Replacement of Marine Fish Oil with de novo Omega 3 Oils from Transgenic Camelina sativa in Feeds for Gilthead Sea Bream (Sparus aurata L.

Transcription

1 DOI.7/s ORIGINAL ARTICLE Replcement of Mrine Fish Oil with de novo Omeg Oils from Trnsgenic Cmelin stiv in Feeds for Gilthed Se Brem (Sprus urt L.) Mónic B. Betncor M. Sprgue D. Montero S. Usher O. Synov P. J. Cmpell J. A. Npier M. J. Cllero M. Izquierdo D. R. Tocher Received: July 6 / Accepted: 9 August 6 AOCS 6 Astrct Omeg- (n-) long-chin polyunsturted ftty cids (LC-PUFA) re essentil components of the diet of ll vertertes. The mjor dietry source of n- LC-PUFA for humns hs een fish nd sefood ut, prdoxiclly, frmed fish re lso relint on mrine fisheries for fish mel nd fish oil (FO), trditionlly mjor ingredients of qufeeds. Currently, the only sustinle lterntives to FO re vegetle oils, which re rich in C 8 PUFA, ut devoid of the eicospentenoic (EPA) nd docoshexenoic cids (DHA) undnt in FO. Two new n- LC-PUFA sources otined from geneticlly modified (GM) Cmelin stiv contining either EPA lone (ECO) or EPA nd DHA (DCO) were compred to FO nd wild-type cmelin oil (WCO) in juvenile se rem. Neither ECO nor DCO hd ny detrimentl effects on fish performnce, lthough finl weight of ECO-fed fish (7 g) ws slightly lower thn tht of FO- nd DCO-fed fish ( nd 7 g, respectively). Inclusion of the GM-derived oils enhnced the n- LC- PUFA content in fish tissues compred to WCO, lthough limited iosynthesis ws oserved indicting ccumultion of dietry ftty cids. The expression of genes involved in severl lipid metolic processes, s well s fish helth nd * Mónic B. Betncor m..etncor@stir.c.uk Fculty of Nturl Sciences, Institute of Aquculture, University of Stirling, Stirling FK9 LA, UK Grupo de Investigción en Acuicultur (GIA), Instituto Universitrio Ecoqu, Universidd de Ls Plms de Grn Cnri, Ctr. Tlirte s/n, 5 Telde, Ls Plms, Cnry Islnds, Spin Deprtment of Biologicl Chemistry nd Crop Protection, Rothmsted Reserch, Hrpenden AL5 JQ, UK Biomr Ltd., North Shore Rod, Grngemouth FK 8UL, UK immune response, in oth liver nd nterior intestine were ltered in fish fed the GM-derived oils. This showed similr pttern to tht oserved in WCO-fed fish reflecting the hyrid ftty cid profile of the new oils. Overll the dt indicted tht the GM-derived oils could e suitle lterntives to dietry FO in se rem. Keywords Se rem Geneticlly modified Cmelin Sustinle feeds Arevitions ACTB β Actin ADC Apprent digestiility coefficient ARA Archidonic cid CASP Cspse CPT Crnitine plmitoyltrnsferse CYTB Cytochrome DCO EPA + DHA Cmelin oil DHA Docoshexenoic cid DPA Docospentenoic cid ECO EPA-Cmelin oil ELFα Elongtion fctor α ELOVL Ftty cid elongse EPA Eicospentenoic cid FABP Ftty cid inding protein FADS Ftty cyl desturse FAME Ftty cid methyl esters FCR Feed conversion rtio FM Fish mel FO Fish oil GC Gs liquid chromtogrphy GM Geneticlly modified HL Heptic lipse HSI Heptosomtic index IL Interleukin

2 K Condition fctor LC-PUFA Long chin polyunsturted ftty cid(s) LPCAT Lysophosphtidylcholine cyltrnsferse LPL Lipoprotein lipse LTB Leukotriene B MUFA Monounsturted ftty cid(s) n- Omeg n-6 Omeg 6 n.d. Not determined NMDS Non-metric multidimensionl scling plot NPTII Knmycin resistnce gene NTC Non-templte control PCA Principl component nlysis PCNA Proliferting cell nucler ntigen PGE Prostglndin E PPARα Peroxisome prolifertor-ctivted receptor α PUFA Polyunsturted ftty cid(s) SAFA Sturted ftty cid(s) SGR Specific growth rte SREBP Sterol regultory element inding protein TAG Tricylglycerol(s) VLC-FA Very long chin ftty cid(s) VO Vegetle oil(s) VSI Viscerosomtic index WCO Wild-type Cmelin oil Introduction Fish is considered s the min source of the eneficil omeg- (n-) long-chin polyunsturted ftty cids (LC- PUFA) eicospentenoic nd docoshexenoic cids, EPA (:5n-) nd DHA (:6n-), respectively. These LC- PUFA ply importnt roles in neurl development, immune nd inflmmtory responses s well s hving eneficil effects in certin pthologies such s those ffecting the crdiovsculr nd neurologicl systems or some types of cncers [ 5]. According to estimtions of the Interntionl Society for the Study of Ftty cids nd Lipids (ISSFAL), dily intke of 5 mg of EPA nd DHA is recommended for optimum crdiovsculr helth [6]. In world where the glol popultion is expected to grow to rech 9.6 illion people y 5 [7], more thn.7 million metric tonnes of EPA + DHA would e necessry to cover nnul humn requirements. This quntity is not met y the ctul totl glol supply of n- LC-PUFA nd thus there is lrge gp etween supply nd demnd [8, 9]. Frmed fish nd sefood ccounted for. % of totl production (including for non-food uses) from cpture fisheries nd quculture in, up from. % in nd. % in [7]. Although fish frming contriutes to the glol n- LC-PUFA production in order to meet humn dietry requirements, the mrine ingredients, fish mel nd oil (FM nd FO, respectively) re still, lmost exclusively, the only rw mterils in qufeeds tht, in turn, cn supply n- LC-PUFA to frmed fish. The use of high levels of FM nd FO to mintin n- LC-PUFA levels in frmed fish is not sustinle prctice s they re finite (on n nnul sis) nd limited resources [9]. Sustinle lterntives to FO used t present re vegetle oils (VO), which re rich in C 8 ut lck n- LC-PUFA, which in turn reduces the proportions of EPA nd DHA in frmed fish, nd does not significntly increse glol production of n- LC-PUFA [9]. Otining lterntive sources of n- LC-PUFA from other mrine orgnisms such s microlge or zooplnkton (krill or copepods) poses significnt technologicl nd economic chllenges nd there re no currently fesile lterntives for mss supply [9]. Therefore, it is cler tht completely new, de novo sources of EPA nd DHA re required. In this respect, metolic engineering of oilseed crops such s Cmelin stiv or flse flxseed provides currently vile option to deliver n- LC-PUFA in the plce of fish oil [ ]. By the insertion of cssettes contining five or seven ftty cyl desturse nd elongse genes from severl lge species, geneticlly modified (GM) Cmelin is cple of producing EPA or oth EPA nd DHA in their seeds []. Recent studies hve successfully demonstrted the fesiility of using oth the high-epa nd EPA + DHA oils s sustitutes for FO in feeds for post-smolt Atlntic slmon (Slmo slr) without compromising fish growth or helth [ 5]. Totl replcement of FO in slmonids hs een shown to e fesile without compromising fish performnce, lthough reduction in tissue n- LC-PUFA ws oserved due to reduced dietry intke nd limited iosynthesis [6 8]. In contrst, totl sustitution of FO y VO in gilthed se rem (Sprus urt) feeds significntly reduced fish performnce [9] nd gretly ltered ftty cid profile of rem tissues [] given their incomplete LC-PUFA iosynthesis pthwy [, ]. In this context, the im of the present study ws to evlute the new GM Cmelinderived oils tht contin fetures of oth mrine fish (n- LC-PUFA) nd terrestril plnt (high levels of C 8 ftty cids) oils s sustitutes for FO in feeds for mrine teleost species tht hve very limited LC-PUFA iosynthesis cpcity from C 8 PUFA []. The specific ojectives were to evlute the efficcy of the high-epa nd EPA + DHA oils s replcements for dietry FO in feeds for gilthed se rem juveniles in terms of growth, feed efficiency, helth nd welfre, nd nutritionl qulity of the fish focussing prticulrly on tissue levels of EPA nd DHA. Additionlly, ssessment of the expression of genes of lipid metolism s well s moleculr mrkers of helth nd immune function ws lso performed.

3 Mterils nd Methods Diets nd Feeding Tril Four isonitrogenous nd isoenergetic diets were formulted to contin 5 g/kg crude protein nd g/kg crude lipid, nd mnufctured t BioMr Tech-Centre (Brnde, Denmrk). The four feeds were produced y vcuum coting identicl dry sl extruded pellets with either fish oil (FO), wild-type Cmelin oil (WCO), EPA-Cmelin oil (ECO) or EPA + DHA-Cmelin oil (DCO) nd were nmed ccording to the oils used (Tle ). ECO nd DCO oils were produced s previously descried [,, 5]. In line with commercil prctice, non-deftted fishmel ws employed s the mjor protein source to ensure EFA requirements were met [], nd yttrium oxide ws dded (.5 g/kg) s n inert mrker for clcultion of lipid nd ftty cid digestiility. A totl of juvenile gilthed se rem with n verge ody weight of 55.5 ±. g (men ± SD) were distriuted into sewter tnks (5 per tnk) nd fed one of the four experimentl feeds in triplicte for weeks. The experimentl system comprised 5 L tnks supplied y flow-through sewter (9 L/min) t mient temperture tht verged. ±.6 C. Experimentl feeds were delivered until pprent stition y hnd-feeding three times dy with uneten feed collected min lter in order to determine ccurte feed efficiency. Collected feed ws plced in n oven ( C) until constnt weight ws chieved in order to clculte feed intke sed on initil moisture content. All procedures were conducted in ccordnce with the regultions set forwrd y the Spnish RD 5/ (BOE 8th Ferury ) nd the Directive /6/EU of the Europen Prliment nd of the Council of Septemer on the protection of nimls used for scientific purposes. The experiment ws sujected to ethicl review y the Animl Welfre nd Bioethicl Committee t the University of Ls Plms de Grn Cnri (Ref 7/ CEBA ULPGC). Smple Collection nd Digestiility After weeks of feeding, fish were not fed for 8 h prior to eing smpled. All fish were nesthetised with clove oil nd weighed nd their length mesured. Ten fish for iometric mesurements (hepto-somtic nd viscero-somtic indices) nd tissue nlyses were killed y overdose with clove oil. Smples of nterior intestine, liver, gills, flesh nd rin from fish per tnk were immeditely frozen Tle Formultions, proximte nd ftty cid compositions (% of ftty cids) of the experimentl feeds n.d. not detected, WCO wild-type Cmelin oil feed Ftty cid compositions of the oils were provided previously [, 5] Includes 5:, : nd : c Includes 6:n-9, :n-, :n-7, :n-9 nd :n-9 d Includes :n-6 nd :5n-6 Feed ingredients (%) Fish mel, NA LT Fish mel, SA 68 Superprime.... Soy protein concentrte (6 %) Mize gluten Whet Fish oil.5 Wild-type Cmelin oil.5 EPA-Cmelin oil.5 EPA + DHA-Cmelin oil.5 Vitmins/minerls Yttrium oxide Anlysed composition Dry mtter (%) Crude protein (%) Crude lipid (%) Ash Ftty cid composition (mol%) Ʃ sturted Ʃ monounsturted c :n :n :n-6. n.d.7.8 :n :n-6.7 n.d. n.d. n.d. Ʃ n-6 PUFA d :n :n :n :5n :5n :6n Ʃ n- PUFA Ʃ PUFA e Totl n- LC-PUFA e Includes C 6 PUFA. DCO, feed contining EPA + DHA oil from trnsgenic Cmelin; ECO, feed contining high-epa oil from trnsgenic Cmelin; FO, fish oil feed; LC- PUFA, long-chin polyunsturted ftty cids (sum of :n-, :5n- :5n- nd :6n-)

4 nd stored t 7 C prior to totl lipid extrction nd ftty cid nlyses. Further smples of liver nd nterior intestine were collected from six fish per tretment (two per tnk) nd stilised in RNAlter (Sigm, Poole, UK) prior to RNA extrction. All remining fish were fed for further week prior to feces eing collected ccording to the method descried y []. Briefly, fish were killed y overdose with clove oil 7 h fter eing fed nd fecl smples collected fter dissecting the rectum of the fish. Fecl smples were pooled y tnk nd stored C prior to lipid nd ftty cid nlysis. The pprent digestiility coefficient (ADC) of lipid nd selected ftty cids ws clculted s: [ (Y O concentrtion in feed/ Y O concentrtion in feces) (lipid or ftty cid concentrtion in feces/lipid or ftty cid concentrtion in feed)]. The concentrtion of individul ftty cids in diets nd feces were clculted sed on the reltive proportion of ech ftty cid compred with known mount of the internl stndrd (7:) dded nd the totl lipid content determined in the smples. Yttrium ws estimted fter cid digestion of the smples vi Inductively Coupled Plsm Mss Spectrometry (Thermo Scientific, XSeries ICP-MS, USA) using rgon nd hydrogen s crrier gs. Proximte Composition Diets nd whole fish were ground efore determintion of proximte composition ccording to stndrd procedures [5]. Fish were pooled per tnk (n = ) nd freeze-dried until further nlysis wheres three technicl replictes of feeds (single tch production) were nlysed. Moisture contents were otined fter drying in n oven t C for h nd sh content determined fter incinertion t 6 C for 6 h. Crude protein ws mesured y determining nitrogen content (N 6.5) using utomted Kjeldhl nlysis (Tector Kjeltec Auto nlyser, Foss, Wrrington, UK) nd crude lipid content determined grvimetriclly fter Soxhlet lipid extrction (Tector Soxtec system 5 Auto Extrction pprtus). Feces nd Tissue Lipid Content nd Ftty Acid Composition Smples of feces, muscle (flesh), liver, gills, nterior intestine nd rin from three fish per tnk were prepred s pooled homogentes (n = per tretment) nd totl lipid extrcted y homogenising in chloroform/methnol (:, v/v) using n Ultr-Turrx tissue disrupter (Fisher Scientific, Loughorough, UK), with content determined grvimetriclly [6]. Ftty cid methyl esters (FAME) were prepred from totl lipid y cid-ctlysed trnsesterifiction t 5 C for 6 h [7], nd FAME extrcted nd purified s descried previously [8]. FAME were seprted nd quntified y gs-liquid chromtogrphy using Fisons GC-86 (Thermo Scientific, Miln, Itly) equipped with m. mm i.d..5 μm ZB-wx column (Phenomenex, Cheshire, UK), on-column injector nd flme ionistion detector. Dt were collected nd processed using Chromcrd for Windows (version.; Thermoquest Itli S.p.A., Miln, Itly). Individul FAME were identified y comprison to known stndrds nd pulished dt [8] nd results expressed s mole percentge. Histologicl Anlysis Smples of liver nd intestine from fish per tnk (n = 6 per tretment) were fixed in % uffered formlin dehydrted through grded lcohol, then xylene, nd finlly emedded in prffin wx. The prffin locks were sectioned t μm nd stined with hemtoxylin nd eosin [9] efore lind exmintion under light microscope. Stined sections of liver were ssessed for cytoplsmic lipid vcuoliztion nd peripncretic ft infiltrtion using four grded exmintion scheme:, not oserved;, few;, medium;, severe. Posterior intestine sections were exmined for integrity of the intestinl mucos nd the presence of ny inflmmtory response. RNA Extrction Liver nd nterior intestine from six individul fish per dietry tretment were homogenised in ml of TriRegent (Sigm-Aldrich, Dorset, UK) RNA extrction uffer using ed tissue disruptor (Bio Spec, Brtlesville, Oklhom, USA). Totl RNA ws isolted following the mnufcturer s instructions nd quntity nd qulity determined y spectrophotometry using Nnodrop ND- (Ltech Int., Est Sussex, UK) nd electrophoresis using 5 ng of totl RNA in % grose gel. cdna ws synthesised using μg of totl RNA nd rndom primers in μl rections nd the High cpcity reverse trnscription kit without RNse inhiiter ccording to the mnufcturer s protocol (Applied Biosystems, Wrrington, UK). The resulting cdna ws diluted -fold with milliq wter. Expression of genes of interest ws determined y quntittive PCR (qpcr) from fish fed ll diets (Tle ). Results were normlised using reference genes, elongtion fctor α (elfα) nd et-ctin (ct), s their expression did not vry mong tretments. The efficiency of the primers for ech gene ws previously evluted y seril dilutions to ensure tht it ws close to %. qpcr ws performed using Biometr TOpticl Thermocycler (Anlytik Jen, Goettingen, Germny) in 96-well pltes in duplicte -μl rection volumes contining μl of Luminris Color HiGreen qpcr Mster Mix (Thermo Scientific, Hemel Hempsted,

5 Tle Detils of primer used for qpcr or PCR nlysis Aim Trnscript Primer sequence (5 ) Amplicon (p) T ( C) Accession no. qpcr fds F: GCAGGCGGAGAGCGACGGTCTGTTCC 7 6 AY5579 R: AGCAGGATGTGACCCAGGTGGAGGCAGAAG elovl F: CGGTGGCAATCATCTTCC 79 6 JX9757 R: TCAACTGGCTGTCTGTGT elovl5 F: CCTCCTGGTGCTCTACAAT 6 AY66879 R: GTGAGTGTCCTGGCAGTA lpct F: CGTGATAGCCTTATCTGTCGTATGC 9 6 JQ96 R: CCGTCCTCCTCTGCCTCAA FABP F: CGAGCACATTCCGCACCAAAG 9 6 AM9576 R: CCCACGCACCCGAGACTTC hl F: TTGTAGAAGGTGAGGAAAACTG 6 EU579 R: GCTCTCCATCAGACCATCC lpl F: CGTTGCCAAGTTTGTGACCTG 9 6 AY9567 R: AGGGTGTTCTGGTTGTCTGC cpt F: GTGCCTTCGTTCGTTCCATGATC 8 6 JQ88 R: TGATGCTTATCTGCTGCCTGTTTG cpt F: CCACCAGCCAGACTCCACAG 78 6 DQ8668 R: CACCACCAGCACCCACATATTTAG srep F: AGGGCTGACCACAACGTCTCCTCTCC 77 6 JQ7779 R: GCTGTACGTGGGATGTGATGGTTTGGG PPARα F: TCTCTTCAGCCCACCATCCC 6 6 AY5999 R: ATCCCAGCGTGTCGTCTCC PPARγ F: CGCCGTGGACCTGTCAGAGC 6 AY59 R: GGAATGGATGGAGGAGGAGGAGATGG csp F: CCAGTCAGTCGAGCAGATGA 6 EU7 R: GAACACACCCTCGTCTCCAT pcn F: GATGTGGAGCAGCTGGGTAT 5 6 FG6675 R: TGTCTACGTTGCTGGTCTGG il8 F: CAGCAGAGTCTTCATCGTCACTATTG 66 6 JX97669 R: AGGCTCGCTTCACTGATGG ct F: TCCTGCGGAATCCATGAGA 5 6 X899 R: GACGTCGCACTTCATGATGCT ef F: ACGTGTCCGTCAAGGAAATC 9 6 AF87 R: GGGTGGTTCAGGATGATGAC PCR nptii F: CTCACCTTGCTCCTGCCGAGA 5 6 KJ879. R: CGCCTTGAGCCTGGCGAACAG cyt F: CCGCTTCTTTGCCTTCCATT 9 57 NC_6. R: AGATTAGGGGCGAATAGGGC fds ftty cid desturse, elovl ftty cid elongse, elovl5 ftty cid elongse 5, lpct lysophosphtidylcholine cyltrnsferse, FABP ftty cid inding protein, hl heptic lipse, lpl lipoprotein lipse, cpt crnitine plmitoyltrnsferse A liver isoform, cpt Crnitine plmitoyltrnsferse muscle isoform, srep sterol regultory element inding protein, PPARα peroxisome prolifertor-ctivted receptor α, PPARγ peroxisome prolifertor-ctivted receptor γ, csp cspse, pcn proliferting cell nucler ntigen, il8 interleukin 8, ct β-ctin, efα elongtion fctor, nptii neomycin phosphotrnsferse II, cyt cytochrome UK), μl of the primer corresponding to the nlysed gene ( pmol), μl of moleculr iology grde wter nd 5 μl of cdna, with the exception of the reference genes, which were determined using μl of cdna. In ddition mplifictions were crried out with systemtic negtive control (NTC-non templte control) contining no cdna. Stndrd mplifiction prmeters contined UDG pre-tretment t 5 C for min, n initil denturtion step t 95 C for min, followed y 5 cycles: 5 s t 95 C, s t 6 C nd s t 7 C.

6 Trcking of the nptii Gene in Gilthed Se Brem Liver, Intestine nd Muscle Genomic DNA ws extrcted from fish flesh, pyloric cec nd liver using REALPURE extrction kit (Vlenci, Spin) ccording to the mnufcturer s instructions. Briefly, tissue smples were incuted in μl of lysis solution overnight t 55 C with μl of Proteinse K. Following the incution, smples were cooled down nd RNse tretment performed (7 C for 6 min). After protein precipittion, DNA ws precipitted y dding 6 μl of isopropnol nd hydrted with 5 mm Tris. Totl DNA ws quntified y spectrophotometry nd qulity determined y electrophoresis s descried ove. Two primers pirs trgeting n endogenous se rem gene (cytochrome ; cyt) nd trnsgene mrker for ECO plnts (Knmycin resistnce gene, nptii) were used (Tle ). Fifty ng of extrcted DNA ws used in PCR mplifictions tht were performed in finl volume of μl, contining 5 μl of MyTq HS Mix (Bioline, London, UK). Ech set of PCR included positive control (DNA from geneticlly modified-cmelin) nd non-templte control (NTC). Sttisticl Anlysis All dt re men ± SE (n = ) unless otherwise specified. Percentge dt were sujected to rcs in squre-root trnsformtion prior to sttisticl nlyses. Dt were tested for normlity nd homogeneity of vrinces with Levene s test prior to one-wy nlysis of vrince followed y Tukey Krmer HSD multiple comprisons of mens. A non-metric multidimensionl scling plot (NMDS) ws performed in order to seprte the ftty cid profile of the five evluted tissues. Stress vlues <.5 indicted n excellent representtion of the clusters nd <. nd <. indicted good nd potentilly useful plots respectively. All sttisticl nlyses were performed using SPSS softwre (IBM SPSS Sttistics 9; SPSS Inc., Chicgo, IL, USA), excepting the NMDS nlysis (PAST) []. Results Fish Performnce Se rem fed ll the experimentl diets more thn douled in weight fter weeks feeding, nd no mortlities were recorded (Tle ). Fish fed ECO displyed the lowest finl weight nd totl length mong the dietry tretments, lthough not different to fish fed WCO, with highest growth chieved in fish fed the FO nd DCO feeds (Tle ). Finl weights reflected feed intke, which ws highest in fish fed FO nd DCO, lowest in fish fed ECO nd intermedite in fish fed WCO. There were no significnt differences in weight gin or specific growth rte (SGR) other thn it eing slightly lower in fish fed ECO compred to fish fed FO (Tle ). There were no differences in the heptosomtic or Tle Growth performnce, survivl, feed utiliztion nd sic nd whole ody proximte composition (% dry weight) of gilthed se rem fter weeks of feeding the experimentl diets Dt re expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, ECO feed contining high-epa oil from trnsgenic Cmelin, FI feed intke, FO fish oil feed, HSI heptosomtic index, k condition fctor, SGR specific growth rte, VSI viscerosomtic index, WCO wild-type Cmelin oil feed Initil weight (g) 55. ± ± ± ± 6. Finl weight (g) 9.9 ±.8. ± ± ±. Finl length (cm) 8. ±.5 8. ± ±.6 8. ±.9 Weight gin (g) 7.5 ±. 7.5 ± ±.6 7. ±. HSI. ±..6 ±.. ±..5 ±. VSI 8. ±. 8. ±. 7.8 ± ±. FI (g/tnk) 8. ± ± ± ± 7.9 FCR. ±.. ±.. ±.. ±. SGR. ±.. ±..9 ±.. ±. k. ±.. ±.. ±.. ±. Whole ody composition (% dry wt.) Crude protein 7.5 ±.7 8. ± ±. 9. ±.5 Crude lipid 5.7 ±. 8. ± ±. 7. ±. Ash 9.8 ± ± ± ±.

7 viscerosomtic index (HSI nd VSI, respectively), lthough vlues tended to e lowest in fish fed DCO nd ECO (p =.576 nd.869 respectively). No differences were oserved in other fish performnce prmeters including feed conversion rtio (FCR) or k condition fctor (Tle ). Lipid nd Ftty Acid Digestiility The pprent digestiility coefficients (ADC) were clculted for lipids nd ftty cids using yttrium oxide s n inert mrker. There were no significnt differences in crude lipid ADC mong the dietry tretments (Tle ). Figure represents the nlysed ftty cid composition of feeds nd feces in order to compre which ftty cid groups were preferentilly digested nd sored (i.e. those found in lower mounts in feces). There ws trend for higher proportions of sturted ftty cids (SAFA) in feces reltive to the feeds, with the ADC for SAFA vrying etween round 8 nd 87 %, generlly slightly lower thn the ADCs for the other ftty cids (Tle ). In contrst, proportions of PUFA in the feces were generlly lower compred to proportions in feeds with ADCs rnging from 9 to lmost 97 %, wheres proportions of monounsturted ftty cid (MUFA) were similr in diet nd feces with ADC rnging from round 8 to 9 % (Fig. ). Some vritions were found etween feeds, with ADC of SAFA eing highest in fish fed FO nd lowest in fish fed ECO, with ADC of MUFA eing higher in fish fed ECO nd DCO compred to fish fed FO (Tle ). Similrly, ADC of 8:n-6 nd n-6 PUFA were higher in fish fed DCO compred to fish fed FO. Digestiility ws highest with n- PUFA generlly lthough ADC for EPA ws lowest in WCO, lthough not different to tht of ECO. Regrding DHA, FO nd DCO showed the highest ADC, eing over 96 % (Tle ). Whole Fish Composition No differences were found in ny of the nlysed components mong fish fed the four dietry tretments (Tle ). However, there were trends for higher lipid content in fish fed the vegetle-sed feeds (p =.86), nd incresed protein in fish fed the ECO nd DCO feeds contining oil from trnsgenic Cmelin (p =.). Tissue Lipid Content The lipid content of flesh (muscle) vried etween round nd.5 % ut diet hd no significnt effect (Tle 5). In contrst, the lipid content of liver ws higher in fish fed WCO thn in fish fed FO with fish fed the oils derived from trnsgenic Cmelin showing intermedite vlues (Tle 6). Diet hd no significnt effect on the lipid content of other tissues including gill (Tle 6), nterior intestine nd rin (Tle 7). Tle Apprent digestiility coefficient (ADC) of lipid nd ftty cids in gilthed se rem fed the four experimentl diets differing in oil source Dt expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets. Sttisticl differences were determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, ECO feed contining oil from trnsgenic Cmelin, FO fish oil feed, WCO wild-type Cmelin oil feed A Includes : nd : B Includes 6:n-9 nd :n-9 C Includes :n-6 nd :5n-6 D Includes C 6 PUFA Tissue Ftty Acid Compositions Muscle (Flesh) Lipid ADC 8.8 ±. 8. ± ± ± 5. : 88.8 ±. 8. ±. 8. ± ± 6. 5: 99. ± ± ±. 98. ±.6 6: 8. ± ± ± ± 5.5 8: 78.9 ± ± ± ±. Totl 87. ± ±. 8. ±. c 8. ±.5 sturted A 6:n ±.8 8. ± ±. 9.8 ±. 8:n ± ± ± ± 8.6 8:n ± ± ± ± 6. :n ± ± ± ±. :n ± ± ± ±. :n- 9. ± ± ±.5 9. ±. :n ± ± ± ±.6 Totl 8. ± ± ± ±. monoenes B 8:n ± ±. 95. ± ±.6 :n ± ±. 9. ± ±. :n ±. 9.9 ±. 96. ± ±.5 Totl n-6 9. ±. 9. ± ±. 96. ±.5 PUFA C 8:n- 9.7 ±. 95. ± ±. 97. ±. 8:n ±. 9.9 ± ±. 98. ±. :n- 96. ±. 9.8 ±.5 9. ±. 95. ±.5 :n- 95. ±. 8. ± ± ±. :5n- 98. ± ± ±. 98. ±. :5n- 9. ±.5 8. ± ±. 9. ± 5. :6n ±. 9.6 ±. 9.6 ± ±. Totl n- 97. ±. 95. ± ±. 97. ±. PUFA Totl PUFA D 96. ±.7 9. ± ± ±. No differences were oserved in the proportions of totl n- PUFA in muscle (p =.58), lthough cler differences

8 9 8 7 SAFA MUFA PUFA FO nd DCO nd higher thn in fish fed WCO, with fish fed ECO showing intermedite vlues. Agin, the totls of EPA + DHA nd EPA + DPA + DHA in fish fed ll feeds were in the rnk order FO > ECO > DCO > WCO. Proportions of totl n-6 PUFA were higher in liver of fish-fed ECO nd DCO reflecting the higher dietry n-6 contents, prticulrly 8:n-6 nd rchidonic cid (ARA, :n-6). 6 Gills % 5 Diet Feces Diet Feces Diet Feces Diet Feces In generl terms, gill ftty cid compositions mirrored dietry input, lthough some smll differences were found (Tle 6). Proportions of EPA vried in the rnk order FO = ECO > DCO > WCO, DHA in the rnk order FO > DCO > ECO = WCO, nd EPA + DHA nd EPA + DPA + DHA in the rnk order FO > ECO > DCO > WCO. 8:n-6 ws higher in gills of fish fed the VO diets compred to fish fed FO while ARA vried in the rnk order ECO > DCO = FO > WCO (Tle 6). Fig. Ftty cid compositions (mol%) of the four experimentl feeds nd feces showing preferentil order of sorption with differing degree of unsturtion of dietry ftty cids were found in individul ftty cids (Tle 5). The mole percentges of EPA were highest in fish fed FO nd ECO, lowest in fish fed WCO nd intermedite in fish fed DCO. Proportions of DHA were similr in fish fed FO nd DCO nd higher thn in fish fed WCO, with fish fed ECO showing intermedite vlues. Fish fed the FO nd ECO diets displyed similr proportions of n- docospentenoic cid (DPA, :5n-) in flesh, which were significntly higher thn those found in fish fed WCO or DCO. The totls of EPA + DHA nd EPA + DPA + DHA in fish fed ll feeds vried in the rnk order FO > ECO > DCO > WCO. The proportions of 8:n-6 nd totl n-6 PUFA were higher in flesh of se rem fed ll the diets contining VO (WCO, ECO nd DCO) compred to fish fed FO (Tle 5). No differences were oserved in totl SAFA nd totl MUFA were higher in fish fed FO nd WCO compred to fish fed the oils from trnsgenic Cmelin. Liver The ftty cid profile of liver ws similr to tht of muscle nd minly reflected dietry compositions. No differences were found in totl n- PUFA mong the four dietry tretments s low levels of n- LC-PUFA were ssocited with high levels of short chin precursors (Tle 6). The percentges of EPA were similr nd highest in fish fed FO nd ECO, lowest in fish fed WCO nd intermedite in fish fed DCO. Proportions of DHA were similr in fish fed Anterior Intestine Proportions of EPA, DHA nd totl EPA + DPA + DHA vried in nterior intestine with essentilly the sme pttern s descried for gills (Tle 7). However, totl n-6 PUFA contents were higher in nterior intestine thn in the other tissues nlysed, prticulrly in fish fed the diets contining oil from trnsgenic Cmelin due to higher levels of 8:n-6 nd ARA. Brin The ftty cid composition of rin ws lest influenced y diet, with fewer individul ftty cids showing significnt differences nd the mgnitude of differences eing lower (Tle 7). Specificlly nd importntly, DHA, EPA + DHA, EPA + DPA + DHA nd EPA/DHA rtio did not vry etween fish fed the different diets, nd neither did 8:n-6 or the totls of n- PUFA, PUFA, SAFA nd MUFA. The non-metric multidimensionl scling (NMDS) plot clerly showed tht tissue ftty cid compositions were ffected y the dietry input rther thn y tissue type with the exception of rin, which clustered in different group (Fig., stress.7). This ws confirmed y the glol R vlue nd low p otined (R =.8; p <.) when compring the feeds. Pir-wise R indicted tht the segregtion ws strongest etween fish fed FO nd WCO (R =.7; p =.5), wheres the wekest seprtion ws oserved etween fish fed the ECO nd DCO diets (R =.; p =.). The tissue ftty cid profiles of fish fed the two trnsgenic-derived oils did not show high seprtion with WCO (R =. nd., nd p =. nd. for

9 Tle 5 Totl lipid content (percentge of wet weight) nd totl lipid ftty cid composition (mol%) of muscle (flesh) of se rem fter feeding the experimentl diets for weeks Lipid content (%).5 ±.6.6 ±.6.9 ±.6.5 ±.5 Ftty cid composition :.6 ±.. ±.. ±.. ±. 6: 9.6 ±. 7. ± ±. 6.6 ±. 8:. ±.. ±..6 ±..8 ±. :. ±.. ±..7 ±..6 ±. Totl sturted A 9. ±. 5. ±.9.7 ±..7 ±. 6:n ±.. ±.. ±.. ±. 8:n ±.6. ±.7 7. ± ±. 8:n-7. ±..5 ±.7.5 ±.. ±. :n-. ±.. ±.. ±.. ±. :n-9. ±.. ±.. ±.. ±. :n-7. ±.. ±.. ±.. ±. :n-. ±.. ±..9 ±..9 ±. :n-9. ±.. ±.5.7 ±..7 ±. Totl monounsturted.9 ±.5 5. ±. 9. ±.. ±.7 B 8:n ±.. ±..6 ±..6 ±. 8:n-6. ±. c. ±. c.6 ±..8 ±. :n-6. ±..8 ±.. ±..6 ±. :n-6. ±.. ±..9 ±.. ±. :n-6.9 ±. c.6 ±. c.7 ±.. ±. :n-6. ±. c. ±. c. ±.. ±. Totl n-6 PUFA C 8.5 ±.. ±. 9. ±. 8.7 ±. 8:n-. ±. d. ±..6 ±. c 5.8 ±. 8:n-. ±..6 ±. d.7 ±. c.7 ±. :n-. ±..6 ±.5.5 ±.. ±. :n-.7 ±..6 ±.. ±..5 ±. :5n- 8. ±..5 ±. c 7.8 ±. 5.7 ±. :5n-.9 ±.. ±. c.9 ±.. ±. :6n-.8 ±. 7. ±.9 c 8. ±.9 c 9.7 ±.6 Totl n- PUFA 5. ±. 5.6 ±. 6. ±. 6. ±.5 Totl PUFA D 5.8 ±.6 c 9.8 ±. c 6. ±. 5. ±.5 EPA + DHA 8.8 ±.. ±. 6. ±.. ±.5 EPA/DHA.7 ±..6 ±..9 ±..5 ±. EPA + DPA + DHA.7 ±.. ±. 9. ±. 6.6 ±.6 Dt re expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, DHA docoshexenoic cid (:6n-); DPA, docospentenoic cid (:5n-), ECO feed contining high-epa oil from trnsgenic Cmelin, EPA eicospentenoic cid (:5n-), FO fish oil feed, WCO wild-type Cmelin oil feed A Includes 5:, : nd : B Includes 6:n-9 nd :n-9 C Includes :5n-6 D Includes C 6 PUFA ECO nd DCO, respectively). Tissue-wise, wek segregtion ws oserved (glol R =.6; p =.8), lthough rin displyed strong seprtion from other tissues (i.e. R = for muscle nd.958 for gill). Tissue Histology Fish fed the FO diet showed regulr heptocyte morphology with lrge centrlly locted nuclei with few

10 Tle 6 Totl lipid content (percentge of wet weight) nd ftty cid compositions (mol%) of totl lipid of liver nd gills of se rem Liver Lipid content 7.6 ±.6. ± ±. 8.6 ±.6 Ftty cid composition 6:.8 ±. 8. ±. 6.7 ±.9 8. ±. Totl sturted A.7 ± ± ± ±.8 8:n-9. ±..6 ± ±. 8.6 ±.8 Totl monounsturted B 5. ±.7 7. ±. 9. ±.9. ±. 8:n-6.6 ±.7 c.9 ±.7.6 ±.6. ±.7 :n-6. ±..6 ±. c. ±..7 ±. :n-6. ±. c. ±. c. ±.. ±. Totl n-6 PUFA C 7. ±.6 c.8 ±.9 9. ±. 7.9 ±.9 8:n-.8 ±. c 9.8 ±.5. ±. 5. ±.5 :5n- 7. ±.. ±.6 c 6.9 ±.7.9 ±.6 :5n-.9 ±..9 ±. c. ±..9 ±. :6n-.8 ±. 6.5 ± ±.7 9. ±.7 Totl n- PUFA.7 ±.7. ±. 5. ±..9 ±. Totl PUFA D. ±.6 6. ±..9 ±.. ±. EPA + DHA 9. ± ±. c.7 ±.. ±. c EPA/DHA.6 ±.. ±. d.9 ±.. ±. c EPA + DPA + DHA. ± ±.5 c 7.9 ±.8 5. ±.5 Gills Lipid content.5 ± ±.7. ±..7 ±.5 Ftty cid composition 6: 9. ±. 5.6 ± ± ±. Totl sturted A 8. ±..6 ±.7. ±.6. ±.5 8:n-9. ±..8 ± ± ±.6 Totl monounsturted B 6. ±. 7. ±..9 ±.9.9 ±.8 8:n-6 7. ±. c. ±. 5. ±..8 ±. :n-6.9 ±.. ±. c.5 ±.. ±. :n-6. ±.. ±. c. ±.. ±. Totl n-6 PUFA C 9. ±. c 5. ±.5 9. ±. 8. ±.6 8:n-. ±. c. ±.6.6 ±. 5.6 ±. :5n- 7.5 ±..8 ±. c 7. ±..5 ±. :5n-.8 ±.. ±. c.7 ±.. ±. :6n-.6 ±. 6.9 ±.5 c 7. ±. c 8.8 ±. Totl n- PUFA. ±.. ±..7 ±..7 ±. Totl PUFA D 5.6 ±. c. ±.7.8 ±..7 ±.8 EPA + DHA 8. ±. 9.7 ±.6 d.5 ±.. ±. c EPA/DHA.7 ±.. ±. d.9 ±..5 ±. c EPA + DPA + DHA.8 ±.. ±.6 d 7. ± ±. c Dt re expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, DHA docoshexenoic cid (:6n-), DPA docospentenoic cid (:5n-), ECO feed contining high-epa oil from trnsgenic Cmelin, EPA eicospentenoic cid (:5n-), FO fish oil feed, WCO wild-type Cmelin oil feed A Includes 5:, : nd : B Includes 6:n-9 nd :n-9 C Includes :5n-6 D Includes C 6 PUFA

11 Tle 7 Totl lipid content (percentge of wet weight) nd ftty cid compositions (mol%) of totl lipid of nterior intestine nd rin of se rem Anterior intestine Lipid content 6.9 ±.8 5. ±..5 ±. 5. ±. Ftty cid composition 6: 9.7 ±.. ±.8.6 ±.5 5. ±.8 Totl sturted A. ±.. ±.9 c 5. ±. c 7. ±.5 8:n-9 5. ± ±..5 ±.5 8. ± 7. Totl monounsturted B.6 ±.5.9 ± ±.6.7 ±.8 8:n ±.8 5. ±.6 6. ± ±. :n-6. ±. c. ±.. ±..8 ±. :n-6. ±. c. ±. c. ±.. ±. :n-6.7 ±..8 ±.. ±..9 ±.7 :n-6. ±.. ±. c. ±.. ±. Totl n-6 PUFA C 8. ±. c 8. ±.5. ±.. ±. 8:n-.9 ±. c.9 ±.7 5. ± ±. :5n- 8. ±.5.6 ±. d 7. ±.. ±. c :5n-. ±.. ±. c.6 ±..7 ±. :6n-. ±. 7. ± ±..8 ±. Totl n- PUFA 5.7 ±. 6.6 ±. 5. ± ±.9 Totl PUFA D 6. ±.6 c 5. ± ±. 5. ±. EPA + DHA.6 ± ±.8 c.9 ±.6 5. ±. EPA/DHA.7 ±.. ±. c.9 ±.. ±. c EPA + DPA + DHA.9 ±.5.9 ±.8 c 7.5 ± ±. Brin Lipid content 9.6 ±. 9.6 ± ±. 8. ±. Ftty cid composition 6: 9. ±.6 9. ±. 8.9 ± ±. Totl sturted A. ±.9. ±.. ±..9 ±. 8:n-9. ±.5. ±.5. ±.6. ±.5 Totl monounsturted B. ±..8 ±.6.7 ±..6 ±.7 8:n-6. ±.8.8 ±.5. ±.6.5 ±.6 :n-6. ±.. ±.. ±.. ±. :n-6. ±. d. ±. c. ±.. ±. :n-6.7 ±..5 ±.. ±.. ±. :n-6. ±.. ±.. ±.. ±. Totl n-6 PUFA C. ±.8.8 ± ± ±.7 8:n-. ±..7 ±.5.9 ±.. ±. :5n-.6 ±..6 ±.. ±..7 ±. :5n-.6 ±.. ±..5 ±.. ±. :6n-. ±.9. ± ±.7. ±.8 Totl n- PUFA 7. ±.5 7. ±.5 7. ±. 7. ±. Totl PUFA D. ±.9.9 ±.8.9 ±.6.5 ±.6 EPA + DHA.6 ±.7.7 ±.8. ±.8.8 ±.7 EPA/DHA. ±.. ±.. ±.. ±. EPA + DPA + DHA 6. ±.6.9 ± ±.7 5. ±.6 Dt re expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, DHA docoshexenoic cid (:6n-), DPA docospentenoic cid (:5n-), ECO feed contining high-epa oil from trnsgenic Cmelin, EPA eicospentenoic cid (:5n-), FO fish oil feed, WCO wild-type Cmelin oil feed A Includes 5:, : nd : B Includes 6:n-9 nd :n-9 C Includes :5n-6 D Includes C 6 PUFA

12 .5..5 Liver Intestine Muscle Hed kidney Gills FO WCO ECO Brin DCO infiltrtion, minly represented y cidophilic grnulocytes nd some lymphocytes ws oserved, minly in fish fed ECO (dt not shown). Most of the cidophilic grnulocytes were locted in the lmin propri lthough few could e found in sumucos nd were present oth in mid nd hindgut. PC (9.%)..5. Liver nd Anterior Intestine Gene Expression LC PUFA Biosynthetic Genes PC (6.%) Fig. Non-metric multidimensionl scling (NMDS) plot sed on logrithmiclly trnsformed ftty cid composition of liver, muscle, gill, nterior intestine nd rin from gilthed se rem fed the four dietry tretments for weeks Tle 8 Men scores for the lipid vcuolistion nd peripncretic ft infiltrtion in liver of gilthed se rem fed the experimentl diets for weeks Cytoplsmic lipid. ±. c. ±.7. ±.7.8 ±. c vcuolistion Peripncretic ft.5 ±.. ±.5. ±.. ±.7 Dt re expressed s men ± SD (n = 6). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5). Scoring ws on scle from to s descried in detil in the Mterils nd Methods section with = not oserved, = few, = medium, nd = severe DCO feed contining EPA + DHA oil from trnsgenic Cmelin, ECO feed contining high-epa oil from trnsgenic Cmelin, FO fish oil feed, WCO wild-type Cmelin oil feed cytoplsmic vcuoles tht did not lter heptocyte shpe or size (Tle 8). Fish fed wild-type Cmelin oil (WCO) displyed higher degree of vcuolistion, lthough no structurl chnges, such s inflmmtion, necrosis or perivsculr cuffing were oserved. Fish fed the feeds contining the GM-derived oils showed intermedite levels of vcuolistion, with no differences etween FO nd DCO-fed fish or etween WCO nd ECO-fed fish (Tle 8). No significnt differences were oserved in the infiltrtion of peripncretic ft lthough fish fed FO showed the lowest scores nd DCO-fed fish the highest (p =.9; Tle 8). With intestinl tissue, good integrity of the sorptive memrne ws oserved in the sections from fish fed ll the dietry tretments. However, cellulr In liver, higher expression of ftty cyl desturse (fds) ws oserved in fish fed ll three diets contining VO (WCO, ECO nd DCO), with expression significntly greter in liver of WCO-fed fish compred to FO-fed fish (Fig. ). Similrly higher expression in liver of fish fed ll VO ws oserved in ftty cid elongse (elovl), significntly so in fish fed oth GM-derived oils compred to fish fed FO (Fig. ). There ws lso non-significnt trend for incresed expression of ftty cid elongse 5 (elovl5) in fish fed VO diets compred to fish fed FO (Fig. ). In contrst, nterior intestine showed different nutritionl regultion of these genes. Firstly, only elovl expression showed similr pttern of expression to tht oserved in liver with higher expression, leit not significnt, in fish fed the VO compred to fish fed FO (Fig. ). Secondly, fold chnges (FC) were less with the highest eing.7 FC for elovl for ECO-fed fish (Fig. ) compred to.6 FC in liver for this gene in fish fed ECO (Fig. ). Only fds showed significnt regultion y dietry oil source, eing down-regulted in intestine in VO-fed fish compred to fish fed FO, nd similr, non significnt, trend ws found in elovl5 in intestine (Fig. ). Lipid Metolism Genes As ove, the nutritionl regultion of this group of genes ws more mrked in liver (Fig. ) thn in nterior intestine (Fig. ). Lysophosphtidylcholine cyltrnsferse (lpct) ws up-regulted in VO-fed fish in oth tissues, lthough the highest expression ws found in liver of ECO-fed fish, wheres fish fed WCO showed the highest significnt FC in intestine. Ftty cid inding protein (FABP) gene expression ws lso regulted in liver, with highest expression in fish fed ECO, wheres no dietry regultion of this gene ws oserved in nterior intestine. Both lipoprotein lipse (lpl) nd heptic lipse (hl) genes showed the sme pttern in liver, with highest levels of expression in fish fed oth diets with GM-derived oils, with WCO showing intermedite levels etween those of ECO/DCO nd fish fed FO (Fig. ). In contrst, no regultion ws oserved in the nterior intestine for lpl, lthough its expression showed downwrd trend in

13 Fig. Expression, mesured y qpcr of LC-PUFA iosynthesis pthwy genes in se rem liver () nd nterior intestine () fter eleven weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to onewy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). fds, delt-6-ftty cyl desturse; elovl, ftty cid elongse ; elovl5, ftty cyl elongse A B fds fds elovl elovl elovl5 elovl A lpct 8 6 fp hl lpl B lpct fp lpl FO WCO DCO ECO Fig. Expression, mesured y qpcr of lipid metolism genes in se rem liver () nd nterior intestine () fter weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to one-wy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). lpct, lysophosphtidylcholine cyltrnsferse ; FABP, ftty cid inding protein ; hl, heptic lipse; lpl, lipoprotein lipse

14 A 6 5 B c cpt c cpt cpt cpt Fig. 5 Expression, mesured y qpcr of energy metolism genes in se rem liver () nd nterior intestine () fter weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to one-wy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). cpt, crnitine plmitoyltrnsferse, isoform ; cpt, crnitine plmitoyltrnsferse, isoform VO-fed fish, nd hl could not e detected in intestinl tissue (Fig. ). Ftty Acid Ctolism Genes Gene expression of two isoforms of crnitine plmitoyltrnsferse, cpt nd cpt, were evluted in liver nd nterior intestine of se rem (Fig. 5). In generl terms, expression of oth cpt in liver ws higher in fish fed the VO compred to fish fed FO. However, WCO-fed fish showed intermedite vlues of cpt expression, lower FC thn fish fed ECO, ut in the sme rnge s DCO-fed fish (Fig. 5). Fish fed ll three VO diets showed similr nd higher levels of expression of cpt in liver thn fish fed FO. No significnt differences in expression of either cpt or cpt were oserved in nterior intestine of se rem fed the dietry tretments (Fig. 5). Nucler Receptors Liver expression of the three evluted nucler receptors ws generlly higher in fish fed ll of the VO diets compred to fish fed FO, lthough differences were not significnt for peroxisome prolifertor-ctivted receptor α (PPARα) (Fig. 6). Expression in liver of PPARγ ws highest in ECO- nd DCO-fed fish with WCO-fed fish showing intermedite vlues, wheres fish fed ll the VO diets showed higher expression of sterol regultory element inding protein (srep) (Fig. 6). Although there were no significnt differences in the expression of these genes Fig. 6 Expression, mesured y qpcr of trnscription fctor genes in se rem liver () nd nterior intestine () fter weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to onewy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). PPARα, peroxisome prolifertor-ctivted receptor lph; PPARγ, peroxisome prolifertor-ctivted receptor gmm; srep, sterol regultory element-inding protein A B ppr ppr pprg pprg srep srep...

15 Fig. 7 Expression, mesured y qpcr of fish helth nd immune system genes in se rem liver () nd nterior intestine () fter weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to onewy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). csp, cspse ; pcn, proliferting cell nucler ntigen; il8, interleukin 8 A B csp csp pcn pcn il8 il8... mong the dietry tretments in nterior intestine, consistent pttern of lower expression in fish fed the VO diets ws oserved for ll three nucler receptors (Fig. 6). Fish Helth nd Immune System Genes Agin the three evluted genes ll showed higher expression in liver of fish fed the VO diets compred to fish fed FO (Fig. 7). In the cse of cspse (csp), ECO-fed fish showed the highest expression levels, lthough no differences were found with WCO nd DCO-fed fish which lso showed similr levels of expression to FO-fed fish (Fig. 7). No sttisticl differences were oserved for proliferting cell nucler ntigen (pcn) expression in liver, lthough DCO, nd prticulrly ECO-fed fish, tended to hve higher levels of expression. DCO-fed fish showed cler up-regultion in heptic interleukin 8 (il8) expression, with WCO nd ECO-fed fish displying intermedite levels (Fig. 7). In contrst, lthough il8 ws lso differentilly regulted y dietry oil source in intestine, the pttern ws opposite to tht oserved in liver, with VO-fed fish showing lower expression compred to FO-fed fish (Fig. 7). Trnsgenes All nlysed se rem tissues (muscle, liver nd nterior intestine) tested negtive for the presence of the Cmelin T-DNA gene construct s monitored y the use of npt-ii primers (dt not shown). Discussion The replcement of FO in qufeeds depends on finding lterntive, sustinle sources of EPA nd DHA, with this currently eing one of the min issues in quculture nutrition, prticulrly in mrine species tht hve limited ility for endogenous synthesis of LC-PUFA. Previous trils completely replcing FO y VO in feeds for gilthed se rem resulted in reduced growth proly relted to reduced intke of essentil LC-PUFA, which re not found in VO [ ]. In the present study we evluted the complete sustitution of FO y two different oils otined from GM-oilseed crops rich in either EPA (ECO) or contining oth EPA nd DHA (DCO) in feeds for se rem juveniles. Both oils proved to e effective sustitutes of FO, displying growth rtes tht were similr to those chieved y fish fed FO (in the cse of DCO) or WCO (for ECO). Similrly, recent studies employing oth oil itertions s sustitutes for FO in Atlntic slmon feeds showed tht fish fed these oils were s successful s those fed FO [, 5]. The lck of effect on growth in WCO-fed fish in the present tril is explined y the inclusion of reltively high levels of FM which ensured tht n- LC-PUFA requirements were fully stisfied (.9 % n- LC-PUFA in WCO-feed), estimted to e.9 % of dry feed []. It ws surprising tht the ECO-fed fish showed slightly reduced performnce, leit no different to WCO-fed fish, given tht n- LC-PUFA requirements, including DHA, were stisfied. One reson for this could e relted to the

16 lnce etween the different dietry LC-PUFA including the dietry EPA/DHA rtio, which differed mong the feeds. An EPA/DHA rtio of : ws reported to e optiml for se rem juveniles [5] nd in the present tril ECO feed presented rtio of pproximtely :, perhps suggesting n imlnce in these essentil ftty cids. However, in previous trils in Atlntic slmon, where the EPA/ DHA rtio ws even higher (round 9:), given the higher oil inclusion nd lower FM level, no dverse effect ws oserved on growth []. However, it should e noted tht the optiml dietry EPA/DHA rtio is likely to e speciesspecific. Another ftty cid tht differed etween ECO nd the other feeds ws ARA, with the ECO diet hving more thn doule the ARA content of the FO diet. Incresed dietry ARA levels hve een ssocited with enhnced stress resistnce, survivl nd improved growth in se rem juveniles nd lrve [6 ] s occurs in other mrine wrm wter species such s Europen se ss (Dicentrrchus lrx) []. However, ARA produces pro-inflmmtory effects due to production of prostglndin E (PGE ), leukotriene B (LTB ) nd lipoxins [], nd so diets rich in n-6 PUFA, primrily ARA, could led to overproduction of PGE lthough tht cn, in turn, hve n immunosuppressnt effect []. Although no mjor or ovious ltertion in fish helth ws shown y the histology nd qpcr results in the present study, incresed ARA levels or even imlnced proportions of n- nd n-6 PUFA my prtly explin the slightly lower growth of ECO-fed se rem. On the other hnd, the rtios of ARA, EPA nd DHA to ech other re lso known to e of importnce for mrine finfish nutrition. For instnce, diet with high EPA nd low ARA (9:) significntly reduced performnce of Atlntic slmon when compred to fish fed more lnced rtio of EPA nd ARA (.5:) [], similr to wht ws oserved in the present tril. Additionlly, multiple regression nlysis demonstrted meningful reltionships etween ARA nd DHA in Cliforni yellowtil (Seriol dorslis) with ARA nd DHA contriuting positively to weight gin wheres EPA contriuted negtively [5]. Thus, the lower growth oserved in ECO-fed se rem could e due to imlnced proportions etween these three essentil LC-PUFA. Despite the slightly reduced performnce of ECO-fed fish compred to FO nd DCO-fed fish, no mrked differences were oserved in lipid or individul ftty cid digestiility, which is consistent with previous studies in slmon using the sme oil []. However, ECO-fed fish consumed less feed (g/tnk) thn fish fed FO or WCO diets, which my suggest pltility issue with this oil. However, it must e noted tht oth oils were extrcted using the sme process nd stilized using the sme concentrtion of ntioxidnt (ethoxyquin). In ddition, exctly the sme tch of ECO ws used in the erlier tril in slmon where no differences in performnce were oserved etween tretments []. Moreover, the se rem feeds were formulted with higher FM levels thn the erlier slmon feeds, which would in turn e expected to increse pltility. Thus, it ppers tht the slightly reduced performnce of ECO-fed fish is more likely to e relted to species-specific sensitivity to high dietry ARA/n-6 levels tht ffected feed intke rther thn prolem with pltility. Complete sustitution of dietry FO y VO is lso ssocited with incresed deposition of C 8 ftty cids nd reduced proportions of LC-PUFA in fish tissues. The two- GM derived oils investigted in the present tril cn e considered s hyrid oils given tht they contin fetures of oth vegetle nd mrine oils, nd the tissue ftty cid profiles reflected this chrcteristic. Thus, in generl terms tissues of ECO nd DCO fed fish hd higher proportions of n- LC-PUFA thn fish fed WCO, which in the cse of flesh enhnced the nutritionl vlue of the product. Some limited iosynthetic ctivity ws oserved prticulrly in fish fed ECO with high EPA (nd ARA), where higher levels of DPA (:5n-) nd :n-6 were oserved in liver, muscle nd gills compred to fish fed either WCO or DCO. This likely reflected the higher heptic expression of elovl, n enzyme tht prticiptes in the elongtion of ARA nd EPA to :n-6 nd :5n-, respectively [6], oserved in ECO nd DCO-fed fish. However, the incresed expression of fds ws not sttisticlly significnt in ECO fed fish, which showed intermedite vlues etween FO nd WCOfed fish. However, incresed expression of fds hs een reported previously in se rem fed VO compred to fish fed FO [, ]. The involvement of elovl in only lter stges of the iosynthetic pthwy (predominntly elongtion of C ), prticulrly the synthesis of very long chin ftty cids (VLC-FA), explins why se rem tissue ftty cid compositions lrgely reflected dietry ftty cid compositions. This ws cler in the PCA (NMDS Plot) nlysis where ll tissues, except rin, grouped ccording to the feeds, with ECO nd DCO clustering in the sme group. This indicted tht the ftty cid composition of rin ws more conserved nd less ffected y diet thn the other tissues, consistent with other studies in the sme species [] nd other teleost species [7, 8]. Inclusion of high levels of VO nd reduction of FO in feeds hs een ssocited with incresed tissue lipid deposition in severl fish species [,,, 9 5]. In the present study incresed lipid deposition ws oserved only in liver, eing highest in WCO-fed fish with ECO nd DCO-fed fish showing intermedite vlues, with liver histology following the sme trend. Similr results were found in Atlntic slmon fed high ECO, reflecting the hyrid nture of the GM-derived oil [, ]. The mechnism for incresed lipid deposition in fish fed VO is not cler lthough high n- LC-PUFA levels found in FO cn suppress tricylglycerol (TAG) ccumultion in