Supplementary Figures
|
|
- Loreen Rose
- 5 years ago
- Views:
Transcription
1 MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3, Minmin Hua 3, Nan Li 1, Hangping Yao 2 & Xuetao Cao 1,2,4 Supplementary Figures Supplementary Fig. 1 Signature of in vitro differentiated helper T cells and sorted natural Tregs. (a) IL-4, IL-17A and Foxp3 mrna expression of different CD4 + T cells subsets and natural Tregs was measured by qpcr and normalized to β-actin mrna. Data are shown as mean ± s.e.m. (b) Intracellular cytokine staining for each helper T cell subsets after in vitro differentiation. Data are representative of 1
2 three independent experiments. 2
3 Supplementary Fig. 2 Analysis of mouse putative mir-29b-1-mir-29a promoter. (a) The diagram illustrates the location and length of the putative mir-29b-1-mir-29a promoter. Three YY1 and two NF-κB binding sites are located in the 1560bp putative promoter. The positions of the primers for ChIP are also indicated. (b) Two specific primers (primer#2, primer#3) for mir-29b-1-mir-29a promoter were used to detect the DNA bond by YY1. Data are shown as mean ± s.e.m of three independent experiments. (c) Human and mouse sequences of the two putative NF-κB binding sites (red) and their flanking regions in mir-29b-1-mir-29a promoter. 3
4 Supplementary Fig. 3 Regulation of IFN-γ production in T-bet-transfected EL4 cells by mir-29 mimics or inhibitor. (a) ELISA of IFN-γ in supernatants of EL4 cells transfected with T-bet vector and mir-29b mimics (left) or mir-29b inhibitor (right), 12 h (for mimics) or 24 h (for inhibitor) later, stimulated with PMA plus ionomycin for the indicated times. (b,c) Flow cytometry analysis of IFN-γ expression (b) and cell apoptosis (c) in EL4 cells transfected with T-bet vector and mir-29a mimics, 24 h later, stimulated with PMA plus ionomycin. Data are shown as mean ± s.e.m of three independent experiments (a) or are representative of three independent experiments (b-c). *P <
5 Supplementary Fig. 4 Downregulation of IFN-γ mrna in T-bet-transfected EL4 cells by mir-29 mimics. Quantitative RT-PCR assay of IFN-γ mrna expression in EL4 cells transfected with T-bet vector and mir-29 mimics, 24 h later, stimulated with PMA plus ionomycin for the indicated times. Data are shown as mean ± s.e.m of three independent experiments. *P <
6 Supplementary Fig. 5 Targets prediction of mir-29 and verification by reporter gene system. (a) The 3 UTRs of T-bet and Eomes mrna contain binding sites of mir-29 family, which are highly conserved in mammalian. (b-c) Luciferase activity in lysates of HEK293T cells transfected with T-bet (b) or Eomes (c) 3 UTR constructs, plus negative control (Ctrl), mir-29a, mir-29b, mir-29c mimics or inhibitors. Data are shown as mean ± s.e.m (b-c). *P < 0.05 and **P <
7 Supplementary Fig. 6 Increased IFN-γ production in activated CD4 + T and CD8 + T cells transfected with mir-29a inhibitor. (a) Quantitative RT-PCR assay of mir-29a expression in CD4 + T cells from OT-II transgenic mice and CD8 + T cells from OT-I transgenic mice transfected with control inhibitor or mir-29a inhibitor, 12 h later, incubated with DC pulsed with OVA (for CD4 + T cells), or OVA (for CD8 + T cells) for 72 h. (b) ELISA of IFN-γ in supernatant of CD4 + T cells and CD8 + T cellsdescribed in (a). Data are shown as mean ± s.e.m of three independent experiments. *P <
8 Supplementary Fig. 7 Effector and memory markers of CD4 + and CD8 + T cells transfected with LV-Ctrl and LV-29a. Flow cytometry analysis of CD25, CD69, CD44, CD127 and CD62L expression in CD4 + and CD8 + T cells transfected with LV-Ctrl or LV-29a lentivirus, and then activated with anti-cd3 plus anti-cd28 mab for 3 d. Data are representative of three independent experiments. 8
9 Supplementary Fig. 8 Endogenous mir-29 has no effect on T H 1 cell differentiation. (a) Induction efficiency of T H 1, T H 2 and T H 17 cells from LV-Ctrl, LV-miR-29a and LV-29sponge transfected CD4 + T cells, determined by flow cytometry. GFP positive cells were gated and analyzed. (b) Flow cytometry analysis of IFN-γ production in T H 1 cells cultured with 10 μg/ml anti-ifn-γ mab or isotype control. Percent of IFN-γ producing cells and their MFI were shown in the dot plot. Data are shown as mean ± s.e.m of three independent experiments (a) or representative of three independent experiments (b). *P <
10 Supplementary Fig. 9 Construction and verification of GS29 mice. (a) UBC-29sponge expression vector contained GFP gene and a 3 UTR which consisted of 7 repeats of mir-29 sponge. (b) The working model of mir-29 sponge. UBC-29sponge expression vector with UBC promoter produced large amount of mir-29 sponge mrna which can absorb endogenous mir-29 efficiently. Transient mir-29 knockdown in cell culture and mir-29 knockdown in transgenic mice can be achieved by delivering UBC-29sponge expression vector into cultured cells and one-cell eggs, respectively. (c) Five GS29 founder mice (#26, #34, #56, #68, #85) were constructed (top panel), the F1 generation of three founder mice (#34, #56, #85) were generated by mating founder mice and wild type C57/BL6 mice (bottom panel). All the mice were identified by PCR assays of genomic DNA extracted from the tails of transgenic mice. GS29 is the characteristic fragment of mir-29 sponge expression vector. Data are representative of three independent experiments.
11 Supplementary Fig. 10 Primary and mature mir-29 mrna in the immune cells from GS29 mice. (a) Northern blot analysis of mature mir-29a in NK cells, CD4 + and CD8 + T cells from GS29 or littermate control mice. U6 mrna serves as a loading control. (b,c) Quantitative RT-PCR assay of mature (b) and primary (c) mir-29a mrna in NK cells, CD4 + T and CD8 + T cells. Data are representative of three independent experiments (a) or are shown as mean ± s.e.m of three independent experiments (b-c). *P < 0.01.
12 Supplementary Fig. 11 Development of T cell subsets and NK cells in GS29 mice. (a) The thymic TCRβ, CD4, CD8 profile in GS29 and littermate control mice at 6 weeks old. (b) Splenic CD4 + T and CD8 + T cell subsets and natural Treg frequencies. (c) Expression of CD44 and CD62L in splenic CD4 + T and CD8 + T cell from GS29 and littermate control mice. Percent of CD44 hi CD62L lo, CD44 hi CD62L hi and CD44 lo CD62L lo cells are indicated. (d) The number of live CD4 + T and CD8 + T cells isolated from GS29 and littermate control mice and stimulated with plate coated anti-cd3 plus anti-cd28 mab for 72 h. (e)the development of NK cells from GS29 and littermate control mice. Data are representative of three experiments (a,b,c,e) or are shown as mean ± s.e.m of three independent experiments (d).
13 Supplementary Fig. 12 mir-29 did not regulate the T-bet and Eomes expression. (a) Flow cytometry analysis of T-bet and Eomes expression in activated CD4 + T and CD8 + T cells transfected with LV-Ctrl or LV-29a lentivirus. (b) Flow cytometry analysis of T-bet and Eomes expression in activated CD4 + T and CD8 + T cells from control or GS29 mice. Data are representative of three independent experiments.
14 Supplementary Fig. 13 Expression of IFN-γ mrna and mir-29a in the immune cells from GS29 mice infected with intracellular pathogen. (a,b) Quantitative RT-PCR assay of IFN-γ and mir-29a mrna expression in NK cells from control and GS29 mice infected by LM for the indicated time. (c,d) Quantitative RT-PCR assay of IFN-γ and mir-29a mrna expression in CD4 + and CD8 + T cells from control and GS29 mice infected by BCG. Data are shown as mean ± s.e.m of three independent experiments. *P < 0.05.
15 Supplementary Fig. 14 GS29 mice exhibit more resistance to BCG infection. (a) H&E (left, 50) and immunohistochmical staining of IFN-γ (right, 400) of lung from littermate control and GS29 mice 4 weeks after i.v. infection with BCG. (b) Intracellular IFN-γ staining of CD4 + T and CD8 + T lymphocytes isolated from lung in (a). Data are representative of three independent experiments.
16 Supplementary Fig. 15 GS29 mice exhibit more resistants to H37Rv infection. (a) Survival of GS29 and control mice after i.v. infection with virulent H37Rv. (n=12 per genotype). P < 0.05 (Wilcoxon test). (b) H37Rv burden in lung from GS29 and control mice 21 days after i.v. infection with H37Rv. Data are shown as mean ± s.e.m of three independent experiments. *P < 0.01.
17 Supplementary Fig. 16 Working model for the control of IFN-γ-mediated innate and adaptive immune responses by mir-29 via targeting IFN-γ
18 Supplementary methods RNA isolation, reverse transcrption and real time quantitative PCR (qpcr). Total RNA was extracted with TRIzol (Invitrogen) or mirneasy Mini Kit (Qiagen). qpcr analysis was performed by using LightCycer (Roche, Basel, Switherland) and SYBR RT-PCR kit (Toyobo, OSAKA, Japan). Primer pairs are listed below: gene primers sequences (5' to 3') mouse Forward GAACTGGCAAAAGGATGGTGA IFN-γ Reverse TGTGGGTTGTTGACCTCAAAC human Forward CTCTTGGCTGTTACTGCCAGG IFN-γ Reverse CTCCACACTCTTTTGGATGCT mouse Forward TCTGTGCCCACACTCCTGTA NPM1 Reverse TTGCCGTGTTCTTCAATCCCA mouse Forward AAGCCTGTAGCCCACGTCGTA TNF-α Reverse GGCACCACTAGTTGGTTGTCTTTG mouse Forward TAGTCCTTCCTACCCCAATTTCC IL-6 Reverse TTGGTCCTTAGCCACTCCTTC mouse Forward CTGCAGCACTTGGATCAGGAACCTG inos Reverse GGAGTAGCCTGTGTGCACCTGGAA mouse Forward ACTTGAGAGAGATCATCGGCA IL-4 Reverse AGCTCCATGAGAACACTAGAGTT mouse Forward ATGGTAATGTGGCCTACTCCT Rorc Reverse GCTGCTGTTGCAGTTGTTTCT mouse Forward CCCATCCCCAGGAGTCTTG Foxp3 Reverse ACCATGACTAGGGGCACTGTA mouse Forward AGTGTGACGTTGACATCCGT β-actin Reverse GCAGCTCAGTAACAGTCCGC human Forward CATGTACGTTGCTATCCAGGC β-actin Reverse CTCCTTAATGTCACGCACGAT RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAACCG mir-29a Forward ATGCTAGCACCATCTGAAAT Reverse GTGCAGGGTCCGAGGT RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACACT mir-29b Forward ATGCTAGCACCATTTGAAATC Reverse GTGCAGGGTCCGAGGT RT AACGCTTCACGAATTTGCGT U6 Forward CTCGCTTCGGCAGCACA Reverse AACGCTTCACGAATTTGCGT
19 Flow cytometry and intracellular cytokine staining. All fluorescein-conjugated mabs and isotype controls were from BD PharMingen (San Diego, CA). For intracellular cytokine staining, cells were stimulated with 25 ng/ml Phorbol myristate acetate (PMA) and 500 ng/ml ionomycin (Sigma, St Louis, MO) or antigen peptide-pulsed DCs as indicated for 6hr at 37 C. 10 μg/ml Brefeldin A (ebioscience, San Diego, CA) was included for the last 4 hr of incubation. Cells were stained with the Cytofix/Cytoperm kit according to the manufacture s instructions (ebioscience). Human Th1 cell differentiation. Naïve CD4 + T cells were sorted by Dako MoFloTM XDP (DakoCytomation, Glostrup, Denmark) for CD45RA + and CD45RO - CD4 + T cells from PBMC. Cell purity was >97%. Then the cells were stimulated with plate-bound anti-cd3 (5 μg/ml) plus soluble anti-cd28 (2 μg/ml) in the presence of 10 μg/ml anti-il-4, 10ng/ml IL-12, and 50 U/ml IL-2. Immunoblot, RNA-Binding protein immunoprecipitation (RIP) and Chromatin immunoprecipitation (ChIP). Cells were lysated using complete RNA lysis buffer provided by Magna RIP kit (Millipore). Protein concentration of the extracts were measured with a BCA assay (Pierce) and equalized with the extraction reagent. Equal amount of the extracts was loaded and subjected to SDS-PAGE, transferred onto nitrocellulose membranes, and then blotted. RIP experiments were performed according to the protocol provided by the kit (Millipore, catalogue ). ChIP
20 experiments were performed according to the protocol provided by the kit (Millipore, catalogue ). The primer pairs for mir-29b-1-mir-29a promoter ChIP assay were listed as below: Primer#1 Primer#2 Primer#3 Forward: 5 -TTTCAGTTGGTGGCTTGATC-3 Reverse: 5 -AGCTCTTCAGTGGGAGACTTT-3 Forward: 5 -AGAAATGAATAGCCGCAGATT-3 Reverse: 5 -AACTACCACCTACTCACCCAGA-3 Forward: 5 -TGGCGTGTCATCTGGATTGG-3 Reverse: 5 -TGAGAAAGGACGGCTGTTGG-3 Plsmids and primers. The primer pair for amplifying mir-29b-1/mir-29a promoter was 5 - CTACTCCGAAGTTGTCGATTGC-3 (forward) and 5 -ATCCACGGCTCA AGTTGCTGAA-3 (reverse). The mir-29b-1-mir-29a promoter reporter vector was indicated as normal. The vector mut-yy1 was converted from normal by deleting all the CCAT core elements of the three YY1 binding sites. The vector mut-nf-κb (1) was constructed by deleting the GGGTC of the (1) NF-κB binding site, while mut-nf-κb (2) was constructed by deleting the GGTGG of the (2) NF-κB binding site. The vector mut-nf-κb was constructed by mutating both of NF-κB binding sites. GFP primer and GS-29 primer were used for identification of GS29 mice, their sequences were 5 -GTGACCACCCTGACCTACGG-3 (forward) and 5 -CTGCTTGTCGGCC ATGATAT-3 (reverse) for GFP primer, 5 -GAGCAAAGACCCCAACGAGA
21 AG-3 (forward) and 5 -TCTACAAATGTGGTATGGCTGAT-3 (reverse) for GS-29 primer. Luciferase reporter assays in TLR-triggered RAW264.7 cells. The RAW264.7 cells were plated in the 96-well plate (10000/well) overnight, followed to be cotransfected with TK vector and reporter vector (normal or mutant mir-29b-1-mir-29a promoter reporter), according to the protocol provided by Jet-ENDO transfection reagents (Polyplus-transfection, Illrich, France). 12h later, the transfected cells were stimulated with 100 ng/ml LPS or 0.1 μm CpG ODN. In some experiments, PDTC (30 μm) was added 30 min before stimulation to block NF-kB pathway. 24h after stimulation, the firefly luciferase activity was measured and normalized to Renilla luciferase activity. Northern Blot. For northern blot analysis, total RNA was loaded onto 15% acrylamide, 8M urea TBE (Tris & borate & EDTA) gels. After electrophoresis, RNA was transferred to a nylon membrane (PerkinElmer) and pre-hybridized overnight at 50 C in hybridization buffer (modified Church-Gilbert hyb-mix). The in vitro transcribed and radiolabeled RNA, which was reverse complementary to mir-29a, was used as probes, and hybridized to the membranes for 12 hours at 50 C. After three washing in NSWS (Non-Stringent Wash Solution) for 30 minutes at 37 C, and followed by 5 minutes washing in SWS (Stringent Wash Solution) at 37 C. Kept the membrane in the film cassette and put the phosphor screen on it overnight, then
22 scanned the phosphor screen. The membrane was stripped and followed to detect the U6 RNA.
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationKerdiles et al - Figure S1
Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a)
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationPBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationSupplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
More informationMicroRNA mir-326 regulates T H -17 differentiation and is associated with the pathogenesis of multiple sclerosis
correction notice Nat. Immunol. 10, 1252 1259 (2009) MicroRNA mir-326 regulates T H -17 differentiation and is associated with the pathogenesis of multiple sclerosis Changsheng Du, Chang Liu, Jiuhong Kang,
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationSupplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationThe encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
More informationSupplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
More informationSupplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationOptimizing Intracellular Flow Cytometry:
Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors An encore presentation by Jurg Rohrer, PhD, BD Biosciences 10.26.10 Outline Introduction Cytokines
More informationSupporting Information
Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationHuman and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationTransduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationCommercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationFigure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationHua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik
SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationSupplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationand follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
More informationSupplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
More informationSUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationSupplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
More informationof whole cell cultures in U-bottomed wells of a 96-well plate are shown. 2
Supplementary online material Supplementary figure legends Supplementary Figure 1 Exposure to T reg cells causes loss of T resp cells in co-cultures. T resp cells were stimulated with CD3+CD28 alone or
More informationGeneration of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
More informationSupplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
More informationHuman Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4
Human Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4 Ankita Garg, Rodney Trout and Stephen A. Spector,,* Department
More informationSupplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationAkt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells
Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
More informationTherapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection
Supplementary Information Therapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection Noah S. Butler, Jacqueline Moebius, Lecia L. Pewe, Boubacar Traore, Ogobara K.
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationSupplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationSupplementary Figure 1. Ex vivo IFNγ production by Tregs. Nature Medicine doi: /nm % CD127. Empty SSC 98.79% CD25 CD45RA.
SSC CD25 1.8% CD127 Empty 98.79% FSC CD45RA CD45RA Foxp3 %IFNγ + cells 4 3 2 1 + IL-12 P =.3 IFNγ p=.9 %IL-4+ cells 3 2 1 IL-4 P =.4 c %IL-1 + cells IFNγ 4 3 2 1 Control Foxp3 IL-1 P =.41.64 4.76 MS 2.96
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSupplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
More information