Generation of TSC2 knockout 293A cells by Zinc Finger Nuclease technology
|
|
- Martina Nicholson
- 5 years ago
- Views:
Transcription
1 Supplementary Material and Method: Cell culture, proliferation assay and transfection. HEK293, MM1.S, H929, RPMI-8266, U266, Hel92.1.7, KG-1, Kasumi-3 and Kasumi-6 cells are available from ATCC (Manassas VA); KMS-26, KMS-34, KMS-11, KMS-12.BM, KMS-28.PE, KMS-27cells are available from Japanese Collection of Research Bioresources (National Institute of Health Sciences; Japan); L- 363, OPM-2, Molm and LP-1 cells available from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Germany). KMS-11.luc, a KMS-11 clone expressing firefly luciferase, was obtained from the University Health Network (UHN), Toronto, Ontario, Canada. All cells are cultured in suggested medium condition. To assess the effect of LGB321 on proliferation, cells were seeded in 96-well tissue culture plates followed by addition of compound that had been serially diluted in 0.1% DMSO. After addition of LGB321 to cells, assay plates were returned to a humidified CO2 incubator (37 C; 5% CO2) for 3 days. 100μl per well of reconstituted CellTiter-Glo reagent was added to the cell assay plates. Assay plates were then sealed and shaken on a DELFIA (Perkin Elmer) plateshaker for 10 minute at RPM. Plates were then read on either a Microbeta Trilux (Perkin Elmer) or SpectroMax L (Molecular Devices) luminometer. Cell growth was determined by comparing assay signals of LGB321 treated cells with the control conditions of untreated cells (defining 0% growth inhibition). Generation of TSC2 knockout 293A cells by Zinc Finger Nuclease technology Briefly, a pair of ZFN vectors (targeting TSC2 gene) were transfected into 293A cells by lipofectamine. ZFN-induced double-strand breaks are typically repaired by a non-perfect cellular repair mechanism and generated cells in which either random heterogeneous genetic insertions or deletions occurred at the site of the double-stand break. Single clones of cells were expanded and the status of TSC2 gene was determined by sequencing. The targeting sequence on TSC2 gene is: CCATCGTCCATGACCTGTTGACCACGGTGGAGGAGCTGTGTGACCAGAACG, with Red representing ZFN binding sequences and underlined representing ZFN cutting sequence. The primers used for sequencing to select positive TSC2 knockout clones are the following: Forward primer: CTGAGAGGGCTGAGGGTGT; and Reverse primer: GCTTTCCAGGTTTCTGCACT. The sequence of mutant TSC2 is CCATCGTCCATGACCTGTTGACCACGGTACGGTGGAGGAGCTGTGTGACCAGAACG, compare to that of wild-type TSC2 CCATCGTCCATGACCTGTTGACCACGGTGGAGGAGCTGTGTGACCAGAACG. The insertion caused frame shift and produced no TSC2 protein as tested by immunoblot analysis. 1
2 LGB321 in vivo studies Scid/bg female mice (10-12 weeks old; Charles River, Hollister CA) were housed up to five animals per cage with a 12-hour light, 12-hour dark cycle at temperatures between F, and 30-70% relative humidity. Cells were harvested at 80-90% confluency, washed and resuspended in cold Dulbecco s Phosphate Buffered Saline (DPBS without Ca2+ or Mg2+, Cellgro, Manasas VA) at a concentration of 5 X 107 cells/ml, mixed with an equal volume of Matrigel (Becton-Dickinson, Franklin Lakes NJ) and then 0.2 ml (5 X 10 6 cells) was implanted subcutaneously into the right flank of female Scid/bg mice. Tumor volume was measured in two dimensions using digital calipers and calculated as (Length x Width2) π/6). For efficacy studies, animals were randomized into groups when tumor volume reached mm3. Tumor volume and body weights were captured and stored by StudyDirector software (StudyLog, South San Francisco, CA). LGB321 was formulated for oral administration in 50mM Acetate buffer, ph4. The concentration of LGB321in plasma was determined following extraction in acetonitrile using liquid chromatography and tandem mass spectroscopy (LC/MS/MS). Commercial electrochemiluminescence (ECL) assay kits from Meso Scale Discovery (MSD; Rockville MD) were used to quantify the effects of LGB321 on ps6rp from xenograft model. Briefly, MDS lysis buffer was added to frozen pulverized tumor samples on ice and homogenates were prepared using the MagNA Lyser bead instrument (Roche Applied Science, Indianapolis, IN) by disrupting the samples with four cycles of 6000 RPM for 30 seconds at 4 C. Supernatants were created following centrifugation at RPM for 15 minutes at 4 C, and protein concentration determined using the BCA Protein Assay kit according to manufacturer s instructions (Pierce Chemical Company, Rockford, IL). Samples were then transferred to ECL assay plates previously blocked with 3% BSA, sealed and incubated at 4 C overnight while 2
3 undergoing gentle shaking on a DELFIA (Perkin Elmer, Waltham MA) plate shaker. Assay plates were then processed according to manufacturer instructions. 3
4 Supplementary Table 1: Effect of LGB321 in MM cell lines with diverse genetic alterations cell line EC 50 Genetic alterations KMS ±0.02µM t (4;14) FGFR3; t (14;16) cmaf KMS-12.BM 0.1±0.0.04µM t (11;14) cyclind1 KMS ±0.07µM t (4;14) FGFR3; t (14;16) cmaf KMS-28.PE 1.7±1.97µM t (4;14) FGFR3 KMS ±0.04µM t (4;14) FGFR3 MM1.S 0.26±0.22µM t (14;16) cmaf H ±0.01µM t (4;14) FGFR3 RPMI ±0.57µM t (14;16) cmaf U266 >5.0 um t (11;14) cyclind1 1
5 AML (N=34) ALL (N=30) Burkitt Lymphoma (N=10) CLL (N=4) CML (N=15) DLBCL (N=18) Hodgkin Lymphoma (N=13) MM (N=29) AML (N=34) ALL (N=30) Burkitt Lymphoma (N=10) CLL (N=4) CML (N=15) DLBCL (N=18) Hodgkin Lymphoma (N=13) MM (N=29) Log2 Pim1 Log2 Pim3 Breast (N=58) Endometrium (N=26) Hematological (N=180) Kidney (N=22) Liver (N=28) Lung (N=181) Ovary (N=52) Pancreas (N=46) Prostate (N=7) Skin (N=61) Breast (N=58) Endometrium (N=26) Hematological (N=180) Kidney (N=22) Liver (N=28) Lung (N=181) Ovary (N=52) Pancreas (N=46) Prostate (N=7) Skin (N=61) Log2 Pim1 Log2 Pim3 Supplementary Figure 1 A Pim1 Expression in CCLE Lines across multiple tumor types B Pim3 Expression in CCLE Lines across multiple tumor types C Pim1 Expression in hematological CCLE Lines D Pim3 Expression in hematological CCLE Lines Sup Figure 1. Microarray analysis of Pim1 and Pim3 mrna expressions in different tumor cell lines and in various hematological tumor cell lines. (A and B) Microarray analysis of Pim1 and Pim3 mrna expressions in various tumor cell lines; (C and D) Microarray analysis of Pim1 and Pim3 mrna expressions in various hematological tumor cell lines;
6 Supplementary Figure 2: Structure of LGB321 OH H 2 N F F N H N N F N O Reference: 1: Nishiguchi GA, Burger M, Han W, Lan J, Atallah G, Ding Y, Mathur M, Muller K, Tamez V, Lindvall M, Bellamacina C, Garcia PD, Zavorotinskaya T, Feucht P, Langowski JL, Zang R, Dai Y, Chan J, Holash J, Huh K. Structure guided optimization of novel, selective, and orally bioavailable inhibitors of Pim kinases. Presented in 245th American Chemical Society (ACS) National Meeting, April 7-11, 2013., New Orleans. 2: Garcia PD, Langowski JL, Wang YY, Chen MY, Holash J, Castillo J, Fanton C, Ison M, Zavorotinskaya T, Dai YM, Lu J, Niu XH, Basham S, Chan J, Yu JJ, Doyle M, Feucht P, Warne R, Drueckers P, Trappe J, Wilson C, and Burger M. Pan-PIM Kinase Inhibition Provides a Novel Therapy for Treating Hematological Cancers. (Manuscript submitted) 3. Burger MT, Han W, Lan J, Nishiguchi G, Bellamacina C, Lindval M, Atallah G, Ding Y, Mathur M, McBride C, Mieuli E, Muller K, Tamez V, Zhang Y, Huh K, Feucht P, Zavorotinskaya T, Dai Y, Holash J, Langowski J and Garcia PD. Structure Guided Optimization, In Vitro Activity and In Vivo Activity of Pan PIM Kinase Inhibitors. (Manuscript in preparation) 3
7 Supplementary Figure 3 A B KMS-34 Deptor Actin In KMS-26 cells H929 Deptor Tubulin In 293A cells Deptor Tubulin LGB321 (µm) LGB321 (µm) PARP Cleaved-PARP Actin C KMS-34 H929 p-s6rp (S235/S236) T-S6RP p-bad (S112) T-BAD Supplementary Figure 3. (A) Deptor expression in MM cell lines with diverse genetic background. Left: a panel of MM cell lines are screened for their Deptor expression levels by immunoblotting. Red label: cell lines with c-maf/mafb translocation. MM1.S- Luc is derived from MM1.S cells with stable luciferase expression. Right: Validation of Deptor antibody (Millipore #09-463). Deptor was knocked down in KMS-26 cell with lentiviral-mediated shrnas, and overexressed in 293A cells with a pcdna-dest40 construct. Lysates were subjected to immunoblotting with Deptor and Tubulin antibodies. (C) Pim inhibition does not affect apoptosis. KMS-34 and H929 cells were treated with increasing doses of LGB321 (0, 0.03, 0.1, 0.33, 1.0μM) for 2 days (12 hours treatment with Staurosporine as positive control), PARP cleavage was examined by immunoblotting. (D) Pim inhibition leads to a severe repression of mtor-c1 pathway activity. KMS-34 and H929 cells were treated with increasing doses of LGB321 (0, 0.03, 0.1, 0.33, 1.0μM) for 2 hours, mtor-c1 pathway activity was examined by the level of p-s6rp (S235/S236) through immunoblotting.
8 Supplementary Figure 4 A KMS-11 KMS-26 KMS-34 H929 LGB321(µM) mtor Raptor B C KMS-11 KMS-26 LGB321 (µm) m-tor IP p-ampk (T172) T-AMPK Raptor IB KMS-34 H929 Heavy chain Deptor LGB321 (µm) p-ampk (T172) T-AMPK D KMS-11 KMS-26 KMS-34 H929 LGB321 (µm) p-pras40 (T246) T-PRAS40 Supplementary Figure 4. (A) ) Pim inhibition does not disrupt the interaction between mtor and Raptor in MM cell lines. Rad001 (100nM) treatment serves as positive control. MM cell lines were treated with increasing doses of LGB321 (0, 0.33 and 1.0µM) for 2hrs, cell lysates were subjected to immunoprecipitation with an anti-raptor antibody, and then analyzed by immunoblotting with anti-mtor and anti-raptor antibodies. (B) Pim inhibition shows no significant effect on Deptor binding to mtor-c1 complex. KMS-26 cells were treated with LGB321 for 2hrs, cell lysates were subjected to immunoprecipitation with an anti-mtor antibody, and then analyzed by immunoblotting with anti-mtor, Raptor and Deptor antibodies. (C) Pim inhibition does not affect p-ampk(t172) levels in MM cell lines. AICAR treatment serves as positive control. MM cells were treated with increasing doses of LGB321 (0, 0.033, 0.1, 0.33 and 1.0µM) and p-ampk(t172) was analyzed by immunoblotting. (D) Pim inhibition does not significantly affect p-pras40(t246) levels in MM cell lines. BKM120, a PI3K kinase inhibitor, serves as positive control. MM cells were treated with increasing doses of LGB321 (0, 0.33 and 1.0µM) for 2hrs, p-pras40(t246) was analyzed by immunoblotting.
9 Relative growth Relative growth Relative growth Relative growth TSC2 shrnas Supplementary Figure 5 A KMS-11 KMS-26 H929 KMS-34 TSC2 Tubulin B KMS-11 KMS-26 Scramble control Days Days H929 KMS-34 Days Days Supplementary Figure 5. TSC2 knockdown in MM cells leads to growth inhibition. (A) TSC2 was knocked down in MM cells by lentivirus-mediated shrnas; (B) TSC2 knockdown in MM cells leads to reduced cell growth, which is monitored by CTG assay daily.
10 Cell lysates IP:TSC2 IB Supplementary Figure 6: Characterization of a phosophospecific antibody for p-tsc2 (Ser-1798) A IP-TSC2 - + Lambda phosphatase P-TSC2 (S1798) T-TSC2 B WT-TSC2 TSC2-S1798A Pim GFP p-tsc2 (by AKT substrate ab) p-tsc2 (S1798) TSC2 TSC2 Pim2 tubulin 7 Supplementary Figure 6. (A) p-tsc2 (Ser-1798) is decreased upon Lambda phosphatase treatment; (B) Pim2 specifically modulates TSC2 phosphorylation on Ser WT-TSC2 or TSC2 S1798A were transfected into TSC2 null 293A cells with either GFP or Pim2, TSC2 was immuno-precipitated and then analyzed for p-tsc2 by a specific p-tsc2 (Ser-1798) antibody, and by an p- AKT-substrate antibody.
11 Supplementary Figure 7: Effect of Pim inhibition on p-erk and p-akt in MM cells + KMS H DMSO LGB321 RAD001 p-p70 (T389) T-P70 p-erk (T202/204) T-ERK p-akt (S473) T-AKT Supplementary Figure 7: Effect of Pim inhibition on p-erk and p-akt in MM cell lines. KMS-11 and H929 cells were treated with either LGB321 (1.0µM) or RAD001 (0.1µM), or both LGB321 and RAD001 for 2 hours. Cell lysates were examined for p-p70 (T389), p-akt (S473), p-erk (T202/204), with total proteins as loading control.
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationSupplementary Figure 1: Normal vs. Tumor expression of PIM kinases mrna across 17 tissue types
Supplementary Figure 1: Normal vs. Tumor expression of PIM kinases mrna across 17 tissue types Supplementary Figure 1 Legend: PIM1, PIM2 and PIM3 mrna expression Expression levels in cancer tissues derived
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationsupplementary information
Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationTECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates
Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Catalog Number RAB0011 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationImpact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationFOXO Reporter Kit PI3K/AKT Pathway Cat. #60643
Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationCaspase-3 Assay Cat. No. 8228, 100 tests. Introduction
Introduction Caspase-3 Assay Cat. No. 8228, 100 tests Caspase-3 is a member of caspases that plays a key role in mediating apoptosis, or programmed cell death. Upon activation, it cleaves a variety of
More informationTotal Histone H3 Acetylation Detection Fast Kit (Colorimetric)
Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationTECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C
Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationSTAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit
STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...
More informationNotch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652
Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationEpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationProtocol for purification of recombinant protein from 300 ml yeast culture
Protocol for purification of recombinant protein from 300 ml yeast culture Equipment and reagents needed: Zirconia beads (0.5 mm diameter from BSP, Germany) Paint Shaker (at 4 C) Tube rotator for 15 ml
More informationSupplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
More informationSupplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationFigure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
More informationab Human Citrate Synthase (CS) Activity Assay Kit
ab119692 Human Citrate Synthase (CS) Activity Assay Kit Instructions for Use For the measurement of mitochondrial citrate synthase (CS) activity in Human samples This product is for research use only and
More informationRecipes for Media and Solution Preparation SC-ura/Glucose Agar Dishes (20mL/dish, enough for 8 clones)
Protocol: 300 ml Yeast culture preparation Equipment and Reagents needed: Autoclaved toothpicks Shaker Incubator set at 30 C Incubator set at 30 C 60 mm 2 sterile petri dishes Autoclaved glass test tubes
More informationAMPK Phosphorylation Assay Kit
AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationEPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric)
More informationSupplementary Figure 1. Method development.
Supplementary Figure 1 Method development. Titration experiments to determine standard antibody:lysate concentration. Lysates (~2 mg of total proteins) were prepared from cells expressing FLAG- tagged
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationRayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit
RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit Catalog #: PEL-NFKBP65-S536-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information
More informationCell Lysis Buffer. Catalog number: AR0103
Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state
More informationSTAT1 (ps727) (Human/Mouse) ELISA Kit
STAT1 (ps727) (Human/Mouse) ELISA Kit Catalog Number KA2171 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT1 (ps727) (Human/Mouse) ELISA (Enzyme-Linked Immunosorbent
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationFor the isolation of mitochondria from P. pastoris and other species of yeast
ab178779 Mitochondrial Yeast Isolation Kit Instructions for Use For the isolation of mitochondria from P. pastoris and other species of yeast This product is for research use only and is not intended for
More informationValidation & Assay Performance Summary
Validation & Assay Performance Summary CellSensor DBE-bla MDA-MB-468 Cell Line Cat. no. K1814 Pathway Description The phosphatidylinositol-3-kinase (PI3K) signaling cascade is essential for cell growth
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More information2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
More informationSTAT3 (py705) (Human/Mouse/Rat) ELISA Kit
STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and
More informationSupplemental material for Hernandez et al. Dicoumarol downregulates human PTTG1/Securin mrna expression. through inhibition of Hsp90
Supplemental material for Hernandez et al. Dicoumarol downregulates human PTTG1/Securin mrna expression through inhibition of Hsp90 Dicoumarol-Sepharose co-precipitation. Hsp90 inhibitors can co-precipitate
More information1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationRayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit
RayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit Catalog #: PEL-DDR2-Y740-T User Manual Last revised March 22, 2018 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607
More informationRayBio Human Phosphotyrosine BTK ELISA Kit
RayBio Human Phosphotyrosine BTK ELISA Kit Catalog #: PEL-BTK-Y User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite
More informationTargeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationData Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory
More informationSupplemental Data. Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB. Supplemental Experimental Procedures
Supplemental Data Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB Dos D. Sarbassov, Siraj M. Ali, Shomit Sengupta, Joon-Ho Sheen, Peggy P. Hsu, Alex F. Bagley, Andrew L. Markhard, and
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationData Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621
Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationK-LISA mtor Activity Kit Cat. No. CBA055
User Protocol CBA055 Rev. 20 December 2006 JSW Page 1 of 8 K-LISA mtor Activity Kit Cat. No. CBA055 Note that this user protocol is not lot-specific and is representative of the current specifications
More informationab For the qualitative measurement of phosphorylated Ser2448 of mtor protein in cell and tissue lysates.
ab168538 mtor (pser2448) ELISA Kit Instructions for Use For the qualitative measurement of phosphorylated Ser2448 of mtor protein in cell and tissue lysates. This product is for research use only and is
More informationGlobal Histone H3 Acetylation Assay Kit
Global Histone H3 Acetylation Assay Kit Catalog Number KA0633 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationSensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*
SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* Catalog # 72146 Kit Size 500 Assays (96-well plate) Optimized Performance: This kit is optimized to detect alkaline phosphatase activity Enhanced
More informationab Mammalian Cell Lysis Buffer 5X
Version 2 Last updated 19 December 2018 ab179835 Mammalian Cell Lysis Buffer 5X For simple and rapid preparation of mammalian cell lysates. View kit datasheet: www.abcam.com/ab179835 (use www.abcam.cn/ab179835
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupplementary Data. Supplementary Methods:
Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationEPIGENTEK. EpiQuik Global Histone H3 Acetylation Assay Kit. Base Catalog # P-4008 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Histone H3 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H3 Acetylation Assay Kit is suitable for specifically measuring global
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationEPIGENTEK. EpiQuik Global Histone H4 Acetylation Assay Kit. Base Catalog # P-4009 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Histone H4 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H4 Acetylation Assay Kit is suitable for specifically measuring global
More informationMinute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)
Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit Catalog number: SM-005 Description Minute TM plasma membrane (PM) protein isolation kit is a novel and patented native PM protein
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationSensoLyte 520 HDAC Activity Assay Kit *Fluorimetric*
SensoLyte 520 HDAC Activity Assay Kit *Fluorimetric* Catalog # 72084 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect HDAC activity. Enhanced Value: It provides
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationGFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
More information