Generation of TSC2 knockout 293A cells by Zinc Finger Nuclease technology

Transcription

1 Supplementary Material and Method: Cell culture, proliferation assay and transfection. HEK293, MM1.S, H929, RPMI-8266, U266, Hel92.1.7, KG-1, Kasumi-3 and Kasumi-6 cells are available from ATCC (Manassas VA); KMS-26, KMS-34, KMS-11, KMS-12.BM, KMS-28.PE, KMS-27cells are available from Japanese Collection of Research Bioresources (National Institute of Health Sciences; Japan); L- 363, OPM-2, Molm and LP-1 cells available from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Germany). KMS-11.luc, a KMS-11 clone expressing firefly luciferase, was obtained from the University Health Network (UHN), Toronto, Ontario, Canada. All cells are cultured in suggested medium condition. To assess the effect of LGB321 on proliferation, cells were seeded in 96-well tissue culture plates followed by addition of compound that had been serially diluted in 0.1% DMSO. After addition of LGB321 to cells, assay plates were returned to a humidified CO2 incubator (37 C; 5% CO2) for 3 days. 100μl per well of reconstituted CellTiter-Glo reagent was added to the cell assay plates. Assay plates were then sealed and shaken on a DELFIA (Perkin Elmer) plateshaker for 10 minute at RPM. Plates were then read on either a Microbeta Trilux (Perkin Elmer) or SpectroMax L (Molecular Devices) luminometer. Cell growth was determined by comparing assay signals of LGB321 treated cells with the control conditions of untreated cells (defining 0% growth inhibition). Generation of TSC2 knockout 293A cells by Zinc Finger Nuclease technology Briefly, a pair of ZFN vectors (targeting TSC2 gene) were transfected into 293A cells by lipofectamine. ZFN-induced double-strand breaks are typically repaired by a non-perfect cellular repair mechanism and generated cells in which either random heterogeneous genetic insertions or deletions occurred at the site of the double-stand break. Single clones of cells were expanded and the status of TSC2 gene was determined by sequencing. The targeting sequence on TSC2 gene is: CCATCGTCCATGACCTGTTGACCACGGTGGAGGAGCTGTGTGACCAGAACG, with Red representing ZFN binding sequences and underlined representing ZFN cutting sequence. The primers used for sequencing to select positive TSC2 knockout clones are the following: Forward primer: CTGAGAGGGCTGAGGGTGT; and Reverse primer: GCTTTCCAGGTTTCTGCACT. The sequence of mutant TSC2 is CCATCGTCCATGACCTGTTGACCACGGTACGGTGGAGGAGCTGTGTGACCAGAACG, compare to that of wild-type TSC2 CCATCGTCCATGACCTGTTGACCACGGTGGAGGAGCTGTGTGACCAGAACG. The insertion caused frame shift and produced no TSC2 protein as tested by immunoblot analysis. 1

2 LGB321 in vivo studies Scid/bg female mice (10-12 weeks old; Charles River, Hollister CA) were housed up to five animals per cage with a 12-hour light, 12-hour dark cycle at temperatures between F, and 30-70% relative humidity. Cells were harvested at 80-90% confluency, washed and resuspended in cold Dulbecco s Phosphate Buffered Saline (DPBS without Ca2+ or Mg2+, Cellgro, Manasas VA) at a concentration of 5 X 107 cells/ml, mixed with an equal volume of Matrigel (Becton-Dickinson, Franklin Lakes NJ) and then 0.2 ml (5 X 10 6 cells) was implanted subcutaneously into the right flank of female Scid/bg mice. Tumor volume was measured in two dimensions using digital calipers and calculated as (Length x Width2) π/6). For efficacy studies, animals were randomized into groups when tumor volume reached mm3. Tumor volume and body weights were captured and stored by StudyDirector software (StudyLog, South San Francisco, CA). LGB321 was formulated for oral administration in 50mM Acetate buffer, ph4. The concentration of LGB321in plasma was determined following extraction in acetonitrile using liquid chromatography and tandem mass spectroscopy (LC/MS/MS). Commercial electrochemiluminescence (ECL) assay kits from Meso Scale Discovery (MSD; Rockville MD) were used to quantify the effects of LGB321 on ps6rp from xenograft model. Briefly, MDS lysis buffer was added to frozen pulverized tumor samples on ice and homogenates were prepared using the MagNA Lyser bead instrument (Roche Applied Science, Indianapolis, IN) by disrupting the samples with four cycles of 6000 RPM for 30 seconds at 4 C. Supernatants were created following centrifugation at RPM for 15 minutes at 4 C, and protein concentration determined using the BCA Protein Assay kit according to manufacturer s instructions (Pierce Chemical Company, Rockford, IL). Samples were then transferred to ECL assay plates previously blocked with 3% BSA, sealed and incubated at 4 C overnight while 2

3 undergoing gentle shaking on a DELFIA (Perkin Elmer, Waltham MA) plate shaker. Assay plates were then processed according to manufacturer instructions. 3

4 Supplementary Table 1: Effect of LGB321 in MM cell lines with diverse genetic alterations cell line EC 50 Genetic alterations KMS ±0.02µM t (4;14) FGFR3; t (14;16) cmaf KMS-12.BM 0.1±0.0.04µM t (11;14) cyclind1 KMS ±0.07µM t (4;14) FGFR3; t (14;16) cmaf KMS-28.PE 1.7±1.97µM t (4;14) FGFR3 KMS ±0.04µM t (4;14) FGFR3 MM1.S 0.26±0.22µM t (14;16) cmaf H ±0.01µM t (4;14) FGFR3 RPMI ±0.57µM t (14;16) cmaf U266 >5.0 um t (11;14) cyclind1 1

5 AML (N=34) ALL (N=30) Burkitt Lymphoma (N=10) CLL (N=4) CML (N=15) DLBCL (N=18) Hodgkin Lymphoma (N=13) MM (N=29) AML (N=34) ALL (N=30) Burkitt Lymphoma (N=10) CLL (N=4) CML (N=15) DLBCL (N=18) Hodgkin Lymphoma (N=13) MM (N=29) Log2 Pim1 Log2 Pim3 Breast (N=58) Endometrium (N=26) Hematological (N=180) Kidney (N=22) Liver (N=28) Lung (N=181) Ovary (N=52) Pancreas (N=46) Prostate (N=7) Skin (N=61) Breast (N=58) Endometrium (N=26) Hematological (N=180) Kidney (N=22) Liver (N=28) Lung (N=181) Ovary (N=52) Pancreas (N=46) Prostate (N=7) Skin (N=61) Log2 Pim1 Log2 Pim3 Supplementary Figure 1 A Pim1 Expression in CCLE Lines across multiple tumor types B Pim3 Expression in CCLE Lines across multiple tumor types C Pim1 Expression in hematological CCLE Lines D Pim3 Expression in hematological CCLE Lines Sup Figure 1. Microarray analysis of Pim1 and Pim3 mrna expressions in different tumor cell lines and in various hematological tumor cell lines. (A and B) Microarray analysis of Pim1 and Pim3 mrna expressions in various tumor cell lines; (C and D) Microarray analysis of Pim1 and Pim3 mrna expressions in various hematological tumor cell lines;

6 Supplementary Figure 2: Structure of LGB321 OH H 2 N F F N H N N F N O Reference: 1: Nishiguchi GA, Burger M, Han W, Lan J, Atallah G, Ding Y, Mathur M, Muller K, Tamez V, Lindvall M, Bellamacina C, Garcia PD, Zavorotinskaya T, Feucht P, Langowski JL, Zang R, Dai Y, Chan J, Holash J, Huh K. Structure guided optimization of novel, selective, and orally bioavailable inhibitors of Pim kinases. Presented in 245th American Chemical Society (ACS) National Meeting, April 7-11, 2013., New Orleans. 2: Garcia PD, Langowski JL, Wang YY, Chen MY, Holash J, Castillo J, Fanton C, Ison M, Zavorotinskaya T, Dai YM, Lu J, Niu XH, Basham S, Chan J, Yu JJ, Doyle M, Feucht P, Warne R, Drueckers P, Trappe J, Wilson C, and Burger M. Pan-PIM Kinase Inhibition Provides a Novel Therapy for Treating Hematological Cancers. (Manuscript submitted) 3. Burger MT, Han W, Lan J, Nishiguchi G, Bellamacina C, Lindval M, Atallah G, Ding Y, Mathur M, McBride C, Mieuli E, Muller K, Tamez V, Zhang Y, Huh K, Feucht P, Zavorotinskaya T, Dai Y, Holash J, Langowski J and Garcia PD. Structure Guided Optimization, In Vitro Activity and In Vivo Activity of Pan PIM Kinase Inhibitors. (Manuscript in preparation) 3

7 Supplementary Figure 3 A B KMS-34 Deptor Actin In KMS-26 cells H929 Deptor Tubulin In 293A cells Deptor Tubulin LGB321 (µm) LGB321 (µm) PARP Cleaved-PARP Actin C KMS-34 H929 p-s6rp (S235/S236) T-S6RP p-bad (S112) T-BAD Supplementary Figure 3. (A) Deptor expression in MM cell lines with diverse genetic background. Left: a panel of MM cell lines are screened for their Deptor expression levels by immunoblotting. Red label: cell lines with c-maf/mafb translocation. MM1.S- Luc is derived from MM1.S cells with stable luciferase expression. Right: Validation of Deptor antibody (Millipore #09-463). Deptor was knocked down in KMS-26 cell with lentiviral-mediated shrnas, and overexressed in 293A cells with a pcdna-dest40 construct. Lysates were subjected to immunoblotting with Deptor and Tubulin antibodies. (C) Pim inhibition does not affect apoptosis. KMS-34 and H929 cells were treated with increasing doses of LGB321 (0, 0.03, 0.1, 0.33, 1.0μM) for 2 days (12 hours treatment with Staurosporine as positive control), PARP cleavage was examined by immunoblotting. (D) Pim inhibition leads to a severe repression of mtor-c1 pathway activity. KMS-34 and H929 cells were treated with increasing doses of LGB321 (0, 0.03, 0.1, 0.33, 1.0μM) for 2 hours, mtor-c1 pathway activity was examined by the level of p-s6rp (S235/S236) through immunoblotting.

8 Supplementary Figure 4 A KMS-11 KMS-26 KMS-34 H929 LGB321(µM) mtor Raptor B C KMS-11 KMS-26 LGB321 (µm) m-tor IP p-ampk (T172) T-AMPK Raptor IB KMS-34 H929 Heavy chain Deptor LGB321 (µm) p-ampk (T172) T-AMPK D KMS-11 KMS-26 KMS-34 H929 LGB321 (µm) p-pras40 (T246) T-PRAS40 Supplementary Figure 4. (A) ) Pim inhibition does not disrupt the interaction between mtor and Raptor in MM cell lines. Rad001 (100nM) treatment serves as positive control. MM cell lines were treated with increasing doses of LGB321 (0, 0.33 and 1.0µM) for 2hrs, cell lysates were subjected to immunoprecipitation with an anti-raptor antibody, and then analyzed by immunoblotting with anti-mtor and anti-raptor antibodies. (B) Pim inhibition shows no significant effect on Deptor binding to mtor-c1 complex. KMS-26 cells were treated with LGB321 for 2hrs, cell lysates were subjected to immunoprecipitation with an anti-mtor antibody, and then analyzed by immunoblotting with anti-mtor, Raptor and Deptor antibodies. (C) Pim inhibition does not affect p-ampk(t172) levels in MM cell lines. AICAR treatment serves as positive control. MM cells were treated with increasing doses of LGB321 (0, 0.033, 0.1, 0.33 and 1.0µM) and p-ampk(t172) was analyzed by immunoblotting. (D) Pim inhibition does not significantly affect p-pras40(t246) levels in MM cell lines. BKM120, a PI3K kinase inhibitor, serves as positive control. MM cells were treated with increasing doses of LGB321 (0, 0.33 and 1.0µM) for 2hrs, p-pras40(t246) was analyzed by immunoblotting.

9 Relative growth Relative growth Relative growth Relative growth TSC2 shrnas Supplementary Figure 5 A KMS-11 KMS-26 H929 KMS-34 TSC2 Tubulin B KMS-11 KMS-26 Scramble control Days Days H929 KMS-34 Days Days Supplementary Figure 5. TSC2 knockdown in MM cells leads to growth inhibition. (A) TSC2 was knocked down in MM cells by lentivirus-mediated shrnas; (B) TSC2 knockdown in MM cells leads to reduced cell growth, which is monitored by CTG assay daily.

10 Cell lysates IP:TSC2 IB Supplementary Figure 6: Characterization of a phosophospecific antibody for p-tsc2 (Ser-1798) A IP-TSC2 - + Lambda phosphatase P-TSC2 (S1798) T-TSC2 B WT-TSC2 TSC2-S1798A Pim GFP p-tsc2 (by AKT substrate ab) p-tsc2 (S1798) TSC2 TSC2 Pim2 tubulin 7 Supplementary Figure 6. (A) p-tsc2 (Ser-1798) is decreased upon Lambda phosphatase treatment; (B) Pim2 specifically modulates TSC2 phosphorylation on Ser WT-TSC2 or TSC2 S1798A were transfected into TSC2 null 293A cells with either GFP or Pim2, TSC2 was immuno-precipitated and then analyzed for p-tsc2 by a specific p-tsc2 (Ser-1798) antibody, and by an p- AKT-substrate antibody.

11 Supplementary Figure 7: Effect of Pim inhibition on p-erk and p-akt in MM cells + KMS H DMSO LGB321 RAD001 p-p70 (T389) T-P70 p-erk (T202/204) T-ERK p-akt (S473) T-AKT Supplementary Figure 7: Effect of Pim inhibition on p-erk and p-akt in MM cell lines. KMS-11 and H929 cells were treated with either LGB321 (1.0µM) or RAD001 (0.1µM), or both LGB321 and RAD001 for 2 hours. Cell lysates were examined for p-p70 (T389), p-akt (S473), p-erk (T202/204), with total proteins as loading control.