiae) (Dclre1c), transcript variant 2, mrna [NM_175683] 4.08 AK AK Mus musculus 16 days embryo head cdna, RIKEN full-length enriched library, clone:c130019g10 product:hypothetical protein, full insert sequence. [AK140790] 4.07 AK AK Mus musculus 10 days neonate cortex cdna, RIKEN full-length enriched library, clone:a830025b07 product:microtubule-associated protein 7, full insert sequence. [AK043723] 4.04 Rnasen AK Mus musculus 8 days embryo whole body cdna, RIKEN full-length enriched library, clone: e20 product:weakly similar to RIBONUCLEASE III (EC ) (RNASE III) (P241) [Homo sapiens], full insert sequence. [AK077549] 4.02 Usp18 NM_ Mus musculus ubiquitin specific peptidase 18 (Usp18), mrna [NM_011909] 4.02 AK AK Mus musculus 0 day neonate cerebellum cdna, RIKEN full-length enriched library, clone:c230076g20 product:unclassifiable, full insert sequence. [AK048858] 4.02 Zfp125 AJ Mus musculus of ZT2 gene encoding zinc finger protein 125 [AJ005350] 4.02 Acad9 AK Mus musculus adult male hippocampus cdna, RIKEN full-length enriched library, clone:c630012l17 product:inferred: RIKEN cdna P15 gene, full insert sequence. [AK049931] 3.97 Igsf4d NM_ Mus musculus immunoglobulin superfamily, member 4 (Igsf4d), mrna [NM_178721] 3.97 AK AK Mus musculus adult male diencephalon cdna, RIKEN full-length enriched library, clone: e06 product:unclassifiable, full insert sequence. [AK034021] 3.96 A_52_P A_52_P Unknown G08Rik NM_ Mus musculus RIKEN cdna G08 gene ( G08Rik), mrna [NM_027434] 3.93 AK AK Mus musculus 0 day neonate eyeball cdna, RIKEN full-length enriched library, clone:e130018a18 product:unclassifiable, full insert sequence. [AK053436] 3.93 Slc13a1 AK Mus musculus 10 days neonate cerebellum cdna, RIKEN full-length enriched library, clone:b930093i16 product:solute carrier family 13 (sodium [AK047580] 3.93 ENSMUST ENSMUST Mus musculus mrna for mkiaa0917 protein. [AK129238] 3.92 Cdkn3 AK Mus musculus 15 days embryo male testis cdna, RIKEN full-length enriched library, clone: g14 product:weakly similar to CYCLIN-DEPENDENT KINASE INHIBITOR 3 (EC ) [Sus scrofa], full insert sequence. [AK033341]

4 F03Rik NM_ Mus musculus RIKEN cdna F03 gene ( F03Rik), mrna [NM_172859] 3.89 Mrpplf4 NM_ Mus musculus mitogen regulated protein, proliferin 4 (Mrpplf4), mrna [NM_181852] 3.89 AK AK Mus musculus adult male spinal cord cdna, RIKEN full-length enriched library, clone:a330080e05 product:unclassifiable, full insert sequence. [AK039663] 3.88 AW NM_ Mus musculus expressed sequence AW (AW551984), mrna [NM_178737] G22Rik NM_ Mus musculus RIKEN cdna G22 gene ( G22Rik), mrna [NM_145509] 3.85 Aldob NM_ Mus musculus aldolase 2, B isoform (Aldob), mrna [NM_144903] 3.83 Hist1h4i BF UI-M-CC0-ayb-f-07-0-UI.r1 NIH_BMAP_Ret1 Mus musculus cdna clone UI-M-CC0-ayb-f-07-0-UI 5'. [BF467941] 3.82 AK AK Mus musculus adult retina cdna, RIKEN full-length enriched library, clone:a930001j16 product:unclassifiable, full insert sequence. [AK080694] 3.82 Bst2 NM_ Mus musculus bone marrow stromal cell antigen 2 (Bst2), mrna [NM_198095] 3.82 LOC XM_ PREDICTED: Mus musculus hypothetical protein LOC (LOC668408), mrna [XM_ ] 3.79 TC TC Q9ERK2 (Q9ERK2) Neprilysin-like peptidase gamma, partial (5%) [TC ] E14Rik NM_ Mus musculus RIKEN cdna E14 gene ( E14Rik), mrna [NM_029131] 3.78 AK AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: l14 product:laminin receptor 1 (67kD, ribosomal protein SA), full insert sequence. [AK017011] 3.78 Ints7 AK Mus musculus 13 days embryo forelimb cdna, RIKEN full-length enriched library, clone: e23 product:unclassifiable, full insert sequence. [AK020029] G02Rik AK Mus musculus mrna for mkiaa4091 protein [AK220482] 3.69 Tmc7 NM_ Mus musculus transmembrane channel-like gene family 7 (Tmc7), mrna [NM_172476] 3.69 Pglyrp1 NM_ Mus musculus peptidoglycan recognition protein 1 (Pglyrp1), mrna [NM_009402] 3.69 Akap14 NM_ Mus musculus A kinase (PRKA) anchor protein 14 (Akap14), mrna [NM_ ] 3.68 Prkar2a AK Mus musculus 10, 11 days embryo whole body cdna, RIKEN full-length enriched library, clone: d03 product:protein kinase, camp dependent regulatory, type II alpha, full insert sequence. [AK013274] 3.65 Slc30a10 NM_ Mus musculus solute carrier family 30, member 10 (Slc30a10), mrna [NM_ ] 3.64 D430006K04 AK Mus musculus 13 days embryo lung cdna, RIKEN full-length enriched library, clone:d430006k04 product:hypothetical protein, full insert sequence [AK084893] 3.63 Plf2 NM_ Mus musculus proliferin 2 (Plf2), mrna [NM_011118] 3.63 AK AK Mus musculus activated spleen cdna, RIKEN full-length enriched library, clone:f830006k17 product:unclassifiable, full insert sequence. [AK089644] 3.62 Galk2 NM_ Mus musculus galactokinase 2 (Galk2), mrna [NM_175154] 3.61 ENSMUST ENSMUST Mus musculus 10 days neonate cerebellum cdna, RIKEN full-length enriched library, clone:b930095i24 product:hypothetical protein, full insert sequence. [AK081168] 3.61 Oas2 NM_ Mus musculus 2'-5' oligoadenylate synthetase 2 (Oas2), mrna [NM_145227] E19Rik AK Mus musculus 8 days embryo whole body cdna, RIKEN full-length enriched library, clone: e19 product:unclassifiable, full insert sequence. [AK017540] 3.60 Ptpro NM_ Mus musculus protein tyrosine phosphatase, receptor type, O (Ptpro), mrna [NM_011216] 3.59 A230097K15Rik NM_ Mus musculus RIKEN cdna A230097K15 gene (A230097K15Rik), transcript variant 1, mrna [NM_172715] 3.58 Rpgrip1 NM_ Mus musculus retinitis pigmentosa GTPase regulator interacting protein 1 (Rpgrip1), mrna [NM_023879] 3.57 ENSMUST ENSMUST Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: a02 product:hypothetical protein, full insert sequence. [AK015562] 3.55 Itgb1bp1 NM_ Mus musculus integrin beta 1 binding protein 1 (Itgb1bp1), mrna [NM_008403] F17Rik AK Mus musculus 0 day neonate eyeball cdna, RIKEN full-length enriched library, clone:e130110g22 product:unclassifiable, full insert sequence [AK021377] D03Rik NM_ Mus musculus RIKEN cdna D03 gene ( D03Rik), mrna [NM_026469] 3.55 Pla2g4b BC Mus musculus phospholipase A2, group IVB (cytosolic), mrna (cdna clone MGC: IMAGE: ), complete cds. [BC098210] 3.52 Itgb3 AK Mus musculus 11 days embryo gonad cdna, RIKEN full-length enriched library, clone: d15 product:unclassifiable, full insert sequence [AK135584] 3.50 C130022M03Rik AK Mus musculus 16 days embryo head cdna, RIKEN full-length enriched library, clone:c130022m03 product:unclassifiable, full insert sequence [AK047938] 3.49 Kng1 NM_ Mus musculus kininogen 1 (Kng1), mrna [NM_023125] 3.47 Olfr678 NM_ Mus musculus olfactory receptor 678 (Olfr678), mrna [NM_146758] 3.46 Akr1c18 NM_ Mus musculus aldo-keto reductase family 1, member C18 (Akr1c18), mrna [NM_134066] G17Rik NM_ Mus musculus RIKEN cdna G17 gene ( G17Rik), mrna [NM_026127] 3.40 Hmgcs1 AK Mus musculus 15 days embryo male testis cdna, RIKEN full-length enriched library, clone: p03 product:similar to hydroxymethylglutaryl-coa synthase (EC ) (fragment) [Gallus gallus], full insert sequence. [AK078743] 3.40 AK AK Mus musculus adult male colon cdna, RIKEN full-length enriched library, clone: g04 product:telomerase associated protein 1, full insert sequence. [AK033525] 3.39 TC TC COXO_MOUSE (P17665) Cytochrome c oxidase polypeptide VIIc, mitochondrial precursor, partial (60%) [TC ] 3.38 LOC XM_ PREDICTED: Mus musculus similar to histone deacetylase 1 (LOC634881), mrna [XM_909745] 3.38 AK AK Mus musculus 15 days embryo male testis cdna, RIKEN full-length enriched library, clone: h20 product:cytosolic 5' nucleotidase, type 1A, full insert sequence. [AK033080] 3.38 A530053G22Rik NM_ Mus musculus RIKEN cdna A530053G22 gene (A530053G22Rik), mrna [NM_177329] 3.37 Abp1 NM_ Mus musculus amiloride binding protein 1 (amine oxidase, copper-containing) (Abp1), mrna [NM_029638] 3.36 Isg20 NM_ Mus musculus interferon-stimulated protein (Isg20), mrna [NM_020583] 3.36 Rnf41 NM_ Mus musculus ring finger protein 41 (Rnf41), mrna [NM_026259] 3.35 A930006K02Rik AK Mus musculus adult male hypothalamus cdna, RIKEN full-length enriched library, clone:a230049k01 product:unclassifiable, full insert sequence [AK038602] 3.35 Aldob NM_ Mus musculus aldolase 2, B isoform (Aldob), mrna [NM_144903] 3.34 Mrps18b AK Mus musculus adult male diencephalon cdna, RIKEN full-length enriched library, clone: a01 product:unclassifiable, full insert sequence. [AK034502] 3.34 Hbb-b1 NM_ Mus musculus hemoglobin, beta adult major chain (Hbb-b1), mrna [NM_008220] 3.32 Rpp14 NM_ Mus musculus ribonuclease P 14 subunit (human) (Rpp14), mrna [NM_025938] 3.32 A730013G03Rik NM_ Mus musculus RIKEN cdna A730013G03 gene (A730013G03Rik), mrna [NM_177299] 3.32 Tmem117 AK Mus musculus adult male diencephalon cdna, RIKEN full-length enriched library, clone: k14 product:weakly similar to KIAA1657 PROTEIN (FRAGMENT) [Homo sapiens], full insert sequence. [AK034024] 3.30 Cd59b NM_ Mus musculus CD59b antigen (Cd59b), mrna [NM_181858] 3.30 Rpl11 NM_ Mus musculus ribosomal protein L11 (Rpl11), mrna [NM_025919] 3.30 Snx5 AK Mus musculus 2 days neonate thymus thymic cells cdna, RIKEN full-length enriched library, clone:e430007j19 product:sorting nexin 5, full insert sequence. [AK088223] 3.29 AK AK Mus musculus 13 days embryo lung cdna, RIKEN full-length enriched library, clone:d430037e19 product:hypothetical protein, full insert sequence. [AK085106] 3.29 Reps2 NM_ Mus musculus RALBP1 associated Eps domain containing protein 2 (Reps2), mrna [NM_178256]

5 3.28 Atf2 AK Mus musculus 10 days neonate cerebellum cdna, RIKEN full-length enriched library, clone:b930056p03 product:activating transcription factor 2, full insert sequence. [AK047405] 3.27 Wdfy3 AK Mus musculus 0 day neonate lung cdna, RIKEN full-length enriched library, clone:e030037m04 product:unclassifiable, full insert sequence. [AK087235] 3.26 AK AK Mus musculus 16 days neonate heart cdna, RIKEN full-length enriched library, clone:d830015g02 product:hypothetical Leucine-rich region containing protein, full insert sequence. [AK052874] 3.24 Asah2 NM_ Mus musculus N-acylsphingosine amidohydrolase 2 (Asah2), mrna [NM_018830] 3.23 Tex11 NM_ Mus musculus testis expressed gene 11 (Tex11), mrna [NM_031384] 3.23 LOC XM_ PREDICTED: Mus musculus hypothetical LOC (LOC627311), mrna [XM_891970] D10Rik AK Mus musculus 10, 11 days embryo whole body cdna, RIKEN full-length enriched library, clone: d10 product:zinc FINGER PROTEIN 54 homolog [Mus musculus], full insert sequence. [AK012854] 3.23 Cd247 NM_ Mus musculus CD247 antigen (Cd247), mrna [NM_031162] 3.23 NAP NAP Unknown A08Rik AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: a08 product:unclassifiable, full insert sequence [AK016784] C06Rik AK Mus musculus adult male tongue cdna, RIKEN full-length enriched library, clone: c06 product:unclassifiable, full insert sequence. [AK009002] 3.21 Neto1 AK Mus musculus 10 days neonate cortex cdna, RIKEN full-length enriched library, clone:a830022o03 product:hypothetical Microbodies C-terminal targeting signal [AK043710] 3.20 Adcyap1r1 NM_ Mus musculus adenylate cyclase activating polypeptide 1 receptor 1 (Adcyap1r1), transcript variant 1, mrna [NM_007407] M13Rik AK Mus musculus 12 days embryo male wolffian duct includes surrounding region cdna, RIKEN full-length enriched library, clone: l20 product:unclassifiable, full insert sequence [AK078441] 3.19 A2m NM_ Mus musculus alpha-2-macroglobulin (A2m), mrna [NM_175628] 3.17 Herc5 AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: d12 product:est AI451296, full insert sequence. [AK007221] 3.16 TC TC Unknown M11Rik AK Mus musculus 12 days embryo male wolffian duct includes surrounding region cdna, RIKEN full-length enriched library, clone: m11 product:hypothetical Retroviral GAG p10 protein/retroviral matrix protein containing protein, full insert sequence Ifi204 NM_ Mus musculus interferon activated gene 204 (Ifi204), mrna [NM_008329] 3.14 AK AK Mus musculus 12 days embryo embryonic body between diaphragm region and neck cdna, RIKEN full-length enriched library, clone: c13 product:unclassifiable, full insert sequence. [AK034578] M11Rik AK Mus musculus adult male olfactory brain cdna, RIKEN full-length enriched library, clone: m11 product:unclassifiable, full insert sequence. [AK032585] 3.14 Fst NM_ Mus musculus follistatin (Fst), mrna [NM_008046] 3.14 Pank1 AK Mus musculus 0 day neonate skin cdna, RIKEN full-length enriched library, clone: i06 product:hypothetical protein, full insert sequence. [AK019493] B17Rik AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: b17 product:unclassifiable, full insert sequence [AK017106] D17Rik AK Mus musculus 13 days embryo male testis cdna, RIKEN full-length enriched library, clone: p05 product:unclassifiable, full insert sequence [AK031619] 3.11 NAP NAP Unknown 3.11 Wdr76 BC Mus musculus WD repeat domain 76, mrna (cdna clone MGC: IMAGE: ), complete cds. [BC094676] 3.10 Abhd3 NM_ Mus musculus abhydrolase domain containing 3 (Abhd3), mrna [NM_134130] 3.10 Slc1a5 NM_ Mus musculus solute carrier family 1 (neutral amino acid transporter), member 5 (Slc1a5), mrna [NM_009201] 3.09 Gfap AK Mus musculus adult male corpora quadrigemina cdna, RIKEN full-length enriched library, clone:b230315d14 product:glial fibrillary acidic protein, full insert sequence. [AK140151] 3.07 D130040H23Rik NM_ Mus musculus RIKEN cdna D130040H23 gene (D130040H23Rik), mrna [NM_172491] 3.07 A630051L19Rik AK Mus musculus 3 days neonate thymus cdna, RIKEN full-length enriched library, clone:a630051l19 product:unclassifiable, full insert sequence [AK042002] 3.06 Zfp706 NM_ Mus musculus zinc finger protein 706 (Zfp706), mrna [NM_026521] 3.06 V1rh1 NM_ Mus musculus vomeronasal 1 receptor, H1 (V1rh1), mrna [NM_134211] 3.05 AK AK Mus musculus activated spleen cdna, RIKEN full-length enriched library, clone:f830009k24 product:unclassifiable, full insert sequence. [AK089705] 3.05 Slc9a7 NM_ Mus musculus solute carrier family 9 (sodium/hydrogen exchanger), isoform 7 (Slc9a7), mrna [NM_177353] 3.05 Slc17a8 NM_ Mus musculus solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 (Slc17a8), mrna [NM_182959] I18Rik NM_ Mus musculus RIKEN cdna I18 gene ( I18Rik), mrna [NM_198651] 3.04 Rab40b NM_ Mus musculus Rab40b, member RAS oncogene family (Rab40b), mrna [NM_139147] 3.04 AI XM_ PREDICTED: Mus musculus expressed sequence AI (AI607873), mrna [XM_980696] 3.02 C1r NM_ Mus musculus complement component 1, r subcomponent (C1r), mrna [NM_023143] 3.01 AK AK Mus musculus 13 days embryo lung cdna, RIKEN full-length enriched library, clone:d430031c23 product:unclassifiable, full insert sequence. [AK085058] 3.01 D130076A03Rik AK Mus musculus 12 days embryo spinal ganglion cdna, RIKEN full-length enriched library, clone:d130076a03 product:unclassifiable, full insert sequence. [AK084007] 3.00 E030002O03Rik NM_ Mus musculus RIKEN cdna E030002O03 gene (E030002O03Rik), mrna [NM_172905] 3.00 AV AV AV RIKEN full-length enriched, adult male testis Mus musculus cdna clone G13 3'. [AV209602] 3.00 Fzd2 AK Mus musculus 16 days embryo head cdna, RIKEN full-length enriched library, clone:c130058l18 product:frizzled 2 PRECURSOR, full insert sequence [AK048420] 3.00 Pnp NM_ Mus musculus purine-nucleoside phosphorylase (Pnp), mrna [NM_013632] 2.99 AI XM_ PREDICTED: Mus musculus expressed sequence AI929863, transcript variant 5 (AI929863), mrna [XM_920647] 2.99 Napa NM_ Mus musculus N-ethylmaleimide sensitive fusion protein attachment protein alpha (Napa), mrna [NM_025898] 2.99 AW NM_ Mus musculus expressed sequence AW (AW124722), mrna [NM_ ] 2.98 AK AK Mus musculus adult male corpora quadrigemina cdna, RIKEN full-length enriched library, clone:b230313k13 product:unclassifiable, full insert sequence [AK045835] 2.97 Mt2 NM_ Mus musculus metallothionein 2 (Mt2), mrna [NM_008630] 2.97 Tmem25 NM_ Mus musculus transmembrane protein 25 (Tmem25), mrna [NM_027865] 2.97 A230097K15Rik NM_ Mus musculus RIKEN cdna A230097K15 gene (A230097K15Rik), transcript variant 1, mrna [NM_172715] 2.96 Krtap3-2 NM_ Mus musculus keratin associated protein 3-2 (Krtap3-2), mrna [NM_025720] 2.94 Pde11a AK Mus musculus adult male medulla oblongata cdna, RIKEN full-length enriched library, clone: f14 product:unclassifiable, full insert sequence. [AK018171] 2.94 Slfn9 NM_ Mus musculus schlafen 9 (Slfn9), mrna [NM_172796] 2.94 LOC XM_ PREDICTED: Mus musculus similar to RNA, U17d small nucleolar (LOC670438), mrna [XM_981289] 2.93 AK AK Mus musculus 0 day neonate cerebellum cdna, RIKEN full-length enriched library, clone:c230078p05 product:carbonic anhydrase 5a, mitochondrial, full insert sequence. [AK048889] C21Rik AK Mus musculus 13 days embryo head cdna, RIKEN full-length enriched library, clone: c21 product:unclassifiable, full insert sequence [AK014177] 2.93 Tomm22 NM_ Mus musculus translocase of outer mitochondrial membrane 22 homolog (yeast) (Tomm22), mrna [NM_172609] 2.92 Imp4 NM_ Mus musculus IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) (Imp4), mrna [NM_178601]

6 2.92 ENSMUST ENSMUST Mus musculus G protein-coupled receptor GPR112 mrna, partial cds. [AY255580] 2.92 Aff2 NM_ Mus musculus AF4/FMR2 family, member 2 (Aff2), mrna [NM_008032] 2.91 Ddc8 NM_ Mus musculus testis specific protein, Ddc8 (Ddc8), mrna [NM_021440] 2.90 Pla2g4b BC Mus musculus phospholipase A2, group IVB (cytosolic), mrna (cdna clone IMAGE: ), complete cds. [BC016255] 2.89 Spp2 NM_ Mus musculus secreted phosphoprotein 2 (Spp2), mrna [NM_029269] 2.88 Ngp NM_ Mus musculus neutrophilic granule protein (Ngp), mrna [NM_008694] 2.88 Asns NM_ Mus musculus asparagine synthetase (Asns), mrna [NM_012055] 2.88 LOC NM_ Mus musculus similar to macrophage activation 2 (LOC634650), mrna [NM_ ] 2.88 Mrpl33 BC Mus musculus mitochondrial ribosomal protein L33, mrna (cdna clone MGC:35714 IMAGE: ), complete cds. [BC027018] 2.87 AK AK Mus musculus 15 days embryo male testis cdna, RIKEN full-length enriched library, clone: k24 product:unclassifiable, full insert sequence. [AK033311] 2.87 Rbm41 AK Mus musculus 13 days embryo male testis cdna, RIKEN full-length enriched library, clone: f16 product:hypothetical protein, full insert sequence. [AK077972] 2.86 TC TC CA1C_MOUSE (Q60847) Collagen alpha 1(XII) chain precursor, partial (5%) [TC ] P15Rik AK Mus musculus 10 days neonate skin cdna, RIKEN full-length enriched library, clone: a21 product:basic FGF repressed, Zic binding protein, full insert sequence [AK028574] 2.86 Txnl4 NM_ Mus musculus thioredoxin-like 4 (Txnl4), transcript variant 1, mrna [NM_025299] 2.86 Arfl4 NM_ Mus musculus ADP-ribosylation factor 4-like (Arfl4), mrna [NM_025404] 2.86 NAP NAP Unknown 2.85 AK AK Mus musculus 16 days neonate cerebellum cdna, RIKEN full-length enriched library, clone: c11 product:unclassifiable, full insert sequence. [AK036244] 2.84 Rassf6 NM_ Mus musculus Ras association (RalGDS/AF-6) domain family 6 (Rassf6), mrna [NM_028478] 2.84 Iigp2 NM_ Mus musculus interferon inducible GTPase 2 (Iigp2), mrna [NM_019440] 2.84 Oxtr D86599 Mus sp. mrna for oxytocin receptor, complete cds. [D86599] 2.84 AK AK Mus musculus 3 days neonate thymus cdna, RIKEN full-length enriched library, clone:a630092p20 product:unclassifiable, full insert sequence. [AK042451] 2.84 H2-Ea NM_ Mus musculus histocompatibility 2, class II antigen E alpha (H2-Ea), mrna [NM_010381] G02Rik NM_ Mus musculus RIKEN cdna G02 gene ( G02Rik), mrna [NM_025617] 2.83 Ada NM_ Mus musculus adenosine deaminase (Ada), mrna [NM_007398] 2.82 Pla2g4b BC Mus musculus phospholipase A2, group IVB (cytosolic), mrna (cdna clone MGC: IMAGE: ), complete cds. [BC098210] 2.82 Cpn2 BC Mus musculus carboxypeptidase N, polypeptide 2, mrna (cdna clone IMAGE: ), partial cds. [BC025836] 2.82 Csta NM_ Mus musculus cystatin A (Csta), mrna [NM_ ] 2.82 Rsad2 NM_ Mus musculus radical S-adenosyl methionine domain containing 2 (Rsad2), mrna [NM_021384] 2.81 AK AK Mus musculus 16 days neonate heart cdna, RIKEN full-length enriched library, clone:d830023g23 product:unclassifiable, full insert sequence [AK085881] P20Rik AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: p20 product:nonhistone chromosomal protein HMG-1 homolog [Bos primigenius taurus], full insert sequence. [AK016539] 2.81 Stat1 NM_ Mus musculus signal transducer and activator of transcription 1 (Stat1), mrna [NM_009283] 2.79 Speer4f NM_ Mus musculus spermatogenesis associated glutamate (E)-rich protein 4f (Speer4f), mrna [NM_027609] P06Rik AK Mus musculus adult male testis cdna, RIKEN full-length enriched library, clone: p06 product:unclassifiable, full insert sequence. [AK019761] 2.78 AK AK Mus musculus 13 days embryo male testis cdna, RIKEN full-length enriched library, clone: i20 product:unclassifiable, full insert sequence. [AK031453] 2.78 Gcn1l1 AK Mus musculus 16 days neonate thymus cdna, RIKEN full-length enriched library, clone:a130017m23 product:hypothetical protein, full insert sequence. [AK037425] 2.77 Slc7a8 NM_ Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 (Slc7a8), mrna [NM_016972] 2.77 AK AK Mus musculus 15 days embryo head cdna, RIKEN full-length enriched library, clone:d930031j16 product:microtubule-associated protein 2, full insert sequence. [AK086484] J02Rik AK Mus musculus 16 days neonate cerebellum cdna, RIKEN full-length enriched library, clone: l01 product:hypothetical protein, full insert sequence [AK035840] G18Rik NM_ Mus musculus RIKEN cdna G18 gene ( G18Rik), mrna [NM_172788] 2.77 LOC XR_ PREDICTED: Mus musculus hypothetical protein LOC (LOC674214), mrna [XR_004625] 2.76 AW NM_ Mus musculus expressed sequence AW (AW551984), mrna [NM_178737] A05Rik AK Mus musculus adult male diencephalon cdna, RIKEN full-length enriched library, clone: f04 product:unclassifiable, full insert sequence. [AK034073] D11Rik BC Mus musculus RIKEN cdna D11 gene, mrna (cdna clone MGC:57108 IMAGE: ), complete cds. [BC049168] 2.74 AK AK Mus musculus 0 day neonate cerebellum cdna, RIKEN full-length enriched library, clone:c230071e14 product:unclassifiable, full insert sequence. [AK082626] 2.73 Matn2 NM_ Mus musculus matrilin 2 (Matn2), mrna [NM_016762] 2.73 Mod1 M29546 Mouse MOD-1 null malic enzyme mrna, partial cds. [M29546] 2.73 CD CD B0215C04-5 NIA Mouse Embryonic Germ Cell cdna Library (Long) Mus musculus cdna clone NIA:B0215C04 IMAGE: ', mrna sequence [CD539668] 2.73 Gm905 NM_ Mus musculus gene model 905, (NCBI) (Gm905), mrna [NM_ ] 2.73 Isg15 NM_ Mus musculus ISG15 ubiquitin-like modifier (Isg15), mrna [NM_015783] C07Rik AK Mus musculus 11 days pregnant adult female ovary and uterus cdna, RIKEN full-length enriched library, clone: c07 product:similar to H88 [Human herpesvirus 6], full insert sequence [AK030322] 2.72 Zfr AK Mus musculus 16 days neonate thymus cdna, RIKEN full-length enriched library, clone:a130027f16 product:unclassifiable, full insert sequence. [AK037578] 2.72 Stk25 NM_ Mus musculus serine/threonine kinase 25 (yeast) (Stk25), mrna [NM_021537] 2.72 Slc13a3 NM_ Mus musculus solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 (Slc13a3), mrna [NM_054055] D21Rik NM_ Mus musculus RIKEN cdna D21 gene ( D21Rik), mrna [NM_148940] 2.71 B230343J05Rik AK Mus musculus adult male diencephalon cdna, RIKEN full-length enriched library, clone: m15 product:unclassifiable, full insert sequence [AK034150] 2.70 Gp1ba NM_ Mus musculus glycoprotein 1b, alpha polypeptide (Gp1ba), mrna [NM_010326] 2.70 Atg7 AK Mus musculus 10 days neonate skin cdna, RIKEN full-length enriched library, clone: i21 product:unclassifiable, full insert sequence. [AK076330] 2.70 Lor NM_ Mus musculus loricrin (Lor), mrna [NM_008508] 2.70 Lgr5 AK Mus musculus 16 days embryo head cdna, RIKEN full-length enriched library, clone:c130018c02 product:g protein-coupled receptor 49, full insert sequence. [AK047873] 2.69 AK AK Mus musculus 2 days pregnant adult female oviduct cdna, RIKEN full-length enriched library, clone:e230032b21 product:unclassifiable, full insert sequence [AK087644] 2.68 Zfp59 NM_ Mus musculus zinc finger protein 59 (Zfp59), mrna [NM_011762] 2.68 H2afj NM_ Mus musculus H2A histone family, member J (H2afj), mrna [NM_177688]

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

Table 1A. Genes enriched as over-expressed in DPM treatment group

Table 1A. Genes enriched as over-expressed in DPM treatment group Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597

More information

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding

More information

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name 5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Supplementary Information

Supplementary Information Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,

More information

Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age

Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age Supplementary Table 2 : 119 differentially expressed between aorta of DMO and CMO at 3 months of age Gene Description Score Fold-change Classification Sephs2 selenophosphate synthase 2 2.680 3.7 Metabolism

More information

Supplementary information, Table S2. Genes belonging to groups in Supplementary information, Figure S8

Supplementary information, Table S2. Genes belonging to groups in Supplementary information, Figure S8 Supplementary information, Table S2. Genes belonging to groups in Supplementary information, Figure S8 Genbank NM_012054 NM_153508 NM_011305 NM_011884 NM_013892 NM_008595 NM_008860 NM_212457 NM_009514

More information

Signal Transduction Cascades

Signal Transduction Cascades Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven

More information

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1- Differential expression of stress-related genes. Feature Number Probe Name Systematic Name Gene Name Description 30248 A_52_P342860 NM_007954 Es1 Mus musculus esterase 1 (Es1), mrna

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 15, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 15, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 15, 2018 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl-

Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl- Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl- 2 upregulation in pregnancy B. Santner-Nanan, K. Straubinger, P. Hsu, G. Parnell, B. Tang, B. Xu, A. Makris,

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Transcriptional changes are dependent upon Fpn and occur in peritoneal macrophages. A. Mouse bone marrow macrophages were transfected with either WT Fpn-GFP

More information

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma

More information

HORMONES AND CELL SIGNALLING

HORMONES AND CELL SIGNALLING HORMONES AND CELL SIGNALLING TYPES OF CELL JUNCTIONS CHEMICAL SIGNALS AND MODES OF ACTION Endocrine system produces chemical messages = hormones that are transported from endocrine gland to target cell

More information

Model Answer. M.Sc. Zoology (First Semester) Examination Paper LZT 103 (Endocrinology)

Model Answer. M.Sc. Zoology (First Semester) Examination Paper LZT 103 (Endocrinology) Model Answer M.Sc. Zoology (First Semester) Examination-2013 Paper LZT 103 (Endocrinology) Section A 1. (i) d (ii) b (iii) b (iv) c (v) c (vi) a (vii) c (viii) a (ix) d (x) b Section B Q.2 Answer Hormonal

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

Chapter 9. Cellular Signaling

Chapter 9. Cellular Signaling Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The

More information

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points. BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which

More information

Homeostasis. Endocrine System Nervous System

Homeostasis. Endocrine System Nervous System Homeostasis Endocrine System Nervous System 2004-2005 Regulation Why are hormones needed? chemical messages from one body part to another communication needed to coordinate whole body homeostasis & regulation

More information

CHAPTER II PDL 101 HUMAN ANATOMY & PHYSIOLOGY. Ms. K. GOWRI. M.Pharm., Lecturer.

CHAPTER II PDL 101 HUMAN ANATOMY & PHYSIOLOGY. Ms. K. GOWRI. M.Pharm., Lecturer. CHAPTER II PDL 101 HUMAN ANATOMY & PHYSIOLOGY Ms. K. GOWRI. M.Pharm., Lecturer. Structure of cell: Human body develops from a single cell zygote which results from fusion of the ovum andd the spermatozoan.

More information

number Done by Corrected by Doctor Nayef Karadsheh

number Done by Corrected by Doctor Nayef Karadsheh number 11 Done by حسام أبو عوض Corrected by Moayyad Al-Shafei Doctor Nayef Karadsheh 1 P a g e General Regulatory Aspects in Metabolism: We can divide all pathways in metabolism to catabolicand anabolic.

More information

Maturity-onset diabetes of the young (MODY) is a heterogeneous group

Maturity-onset diabetes of the young (MODY) is a heterogeneous group Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the

More information

Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases

Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin

More information

CELLS. Cells. Basic unit of life (except virus)

CELLS. Cells. Basic unit of life (except virus) Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%

More information

WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA

WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 18, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 18, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 18, 2016 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical

More information

Regulation of Enzymatic Activity. Lesson 4

Regulation of Enzymatic Activity. Lesson 4 Regulation of Enzymatic Activity Lesson 4 Regulation of Enzymatic Activity no real regulation: - regulation of enzyme expression and turnover - control of enzyme trafficking - supply of cofactors real

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7

More information

Cell Signaling part 2

Cell Signaling part 2 15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

More information

Cell Communication. Local and Long Distance Signaling

Cell Communication. Local and Long Distance Signaling Cell Communication Cell to cell communication is essential for multicellular organisms Some universal mechanisms of cellular regulation providing more evidence for the evolutionary relatedness of all life

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 16, 2017 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

* Kyoto Encyclopedia of Genes and Genomes.

* Kyoto Encyclopedia of Genes and Genomes. Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

More information

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,

More information

MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #:

MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #: For this first section, circle the letter that precedes the best answer for each of the following multiple-choice questions. LOOK AT ALL ALTERNATIVES BEFORE CHOOSING YOUR ANSWER. 1. The TcR (T cell receptor)

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Principles of cell signaling Lecture 4

Principles of cell signaling Lecture 4 Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway

More information

201291_s_at Consensus includes gb:au /FEA=EST /DB_XREF=gi: /DB_XREF=est:AU /CLONE=Y79AA /UG=Hs topoisomerase (DNA)

201291_s_at Consensus includes gb:au /FEA=EST /DB_XREF=gi: /DB_XREF=est:AU /CLONE=Y79AA /UG=Hs topoisomerase (DNA) 201291_s_at Consensus includes gb:au159942 /FEA=EST /DB_XREF=gi:11021463 /DB_XREF=est:AU159942 /CLONE=Y79AA1000724 /UG=Hs.156346 topoisomerase (DNA) II alpha (170kD) /FL=gb:J04088.1 gb:nm_001067.1 201664_at

More information

Endocrine System Hormones (Ch. 45)

Endocrine System Hormones (Ch. 45) Endocrine System Hormones (Ch. 45) Regulation Why are hormones needed? chemical messages from one body part to another communication needed to coordinate whole body daily homeostasis & regulation of large

More information

MT09 - Normal Human Tissue Microarray, FDA

MT09 - Normal Human Tissue Microarray, FDA Reveal Biosciences offers Histochemical Staining, Immunohistochemistry (IHC), In Situ Hybridization (ISH), Whole Slide Imaging, and Quantitative Image Analysis on any TMA MT09 - Normal Human Tissue Microarray,

More information

Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed

Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed Supplementary Information Table S1. Differentially expressed transcripts between hepatic inkt cells sorted form and plck-hcd1d tg mice. Differentially expressed transcripts identified by gene expression

More information

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in

More information

Endocrine System Hormones. AP Biology

Endocrine System Hormones. AP Biology Endocrine System Hormones 2007-2008 Regulation Why are hormones needed? u chemical messages from one body part to another u communication needed to coordinate whole body u daily homeostasis & regulation

More information

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.

More information

Human Anatomy & Physiology

Human Anatomy & Physiology PowerPoint Lecture Slides prepared by Barbara Heard, Atlantic Cape Community College Ninth Edition Human Anatomy & Physiology C H A P T E R 3 Annie Leibovitz/Contact Press Images 2013 Pearson Education,

More information

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters

More information

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse

More information

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12864 Supplementary Table 1 1 2 3 4 5 6 7 Peak Gene code Screen Function or Read analysis AMP reads camp annotation reads minor Tb927.2.1810 AMP ISWI Confirmed

More information

Chemistry 107 Exam 4 Study Guide

Chemistry 107 Exam 4 Study Guide Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and

More information

Foundations in Microbiology

Foundations in Microbiology Foundations in Microbiology Fifth Edition Talaro Chapter 15 The Acquisition of Specific Immunity and Its Applications Chapter 15 2 Chapter Overview 1. Development of the Dual Lymphocyte System 2. Entrance

More information

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation

More information

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving

More information

Protein Trafficking in the Secretory and Endocytic Pathways

Protein Trafficking in the Secretory and Endocytic Pathways Protein Trafficking in the Secretory and Endocytic Pathways The compartmentalization of eukaryotic cells has considerable functional advantages for the cell, but requires elaborate mechanisms to ensure

More information

Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system

Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds

More information

Lymphatic System. Where s your immunity idol?

Lymphatic System. Where s your immunity idol? Lymphatic System Where s your immunity idol? Functions of the Lymphatic System Fluid Balance Drains excess fluid from tissues Lymph contains solutes from plasma Fat Absorption Lymphatic system absorbs

More information

Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective

Thanks to: Signal Transduction. BCB 570 Signal Transduction 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication

More information

Biology 12 November 2002 Provincial Examination

Biology 12 November 2002 Provincial Examination Biology 12 November 2002 Provincial Examination ANSWER KEY / SCORING GUIDE CURRICULUM: Organizers 1. Cell Biology 2. Cell Processes and Applications 3. Human Biology Sub-Organizers A, B, C, D E, F, G,

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information

Project Summary. Characterization of intramuscular adipogenesis in cattle

Project Summary. Characterization of intramuscular adipogenesis in cattle Project Summary Characterization of intramuscular adipogenesis in cattle Principal Investigators: J. B. Morgan, R. D. Geisert, U. DeSilva, C. R. Krehbiel, J. R. Malayer, and D. Stein Oklahoma State University

More information

ACCESSORY PUBLICATION. Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals. after tick larval challenge e

ACCESSORY PUBLICATION. Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals. after tick larval challenge e ACCESSORY PUBLICATION Supplementary Table 1. Genes up regulated in the skin of both HR and LR animals after tick larval challenge e GenBank Accession a No. of elemen ts b t=0 Signal intensity c t=0 Description

More information

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A). Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease

More information

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity

More information

Cell Signaling (part 1)

Cell Signaling (part 1) 15 Cell Signaling (part 1) Introduction Bacteria and unicellular eukaryotes respond to environmental signals and to signaling molecules secreted by other cells for mating and other communication. In multicellular

More information

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) - MHC molecules were initially discovered during studies aimed

More information

Revision. camp pathway

Revision. camp pathway االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition

More information

Cell Physiology Final Exam Fall 2008

Cell Physiology Final Exam Fall 2008 Cell Physiology Final Exam Fall 2008 Guys, The average on the test was 69.9. Before you start reading the right answers please do me a favor and remember till the end of your life that GLUCOSE TRANSPORT

More information

Tala Saleh. Ahmad Attari. Mamoun Ahram

Tala Saleh. Ahmad Attari. Mamoun Ahram 23 Tala Saleh Ahmad Attari Minna Mushtaha Mamoun Ahram In the previous lecture, we discussed the mechanisms of regulating enzymes through inhibitors. Now, we will start this lecture by discussing regulation

More information

NBCE Mock Board Questions Biochemistry

NBCE Mock Board Questions Biochemistry 1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation

More information

PCB 3023 Exam 4 - Form A First and Last Name

PCB 3023 Exam 4 - Form A First and Last Name PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this

More information

Immune system. Aims. Immune system. Lymphatic organs. Inflammation. Natural immune system. Adaptive immune system

Immune system. Aims. Immune system. Lymphatic organs. Inflammation. Natural immune system. Adaptive immune system Aims Immune system Lymphatic organs Inflammation Natural immune system Adaptive immune system Major histocompatibility complex (MHC) Disorders of the immune system 1 2 Immune system Lymphoid organs Immune

More information

Activation of the endocannabinoid system by organophosphorus nerve agents

Activation of the endocannabinoid system by organophosphorus nerve agents 1 Supplementary Information Activation of the endocannabinoid system by organophosphorus nerve agents Daniel K. Nomura, 1 Jacqueline L. Blankman, 2 Gabriel M. Simon, 2 Kazutoshi Fujioka, 1 Roger S. Issa,

More information

Development of B and T lymphocytes

Development of B and T lymphocytes Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell

More information

Chapter 3 Part 2! Pages (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis!

Chapter 3 Part 2! Pages (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis! Chapter 3 Part 2! Pages 65 89 (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis! The Cell Theory! Living organisms are composed of one or more cells.!

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The

More information

INTEREST GRABBER NOTEBOOK #1

INTEREST GRABBER NOTEBOOK #1 INTEREST GRABBER NOTEBOOK #1 AN IMPORTANT PROCESS While walking along a dusty path, you begin to cough. As you continue your walk, a small insect comes flying toward you. You blink and then duck so that

More information

Signal Transduction: G-Protein Coupled Receptors

Signal Transduction: G-Protein Coupled Receptors Signal Transduction: G-Protein Coupled Receptors Federle, M. (2017). Lectures 4-5: Signal Transduction parts 1&2: nuclear receptors and GPCRs. Lecture presented at PHAR 423 Lecture in UIC College of Pharmacy,

More information

Regulation of Glucose Metabolism by Intracellular Compounds

Regulation of Glucose Metabolism by Intracellular Compounds Regulation of Metabolism by Intracellular ompounds Hexokinase ( ) -6- H ribose-5- or fructose-6- -6-phosphate () ( ) H -6-phosphate GI GM UD-glucose pyrophosphorylase 1-phosphate UD- hosphorylase synthase

More information

BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION

BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your

More information

BIO 5099: Molecular Biology for Computer Scientists (et al)

BIO 5099: Molecular Biology for Computer Scientists (et al) BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being a Eukaryote: From DNA to Protein, A Tour of the Eukaryotic Cell. Christiaan van Woudenberg Being A Eukaryote Basic eukaryotes

More information

Animal and Veterinary Science Department University of Idaho. REGULATION OF REPRODUCTION AVS 222 (Instructor: Dr. Amin Ahmadzadeh) Chapter 5

Animal and Veterinary Science Department University of Idaho. REGULATION OF REPRODUCTION AVS 222 (Instructor: Dr. Amin Ahmadzadeh) Chapter 5 Animal and Veterinary Science Department University of Idaho REGULATION OF REPRODUCTION AVS 222 (Instructor: Dr. Amin Ahmadzadeh) Chapter 5 I. DEFINITIONS A. Endocrine Gland B. Hormone Chemical messenger

More information

Chapter 10. 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation)

Chapter 10. 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation) Chapter 10 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation) 1 Fueling Processes Respiration 1 Most respiration involves use of an electron transport chain As electrons pass through the electron

More information

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive

More information

Supplemental Table 1 Age and gender-specific cut-points used for MHO.

Supplemental Table 1 Age and gender-specific cut-points used for MHO. Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123

More information

MECHANISM AND MODE OF HORMONE ACTION. Some definitions. Receptor: Properties of receptors. PRESENTED BY MBUNKUR GLORY NKOSI.

MECHANISM AND MODE OF HORMONE ACTION. Some definitions. Receptor: Properties of receptors. PRESENTED BY MBUNKUR GLORY NKOSI. MECHANISM AND MODE OF HORMONE ACTION. PRESENTED BY MBUNKUR GLORY NKOSI. OUTLINE. Introduction Some definitions Hormone secretion, transport, and clearance from the blood. Feedback control of hormone secretion.

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

Endocrine Glands and Hormones "What are endocrine glands and what do they make?

Endocrine Glands and Hormones What are endocrine glands and what do they make? Endocrine Glands and Hormones "What are endocrine glands and what do they make? Model 1:Development of glands. Exocrine Gland Endocrine Gland Critical thinking questions 1. Based on the model, which of

More information

Effects of Second Messengers

Effects of Second Messengers Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many

More information

Ayman Mesleh & Leen Alnemrawi. Bayan Abusheikha. Faisal

Ayman Mesleh & Leen Alnemrawi. Bayan Abusheikha. Faisal 24 Ayman Mesleh & Leen Alnemrawi Bayan Abusheikha Faisal We were talking last time about receptors for lipid soluble hormones.the general mechanism of receptors for lipid soluble hormones: 1. Receptors

More information