Kerdiles et al - Figure S1
|
|
|
- Marilyn Fowler
- 5 years ago
- Views:
Transcription
1 Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ
2 Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a) Expression profile of Foxo1 in mouse and (b) human tissues and cell subsets according to the Gene Atlas from the Genomics Institute of the Novartis Foundation (GNF) ( (c) Immunoblot analysis of Foxo1 expression in purified cells subsets. T and B cells were isolated from LN and spleen respectively. Macrophages and Polymorphonuclear cells (PMNs) were isolated from the peritoneal cavity of mice elicited with thioglycolate. Representative results from two independent experiments. 1
3 Kerdiles et al - Figure S2 a Foxo1 f/f Cd4Cre T cell-dna Foxo1 f/f Foxo1 f/f Tail-DNA Foxo1 f/+ Foxo1 Foxo1 f Foxo1 + b Foxo1 f/f Foxo1 f/f Cd4Cre Foxo1 f/f Foxo1 f/f Cd4Cre Foxo1 β-tubulin T cells B cells c Foxo1 f/f Foxo3 +/Kca Foxo3 Kca/Kca Foxo1 f/f Foxo3 +/+ Cd4Cre Foxo3 Foxo1 PLCγ T cells
4 Supplementary Figure 2 Efficient deletion of Foxo1 in peripheral T cells of Foxo1 f/f CD4Cre mice. (a) PCR analysis of Foxo1 genomic deletion in purified LN T cells and tail sample. (b) Immunoblot analysis of Foxo1 expression in purified LN T and B cells. (c) Immunblot analysis of Foxo1 and Foxo3 expression in purified LN T cells. Representative results from two to four experiments (a-c). 2
5 Kerdiles et al - Figure S3 a pln 1.2 TCRβ+ CD4+ Foxo1f/f Foxo1f/fCd4Cre 4.7 IL IL b 12.3 CD44hi T CD4 T CD8 CD IFNγ IFNγ 18 Foxo1f/fCd4Cre TNF mln 1.2 Foxo1f/f TCRβ+ CD8+ CD62L Foxo1f/f Foxo1f/fCd4Cre
6 Supplementary Figure 3 Foxo1 deletion in T cells induces the accumulation of activated and memory phenotype T cells in peripheral lymphoid organs. (a) LN cells from individual mice were stimulated for 4.5 h with PMA and ionomycin, in presence of Brefeldin A for the last 3 h. Stimulated cells were then surface stained, fixed, permeabilzed and intracellularly-stained for the indicated cytokines. (pln: peripheral lymph nodes (inguinal, brachial, axillary), mln: mesenteric lymph nodes). Representative results from n 6 mice per genotype analyzed in three independent experiments. (b) CD69 and CD62L expression on LN CD44 hi TCRβ + CD4 + and TCRβ + CD8 + cells of 8-12 week-old mice. Representative results for n 8 mice per staining and per genotype, analyzed in at least three independent experiments. 3
7 Kerdiles et al - Figure S4 a Foxo1 +/+ LckCre Foxo1 f/f LckCre CD CD8 b TCRb hi CD24 lo (%) 10.0 ns Foxo1 +/+ LckCre Foxo1 f/f LckCre TCRb hi CD24 lo (%) *** CD4 + CD8 + Foxo1 +/+ LckCre Foxo1 f/f LckCre
8 Supplementary Figure 4 Foxo1 is dispensable for T cell development. (a) CD4 and CD8 expression and (b) proportion of mature T cells (TCRβ hi HSA lo ) and percentage of CD4 + and CD8 + single positive cells among TCRβ hi HSA lo cells (mean±s.e.m.) on thymocytes of 8-week-old mice. Each circle indicates one mouse. Data represent n = 5 Foxo1 +/+ and n = 7 Foxo1 f/f mice, analyzed in two independent experiments (a and b) (***,p<0.0001; ns: not significant). 4
9 Kerdiles et al - Figure S5 TCRβ hi DP CD4 + CD8 + L-selectin CCR7 CD44 CD127 Bcl-2 Isotype Foxo1 f/f Foxo1 f/f ;CD4Cre
10 Supplementary Figure 5 Impaired expression of L-selectin, Ccr7 and IL-7Rα on thymic mature T cells. Representative results of n 6 mice per staining and per genotype, analyzed in at least two independent experiments. 5
11 b 10 T cells Tamox Foxo PLCγ xo Fo xo 1 f/f 1 f/f ER C re a Foxo1 mrna (relative) Kerdiles et al - Figure S6 d Fo CD4 81 Foxo1f/fERCre 40 CD8 58 CD Bim mrna (relative) Foxo1f/f Foxo3a mrna (relative) c Foxo1f/f Foxo1f/fERCre
12 Supplementary Figure 6 Short term tamoxifen treatment induces efficient deletion of Foxo1 and does not alter the ratio of naïve to activated-memory phenotype T cells in Foxo1 f/f ERCre mice. (a-d) Foxo1 f/f ERCre mice and littermates were treated for 5 days with tamoxifen and rested for 5 days. (a) QPCR anaysis of Foxo1 mrna expression, normalized to Hprt mrna, in purified LN T cells. (b) Immunoblot analysis of Foxo1 expression in purified LN T cells. Representative results of three independent experiments. (c) CD44 expression by LN TCRβ + CD4 + and TCRβ + CD8 + cells. (d) QPCR analysis of Foxo3 and Bim mrna expression, normalized to Hprt mrna, in purified LN T cells. Each circle indicates one mouse (a and d). Data represent n 6 mice analyzed in at least two independent experiments (a, c and d) (***,p<0.0001; ns: not significant). 6
13 Kerdiles et al - Figure S7 a ECR 1 2 Il7ra 3 Opposum Human Chimp Dog Rhesus Rat 0 b Mouse Dog Human Macaque Opossum Mouse Dog Human Macaque Opossum Mouse Dog Human Macaque Opossum Mouse Dog Human Macaque Opossum Mouse Dog Human Macaque Opossum 10Kb 20Kb AATTGTATCATGTCTCT AGGTGTCATGAATTGCT--CAGATTGTCACTCCATGGGTGAGTAATTGGGTTGTGTCTCT AAATCTCCTAAACTGCTAACAGATTGTCACTTCATGGGTGAGTAACTGGGTTATGTCTCT AGATCTCCTAAACGGCTAACAGATTGTCACTTCATGGGTGAGTAACTGGGTCATGTCTCT AATTGGGTAATGTCTCT ** ** * ******* FoxO TTAAATTCTCTTGTTTATCATTTAAGTGGACCATCATTTTGATTGTATCTCTTTCCTTTA TTAAATTCTCTTGTTTATCATTTTAGTGGACTATCATTTTGATTGTATCTCTTTCCTTTA TTAAATTCTCTTGTTTATCATTTAAGTGGACTATCATTTTGATTGTATCTCTTTCCTTTA TTAAATTCTCTTGTTTATCATTTAAGTGGACTATCATTTTGATTGTATCTCTTTCCTTTA TTAAATTCTCTTGTTTATCACTTAAATGGACTATCATTTTGATTTTATCTCTTTCCTTCA ******************** ** * ***** ************ ************* * GR GTTGTGAAGATGTAAAAGAACAAAGTTAAGACATAATATTTTGGTACAGCATGTGCTAGT GTTGTGAAGATGTAAAAGAACAAAGCCAAGACACAATATTTTGGTACAGCATGTGCTAGT GTTGTGAAGATGTAAAAGAACAAAGCCAAGACACAATATTTTGGTACAGCATGTGCTGGT GTTGTGAAGATGTAAAAGAACAAAGCCAAGACACAATATTTTGGTACAGCATGTGCTGGT GATGTGAAG---CAAAAGAACAAAAA-AGGGCACAATATTTTGGTTCGGCTTGTGATCTT * ******* *********** * * ** *********** * ** **** * * NF-κB SP1 TTGCTCAGGGGATTTCCACTGGTGTGCTTACCCCTTTTGGGTGGGG-CAGGAGATGCTGA TTGCTCAGGGGATTTCCACTGGTGTACTTACTCTTTTTGGGTGGGG-CAGGAGATGCCGA TTGTTCTGGGGATTTCCACAGGGGTGCTTACTCT---TGGGTGGGG-CAGGAGATGCTGA TTGTTCTGGGGATTTCCACAGGGGTGCTTACTTTC--TGGGTGGGG-CAGGAGATGCTGA CAGCTCAGGGGATTTCCACTGGTATGTTCTCTTC----GGGTGGGGACAGGGGATGCTCT * ** ************ ** * * * ******** **** ***** A-AGGACATCAGAGAGAAATCTAAATAGAGTGCGGGAAGCTTAAAG A-GGACC--TAGAGAGAAACCTAGATATAGTGCGGGGAGCTCAAAGAAAA--GAGAAGTC A-AAGACCTCAGAGAGAAGCCTAAA----GTGTGGGGAGCTCAAAGAAAAATGACATGCG A-AAGACCTCAGAGAGAAGCCTAAA----GTGTGGGGAGCTCAAAGAAAAATGACATGCA CTGAGGAACCAGAGAGGAGCCCAAA------GAGAGCTGCCACAAG ****** * * * * * * * ** ***
14 Supplementary Figure 7 Genomic sequence alignment of the Il7ra enhancer. (a) Comparative alignment of the Il7ra loci from NCBI decode.org ( (b) The aligned sequences from ECR2 showing the conserved Foxo, glucocorticoid receptor (GR), and NFκB binding sites. 7
15 Kerdiles et al - Figure S8 TCRβ + CD4 + CD44 lo TCRβ + CD8 + CD44 lo L-Selectin C57BL/6 IL-7Rα / CCR7
16 Supplementary Figure 8 IL-7Rα is not required for L-selectin and Ccr7 expression on naïve T cells. L-selectin and Ccr7 expression on spleen CD44 lo CD4 + and CD8 + T cells from wildtype and Il7ra / mice. Representative results of n = 4 mice per genotype. 8
17 Kerdiles et al - Figure S9 a b Il7ra TCRβ + CD4 + CD44 lo TCRβ + CD8 + CD44 lo CD8 + CD44 lo CD4 + CD44 lo CD127 *** *** CD127 MFI (%) Pten +/+ ERCre Pten f/f ERCre L-selectin * *** L-selectin MFI (%) c Il7ra mrna ( fold change ) Il7ra mrna (relative) *** Pten +/+ ;ERCre Pten f/f ;ERCre 12 * Pten +/+ ERCre 10 Pten f/f ERCre ** 0 IL-7
18 Supplementary Figure 9 PTEN-mediated control of IL-7Rα and L-selectin on naïve T cells. (a-c) Mice were treated with tamoxifen for 5 days and rested for 5 days. (a) Quantification of CD127 and L-selectin expression on LN CD44 lo TCRβ + CD4 + and TCRβ + CD8 + cells (mean ± s.e.m.). Data represent n=7 Pten +/+ and n=9 Pten f/f mice (CD127); and n=3 PTEN +/+ and n=6 PTEN f/f mice (L-selectin), analyzed in two independent experiments. (b) QPCR analysis of Il7ra mrna expression, normalized to Hprt mrna, in purified LN T cells. Each circle indicates one mouse. (c) Purified LN T cells were cultured overnight in media supplemented or not with IL-7 (10 ng/ml) and Il7ra mrna was quantified by QPCR. Results are presented as fold change (mean ± s.d. of triplicate culture) relative to the value obtained for freshly isolated T cells set to 1. Representative results of two independent experiments (*,p<0.05; **, p<0.01; ***,p<0.0001). 9
19 Supplementary Table I Antibodies Antibody specificity Clone Identifier Source TCRbeta H ebioscience CD44 IM7 ebioscience CD4 GK1.5 ebioscience CD BioLegend CD24 30-F1 BD Biosciences L-selectin (CD62L) MEL-14 ebioscience CCR7 4B12 ebioscience CD45.1 A20 ebioscience CD ebioscience Bcl-2 10C4 Santa Cruz Biotechnology IL-7R (CD127) A7R34 ebioscience gc (CD132) 4G3 BD Biosciences b-tubulin AA2 Upstate-Millipore PLCg B-6-4 Santa Cruz Biotechnology IL-4 11B11 ebioscience IL-17 TC11-18H10 BD Biosciences IFNg XMG1.2 ebioscience TNF MP6-XT22 ebioscience CD69 H1.2F3 ebioscience Foxo1 76E10 Cell Signaling Foxo3 Rabbit anti-mouse Foxo3 Gift, A. Brunet, Stanford U
20 Supplementary Table II Primers used to quantitate gene expression Primer sequence Gene tcattatgccgaggatttgga Hprt S cagagggccacaatgtgatg Hprt AS tgtcaggctaagagttagtgagca Foxo1 S gggtgaagggcatctttg Foxo1 AS aagtggaaatgcccaggat Il7ra S ttgacttccatccacttcca Il7ra AS ggttactgaataccaagggaacttt IL2rg S tggcagaaccgttcactgta IL2rg AS ctaaaggcgcatctgcgta Klf2 S tagtggcgggtaagctcgt Klf2 AS tgatttctacagcccccaga Ccr7 S gcacacctggaaaatgacaa Ccr7 AS ccaagtgtgctttcaactgttc Sell S aaaggctcacactggaccac Sell AS ggagacgagttcaacgaaactt Bim S aacagttgtaagataaccatttgagg Bim AS aagcaggcctcatctcaaag Foxo3 S cgtcagtttgagggtctgc Foxo3 AS Supplementary Table III Primers used for Chromatin Immunoprecipitation (ChIP) Primer sequence Il7ra gene region acctcatcagcctttcatgg Il7ra-ECR2 S atcccctgagcaaactagca Il7ra-ECR2 AS agcaaaaggattgctgctgt Il7ra-ECR1 S aagtgtggattttggcttg Il7ra-ECR1 AS tcttgggtgttgatgtggaa Il7ra-ECR3 S gtgccaggcttctttcata Il7ra-ECR3 AS 1
CD44
MR1-5-OP-RU CD24 CD24 CD44 MAIT cells 2.78 11.2 WT RORγt- GFP reporter 1 5 1 4 1 3 2.28 1 5 1 4 1 3 4.8 1.6 8.1 1 5 1 4 1 3 1 5 1 4 1 3 3.7 3.21 8.5 61.7 1 2 1 3 1 4 1 5 TCRβ 2 1 1 3 1 4 1 5 CD44 1 2 GFP
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
Supplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Supplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Supplementary Figures
MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,
Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells
Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity
Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
Foxo Transcription Factors Control Regulatory T Cell Development and Function
Article Foxo Transcription Factors Control Regulatory T Cell Development and Function Yann M. Kerdiles, 1,3,4 Erica L. Stone, 1,3 Daniel L. Beisner, 1, Maureen A. McGargill, 2 Irene L. Ch en, 1 Christian
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
SUPPORTING INFORMATIONS
SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression.
Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. (a) Characterization of c-independent SP8 cells. Stainings for maturation markers (top)
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C
CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Table S1. Viral load and CD4 count of HIV-infected patient population
Table S1. Viral load and CD4 count of HIV-infected patient population Subject ID Viral load (No. of copies per ml of plasma) CD4 count (No. of cells/µl of blood) 28 7, 14 29 7, 23 21 361,99 94 217 7, 11
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.
Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Transcription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Supplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)
Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Supplementary Table e-1. Flow cytometry reagents and staining combinations
Supplementary data Supplementary Table e-1. Flow cytometry reagents and staining combinations Reagents Antibody Fluorochrome Clone Source conjugation CD3 FITC UCHT1 BD Biosciences CD3 PerCP-Cy5.5 SK7 Biolegend
Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
Supplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
Mouse Clec9a ORF sequence
Mouse Clec9a gene LOCUS NC_72 13843 bp DNA linear CON 1-JUL-27 DEFINITION Mus musculus chromosome 6, reference assembly (C57BL/6J). ACCESSION NC_72 REGION: 129358881-129372723 Mouse Clec9a ORF sequence
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
Nature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
Maintaining T lymphocytes in sufficient numbers and at an
NF-κB signaling mediates homeostatic maturation of new T cells Ana Silva, Georgina Cornish 1, Steven C. Ley, and Benedict Seddon 2,3 Division of Immune Cell Biology, Medical Research Council National Institute
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Mst1 regulates integrin-dependent thymocyte trafficking and antigen recognition in the thymus
Mst1 regulates integrin-dependent thymocyte trafficking and antigen recognition in the thymus Yoshihiro Ueda, Koko Katagiri, Takashi Tomiyama, Kaneki Yasuda, Katsuyoshi Habiro, Tomoya Katakai, Susumu Ikehara,
Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
![Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.](/thumbs/90/103696086.jpg "Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.")
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Transduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
Dendritic cells in cancer immunotherapy Aimin Jiang
Dendritic cells in cancer immunotherapy Aimin Jiang Feb. 11, 2014 Dendritic cells at the interface of innate and adaptive immune responses Dendritic cells: initiators of adaptive immune responses Dendritic
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice
SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,
T cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
Supplementary Figure 1. Ex vivo IFNγ production by Tregs. Nature Medicine doi: /nm % CD127. Empty SSC 98.79% CD25 CD45RA.
SSC CD25 1.8% CD127 Empty 98.79% FSC CD45RA CD45RA Foxp3 %IFNγ + cells 4 3 2 1 + IL-12 P =.3 IFNγ p=.9 %IL-4+ cells 3 2 1 IL-4 P =.4 c %IL-1 + cells IFNγ 4 3 2 1 Control Foxp3 IL-1 P =.41.64 4.76 MS 2.96