Supplementary Materials

An integrated transcriptomic and functional genomic approach identifies a. type I interferon signature as a host defense mechanism against Candida

Supplementary information for: An integrated transcriptomic and functional genomic approach identifies a type I interferon signature as a host defense mechanism against Candida albicans in humans Sanne

Deconvolution of Heterogeneous Wound Tissue Samples into Relative Macrophage Phenotype Composition via Models based on Gene Expression

Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2017 Supplementary Information for: Deconvolution of Heterogeneous Wound Tissue Samples into

Supplementary Figure 1. Microarray data mining and validation

Supplementary Figure 1. Microarray data mining and validation Microarray (>47,000 probes) Raw data Background subtraction NanoString (124 genes) Set cut-off and threshold values Raw data Normalized to

Nature Immunology: doi: /ni.3745

Supplementary Figure 1 Experimental settings. (a) Experimental setup and bioinformatic data analysis of transcriptomic changes induced in neonatal and adult monocytes by stimulation with 10 ng/ml LPS for

HTG EdgeSeq Immuno-Oncology Assay Gene List

A2M ABCB1 ABCB11 ABCC2 ABCG2 ABL1 ABL2 ACTB ADA ADAM17 ADGRE5 ADORA2A AICDA AKT3 ALCAM ALO5 ANA1 APAF1 APP ATF1 ATF2 ATG12 ATG16L1 ATG5 ATG7 ATM ATP5F1 AL BATF BA BCL10 BCL2 BCL2L1 BCL6 BID BIRC5 BLNK

Supplementary Figures. Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated. for each lesion type.

Supplementary Figures Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated for each lesion type. a b Supplementary Figure 2. Non-negative matrix factorization-derived

Low Avidity CMV + T Cells accumulate in Old Humans

Supplementary Figure Legends Supplementary Figure 1. CD45RA expressing CMVpp65-specific T cell populations accumulate within HLA-A*0201 and HLA-B*0701 individuals Pooled data showing the size of the NLV/HLA-A*0201-specific

Supplemental Table 1: Enriched GO categories per cluster

Supplemental Table 1: Enriched GO categories per cluster Cluster Enriched with #genes Raw p-value Corrected p-value Frequency in set (%) Cluster 1 immune response - GO:0006955 32 2.36E-14 0.001 13.5 Cluster

Transduction of lentivirus to human primary CD4+ T cells

Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10860 Supplementary Discussion It remains unclear why H3K9 demethylation appeared to be more sensitive to suppression than at least some other histone methylation marks as a result of

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature11986 relative IL-6 expression Viable intracellular Bp per well 18 16 1 1 5 5 3 1 6 +DG 8 8 8 Control DG Time (h) hours B. pertussis IL-6 (pg/ml) 15 Control DG

Supplemental Table 1. List of genes and mature shrna sequences identified from the shrna screen in BRCA2-mutant PEO1 cells.

Guillemette_Supplemental Table 1 Gene Mature Sequence Gene Mature Sequence ATTCATAGGATGTCAGCAG LOC157193 TATGCGTAAGTAATAAATTGCT TTAGTTCTGTCTTGGAGG LOC152225 CGCATATATGTTCTGACTT ALDH2 CACTTCAGTGTATGCCT

pplementary Figur Supplementary Figure 1. a.

pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective

HD1 (FLU) HD2 (EBV) HD2 (FLU)

ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127

x Lymphocyte count /µl CD8+ count/µl 800 Calculated

% Lymphocyte in CBC A. 50 40 30 20 10 Lymphocyte count /µl B. x10 3 2.5 1.5 C. 50 D. 1000 % CD3+CD8+ Cells 40 30 20 Calculated CD8+ count/µl 800 600 400 200 10 0 #61 #63 #64 #65 #68 #71 #72 #75 Figure

A genome-wide association study identifies vitiligo

A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples

Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl-

Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl- 2 upregulation in pregnancy B. Santner-Nanan, K. Straubinger, P. Hsu, G. Parnell, B. Tang, B. Xu, A. Makris,

Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK

Supplemental legends Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK Table SП. List of genes in cluster 1 identified using two-dimensional hierarchical clustering analysis Table SШ.

Supplementary Table S1: Gene expression targets

Supplementary Table S1: Gene expression targets Probe ID Gene ID Gene Descriptions Cell type Antigen-dependent activation MmugDNA.32422.1.S1_at CD180 CD180 molecule B 1 MmugDNA.18254.1.S1_at CD19 CD19

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

Supporting Information

Supporting Information Lin et al. 10.1073/pnas.1408759111 Fig. S1. Safety and potential toxicity evaluation of M1 in immunocompetent mice. Immunocompetent BALB/c mice received two doses of i.v. infusion

SDC (Supplemental Digital Content) Figure S1. Percentages of Granzyme B expressing CD8 + T lymphocytes

Figure S1. Percentages of Granzyme expressing D8 + T lymphocytes 13.5% 1.4%.6% 77% 21% 24% 76% 8 8 Granzyme + (%) 6 4 2 Granzyme + (%) 6 4 2 D8 + Tnaive Tcm Tem Temra D8 + D8 + D28 + D8 + D28 null We analyzed

Moyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic

Supplementary Information for Moyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic signals in endothelial cells Kazuhiro Ohkubo 1,, Yasunari Sakai 1,*,, Hirosuke Inoue 1, Satoshi

Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads

Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Representative example of comparative ex vivo tetramer enrichment performed in three independent experiments with either conventional

The CAPRI-T was one of two (along with the CAPRI-NK, see reference. [29]) basic immunological studies nested within the CAMELIA trial.

1 SUPPLEMENTARY INFORMATION Patient description and recruitment The CAPRI-T was one of two (along with the CAPRI-NK, see reference [29]) basic immunological studies nested within the CAMELIA trial. Patients

Supplementary appendix

Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kennedy GA, Varelias A, Vuckovic S, et al.

Supplementary Table 1: List of parameters used in this study. Parameter Unit Parameter Unit Clinical parameters CD4 T cells Microbial translocation

Supplementary Table 1: List of parameters used in this study. Left table shows parameters available for all subjects and right table shows parameters available for a smaller subset of subjects. Parameters

Nature Neuroscience: doi: /nn.4295

Supplementary Figure 1 Gene expression profiling of EGFRvIII-expressing human brain tumor stem cells (BTSCs) and mouse astrocytes (a) The protein lysates of human BTSCs were analyzed by immunoblotting

Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated

1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade

Eosinophils! 40! 30! 20! 10! 0! NS!

A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the

Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells

Immunity, Volume 50 Supplemental Information Checkpoint Blockade Immunotherapy Induces Dynamic Changes in PD-1 CD8 + Tumor-Infiltrating T Cells Sema Kurtulus, Asaf Madi, Giulia Escobar, Max Klapholz, Jackson

Nature Immunology: doi: /ni.3494

Supplementary Figure 1 High-throughput screen for novel inducer of T FH cell differentiation. (a) Schematic of primary screen. Purified human naïve CD4 T cells were stimulated by anti-cd3/cd28 beads on

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing

Supplement Results, Figures and Tables

Supplement Results, Figures and Tables Results PET imaging The SUV was significantly higher in tumours of the parental HSC-3 cell line than tumours of the EV and the MMP-8 overexpressing cell lines (Figure

The epigenetic landscape of T cell subsets in SLE identifies known and potential novel drivers of the autoimmune response

Abstract # 319030 Poster # F.9 The epigenetic landscape of T cell subsets in SLE identifies known and potential novel drivers of the autoimmune response Jozsef Karman, Brian Johnston, Sofija Miljovska,

** *** population. (A) Representative FACS plots showing the gating strategy for T N

Sca-1 (MFI) CD122 (MFI) CD44 A CD8 + gated: resting spleen CD8 + gated: T Mem -derived CD8 + gated: T N -derived, expanded alone B CD62L CD44 low CD62L +, resting CD44 high, T Mem -derived CD44 low CD62L

Transcription factor Foxp3 and its protein partners form a complex regulatory network

Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey

Supplementary Information

1 Supplementary Information Human TSC2 Null Fibroblast-Like Cells Induce Hair Follicle Neogenesis and Hamartoma Morphogenesis Shaowei Li 1, Rajesh L. Thangapazham 1, Ji-an Wang 1, Sangeetha Rajesh 1, Tzu-Cheg

Supplementary Figure 1

Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

BD Rhapsody Immune Response Panel Hs

Doc ID: 55665 Rev. 2.0 PRODUCT INSERT BD Rhapsody Immune Response Panel Hs BD Biosciences Kit Part Number: 633750 Purpose The BD Rhapsody Immune Response Panel Hs is a set of ready-to-use primer pools

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated

Table S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in

Supplementary Files to Töröcsik et al. Factor XIII-A is involved in the regulation of

Supplementary Files to Töröcsik et al. Factor XIII-A is involved in the regulation of gene expression in alternatively activated human macrophages (Thromb Haemost 2010; 104.3) A Protein synthesis Cell

WT-TP53 DLBCL WT-TP53 GCB-DLBCL

SUPPLEMENTAL TABLES AND FIGURES Supplemental Table S1. Summary of gene expression profiling analysis results listing counts of significant differentially expressed transcripts between defined two groups

SUPPLEMENTARY MATERIAL

Supplementary Material The Open AIDS Journal, 2012, Volume 6 i SUPPLEMENTARY MATERIAL Immune Reconstitution During the First Year of Antiretroviral Therapy of HIV-1-Infected Adults in Rural Burkina Faso

Statistical Issues in Translational Cancer Research

Statistical Issues in Translational Cancer Research Martin Bøgsted Department of Haematology Aalborg University Hospital and Department of Clinical Medicine Aalborg University The only useful function

The broadest portfolio for your T cell research

quick guide The broadest portfolio for your T cell research Sample preparation Cell separation Cell culture Flow cytometry Mouse T cells Overview CD4 + T cell subsets Polarization reagents Naive CD4 +

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses

ankylosing spondylitis Department of Clinical Immunology, Xijing Hospital, The Fourth Military

Functional defects in CD4 + CD25 high FoxP3 + regulatory cells in ankylosing spondylitis Huifang Guo 1, 2, 3, Ming Zheng 1, 2, 3, Kui Zhang 1, 3, Fengfan Yang 1, 3, Xin Zhang 1, 3, Qing Han 1, 3, Zhi-Nan

Appendix Figure S1 A B C D E F G H

ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with

Bronchoalveolar lavage fluid analysis showed increased eosinophil in 30% of subjects with IrIa BAL

Bronchoalveolar lavage fluid analysis showed increased eosinophil in 30% of subjects with IrIa BAL UBC Chan-Yeung Centre for Occupational and Environmental Respiratory Disease Understanding exposure effects

CPM (x 10-3 ) Tregs +Teffs. Tregs alone ICOS CLTA-4

A 2,5 B 4 Number of cells (x 1-6 ) 2, 1,5 1, 5 CPM (x 1-3 ) 3 2 1 5 1 15 2 25 3 Days of culture 1/1 1/2 1/4 1/8 1/16 1/32 Treg/Teff ratio C alone alone alone alone CD25 FoxP3 GITR CD44 ICOS CLTA-4 CD127

Analysis of gene expression in blood before diagnosis of ovarian cancer

Analysis of gene expression in blood before diagnosis of ovarian cancer Different statistical methods Note no. Authors SAMBA/10/16 Marit Holden and Lars Holden Date March 2016 Norsk Regnesentral Norsk

Supplemental Figures/Tables. Methylation forward GTCGGGGCGTATTTAGTTC. Methylation reverse AACGACGTAAACGAAAATATCG

Supplemental Figures/Tables Supplementary Tables Table S1. Primer sequences MSP Primers SPARC2 Unmethylation forward TTTTTTAGATTGTTTGGAGAGTG Unmethylation reverse AACTAACAACATAAACAAAAATATC Methylation

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.

a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

Multi-class cancer outlier differential gene expression detection Supplementary Information

Multi-class cancer outlier differential gene expression detection Supplementary Information Fang Liu, Baolin Wu 1 Breast cancer microarray data analysis The breast cancer microarray data (West et al.,

Supplementary Figure 1 a

Supplementary Figure 1 a b d c Supplementary Figure 1. Poor sensitivity for mutation detection using established single-cell RNA-sequencing methods. (a) Representative bioanalyzer trace showing expected

Supplementary Fig.S1 Microarray quality control chart. Supplementary Fig.S2 Display of the overview of pathway network from Reactome online.

Supplementary Fig.S1 Microarray quality control chart. Data after normalization. X-axis: sample; Y-axis: log2 expression value. Box plot showed the distribution of value data for the samples we selected

SCIENCE CHINA Life Sciences

SCIENCE CHINA Life Sciences RESEARCH PAPER April 2013 Vol.56 No.4: 1 7 doi: 10.1007/s11427-013-4460-x Table S1 Human paired-end RNA-Seq data sets from the Sequence Read Archive (SRA) database Experiment

Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed

Supplementary Information Table S1. Differentially expressed transcripts between hepatic inkt cells sorted form and plck-hcd1d tg mice. Differentially expressed transcripts identified by gene expression

supplemental Figure 1

supplemental Figure 1 A T cell T1 anti-ny-eso-117-16/hla-a*:1 CDζ CH/CH scfv B T cell T1 anti-ny-eso-117-16/hla-a*:1 CDζ CH/CH scfv C T cell BW1/6 anti-cea CDζ CH/CH scfv supplemental Figure 1.79.9.87

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

Table 1 Demographic data of PD-patients. Data are represented as counts or median and full range.

Table 1 Demographic data of PD-patients. Data are represented as counts or median and full range. Parameter Number Patients 5 Diabetes mellitus 0 Previous NTX 0 Steroids 0 Patients with residual renal

Supplementary Figure 1

Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the

Supplementary Information

Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,

Schrader et al. Cell Communication and Signaling 2012, 10:43

Schrader et al. Cell Communication and Signaling 2012, 10:43 RESEARCH Open Access Global gene expression changes of in vitro stimulated human transformed germinal centre B cells as surrogate for oncogenic

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2.

Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2. mir D HF VS CTR ND HF VS CTR D HF VS ND HF FOLD CHANGE p FOLD CHANGE p FOLD CHANGE

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

Supplemental Information. lncrna Epigenetic Landscape Analysis Identifies EPIC1 as an Oncogenic lncrna that Interacts with MYC

Cancer Cell, Volume 33 Supplemental Information lncrna Epigenetic Landscape Analysis Identifies as an Oncogenic lncrna that Interacts with and Promotes Cell-Cycle Progression in Cancer Zehua Wang, Bo Yang,

IgG3 regulates tissue-like memory B cells in HIV-infected individuals

SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41590-018-0180-5 In the format provided by the authors and unedited. IgG3 regulates tissue-like memory B cells in HIV-infected individuals Lela

CD80 and PD-L2 define functionally distinct memory B cell subsets that are. Griselda V Zuccarino-Catania, Saheli Sadanand, Florian J Weisel, Mary M

Supplementary Figures CD8 and PD-L define functionally distinct memory B cell subsets that are independent of antibody isotype Running title: Memory B Cell Subset Function Griselda V Zuccarino-Catania,

Supplementary Material. Table S1. Summary of mapping results

Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598

Äijö et al. BMC Genomics 2012, 13:572

Äijö et al. BMC Genomics 2012, 13:572 RESEARCH ARTICLE Open Access An integrative computational systems biology approach identifies differentially regulated dynamic transcriptome signatures which drive

Epigenetic Regulation by Chromatin Activation Mark H3K4me3 in Primate Progenitor

Epigenetic Regulation by Chromatin Activation Mark H3K4me3 in Primate Progenitor Cells within Adult Neurogenic Niche Richard S. Sandstrom 1, Michael R. Foret 2, Douglas A. Grow 2,3, Eric Haugen 1, Christopher

Supplementary Online Content

Supplementary Online Content Lyall DM, Celis-Morales C, Ward J, et al. Association of body mass index with cardiometabolic disease in the UK Biobank: a mendelian randomization study. JAMA Cardiol. Published

Supplementary Figures and Tables. An inflammatory gene signature distinguishes neurofibroma Schwann cells and

Supplementary Figures and Tables An inflammatory gene signature distinguishes neurofibroma Schwann cells and macrophages from cells in the normal peripheral nervous system Kwangmin Choi 1, Kakajan Komurov

p5+mir30: AATGATACGGCGACCACCGACTAAAGTAGCCCCTTGAATTC

SUPPORTING INFORMATION METHODS Massively parallel sequencing and shrna screen data analysis pipeline Genomic DNA extraction and purification from surviving MCF7 cells in the genome wide screen was carried

Supplementary appendix

Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Ellingford JM, Sergouniotis PI, Lennon R, et

F-CD8 +/+ 313F-CD8 -/ ShcA-CD8 +/+ ShcA-CD8 -/- * * 313F-IFN +/+ 313F-IFN -/- 2F-IFN -/- % Tumor Free.

a 864 5372 6738 ShcA-CD8 +/+ ShcA-CD8 -/- 2F-CD8 +/+ 2F-CD8 -/- b 4788 5376 623 313F-CD8 +/+ 313F-CD8 -/- 1 1 1 75 75 75 5 5 5 25 25 25 2 4 6 Time after Inoculation (d) 2 4 6 Time after Inoculation (d)

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic

Kerdiles et al - Figure S1

Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a)

Neonatal and adult recent thymic emigrants produce IL-8 and express complement receptors CR1 and CR2

Neonatal and adult recent thymic emigrants produce IL-8 and express complement receptors CR1 and CR2 Marcin L. Pekalski,, John A. Todd, Linda S. Wicker JCI Insight. 2017;2(16):e93739.. Research Article

Supplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing

Supplementary Table 1. Information on the 174 single nucleotide s identified by whole-exome sequencing Chr Position Type AF exomes Database 1 10163148 A/G UBE4B missense 0.000326 1534 2 98 1 4.44 Damaging

From the Diagnostic Immunology Laboratories

Immunology Laboratories ISSUE 9 SPRING 2012 PAGE 1 Spring Meetings Please stop by and say hello in May at this year s American Society of Pediatric Hematology/Oncology (ASPHO) Annual Meeting in New Orleans

Proteome Analysis of Human Perilymph using an Intraoperative Sampling Method

Supporting Information Article Title Proteome Analysis of Human Perilymph using an Intraoperative Sampling Method Authors Heike A. Schmitt 1,3, Andreas Pich 2, Anke Schröder 2, Verena Scheper 1,3, Giorgio

g. RA Bardot et al., 2016 Supplementary Figure 1 RV LV E15.5 E6.5 E18.5 E7.5 VE RV LV E8.5 RV LV E10.5 Brightfield Foxa2Cre:YFP Brightfield

Bardot et al., 216 Supplementary Figure 1 a. VE e. RA LA LA RV LV E15.5 E6.5 b. E7.5 VE f. RA E18.5 LA c. E8.5 ML N CM g. RA RV LV LA P7 PHT RV LV d. E1.5 Brightfield Foxa2Cre:YFP H Brightfield Foxa2Cre:YFP

15. Supplementary Figure 9. Predicted gene module expression changes at 24hpi during HIV

Supplementary Information Table of content 1. Supplementary Table 1. Summary of RNAseq data and mapping statistics 2. Supplementary Table 2. Biological functions enriched in 12 hpi DE genes, derived from

Optimized between-group classification: a new jackknife-based gene selection procedure for genome-wide expression data Supplementary information

Optimized between-group classification: a new jackknife-based gene selection procedure for genome-wide expression data Supplementary information Florent Baty 1 florent.baty@unibas.ch Michel P Bihl 1 michel.bihl@unibas.ch

Use of Molecular Assays to Assess Cellular Therapies

Use of Molecular Assays to Assess Cellular Therapies D. Stroncek, P. Jin, M. Sabatino, J. Ren, L. Castiello, E. Wang, and F.M. Marincola. Cellular Therapies Section Clinical Center, NIH Methods for the

Supplementary information: Forstner, Hofmann et al.

Supplementary information: Forstner, Hofmann et al., Genome-wide analysis implicates micrornas and their target genes in the development of bipolar disorder Table of contents Supplementary Figure 1: Regional

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

Allele specific FKBP5 DNA demethylation: a molecular mediator of gene childhood

Allele specific FKBP5 DNA demethylation: a molecular mediator of gene childhood trauma interactions Torsten Klengel 1, Divya Mehta 1, Christoph Anacker 2, Monika Rex Haffner 1, Jens C. Pruessner 3, Carmine

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

Supplementary Information

Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!

Integrative Radiation Biology

Dr. Kristian Unger Integrative Biology Group Research Unit of Radiation Cytogenetics Department of Radiation Sciences Helmholtz-Zentrum München 1 Key Questions Molecular mechanisms of radiation-induced