Replacement of Marine Fish Oil with de novo Omega 3 Oils from Transgenic Camelina sativa in Feeds for Gilthead Sea Bream (Sparus aurata L.
|
|
- Horatio Berry
- 5 years ago
- Views:
Transcription
1 DOI.7/s ORIGINAL ARTICLE Replcement of Mrine Fish Oil with de novo Omeg Oils from Trnsgenic Cmelin stiv in Feeds for Gilthed Se Brem (Sprus urt L.) Mónic B. Betncor M. Sprgue D. Montero S. Usher O. Synov P. J. Cmpell J. A. Npier M. J. Cllero M. Izquierdo D. R. Tocher Received: July 6 / Accepted: 9 August 6 AOCS 6 Astrct Omeg- (n-) long-chin polyunsturted ftty cids (LC-PUFA) re essentil components of the diet of ll vertertes. The mjor dietry source of n- LC-PUFA for humns hs een fish nd sefood ut, prdoxiclly, frmed fish re lso relint on mrine fisheries for fish mel nd fish oil (FO), trditionlly mjor ingredients of qufeeds. Currently, the only sustinle lterntives to FO re vegetle oils, which re rich in C 8 PUFA, ut devoid of the eicospentenoic (EPA) nd docoshexenoic cids (DHA) undnt in FO. Two new n- LC-PUFA sources otined from geneticlly modified (GM) Cmelin stiv contining either EPA lone (ECO) or EPA nd DHA (DCO) were compred to FO nd wild-type cmelin oil (WCO) in juvenile se rem. Neither ECO nor DCO hd ny detrimentl effects on fish performnce, lthough finl weight of ECO-fed fish (7 g) ws slightly lower thn tht of FO- nd DCO-fed fish ( nd 7 g, respectively). Inclusion of the GM-derived oils enhnced the n- LC- PUFA content in fish tissues compred to WCO, lthough limited iosynthesis ws oserved indicting ccumultion of dietry ftty cids. The expression of genes involved in severl lipid metolic processes, s well s fish helth nd * Mónic B. Betncor m..etncor@stir.c.uk Fculty of Nturl Sciences, Institute of Aquculture, University of Stirling, Stirling FK9 LA, UK Grupo de Investigción en Acuicultur (GIA), Instituto Universitrio Ecoqu, Universidd de Ls Plms de Grn Cnri, Ctr. Tlirte s/n, 5 Telde, Ls Plms, Cnry Islnds, Spin Deprtment of Biologicl Chemistry nd Crop Protection, Rothmsted Reserch, Hrpenden AL5 JQ, UK Biomr Ltd., North Shore Rod, Grngemouth FK 8UL, UK immune response, in oth liver nd nterior intestine were ltered in fish fed the GM-derived oils. This showed similr pttern to tht oserved in WCO-fed fish reflecting the hyrid ftty cid profile of the new oils. Overll the dt indicted tht the GM-derived oils could e suitle lterntives to dietry FO in se rem. Keywords Se rem Geneticlly modified Cmelin Sustinle feeds Arevitions ACTB β Actin ADC Apprent digestiility coefficient ARA Archidonic cid CASP Cspse CPT Crnitine plmitoyltrnsferse CYTB Cytochrome DCO EPA + DHA Cmelin oil DHA Docoshexenoic cid DPA Docospentenoic cid ECO EPA-Cmelin oil ELFα Elongtion fctor α ELOVL Ftty cid elongse EPA Eicospentenoic cid FABP Ftty cid inding protein FADS Ftty cyl desturse FAME Ftty cid methyl esters FCR Feed conversion rtio FM Fish mel FO Fish oil GC Gs liquid chromtogrphy GM Geneticlly modified HL Heptic lipse HSI Heptosomtic index IL Interleukin
2 K Condition fctor LC-PUFA Long chin polyunsturted ftty cid(s) LPCAT Lysophosphtidylcholine cyltrnsferse LPL Lipoprotein lipse LTB Leukotriene B MUFA Monounsturted ftty cid(s) n- Omeg n-6 Omeg 6 n.d. Not determined NMDS Non-metric multidimensionl scling plot NPTII Knmycin resistnce gene NTC Non-templte control PCA Principl component nlysis PCNA Proliferting cell nucler ntigen PGE Prostglndin E PPARα Peroxisome prolifertor-ctivted receptor α PUFA Polyunsturted ftty cid(s) SAFA Sturted ftty cid(s) SGR Specific growth rte SREBP Sterol regultory element inding protein TAG Tricylglycerol(s) VLC-FA Very long chin ftty cid(s) VO Vegetle oil(s) VSI Viscerosomtic index WCO Wild-type Cmelin oil Introduction Fish is considered s the min source of the eneficil omeg- (n-) long-chin polyunsturted ftty cids (LC- PUFA) eicospentenoic nd docoshexenoic cids, EPA (:5n-) nd DHA (:6n-), respectively. These LC- PUFA ply importnt roles in neurl development, immune nd inflmmtory responses s well s hving eneficil effects in certin pthologies such s those ffecting the crdiovsculr nd neurologicl systems or some types of cncers [ 5]. According to estimtions of the Interntionl Society for the Study of Ftty cids nd Lipids (ISSFAL), dily intke of 5 mg of EPA nd DHA is recommended for optimum crdiovsculr helth [6]. In world where the glol popultion is expected to grow to rech 9.6 illion people y 5 [7], more thn.7 million metric tonnes of EPA + DHA would e necessry to cover nnul humn requirements. This quntity is not met y the ctul totl glol supply of n- LC-PUFA nd thus there is lrge gp etween supply nd demnd [8, 9]. Frmed fish nd sefood ccounted for. % of totl production (including for non-food uses) from cpture fisheries nd quculture in, up from. % in nd. % in [7]. Although fish frming contriutes to the glol n- LC-PUFA production in order to meet humn dietry requirements, the mrine ingredients, fish mel nd oil (FM nd FO, respectively) re still, lmost exclusively, the only rw mterils in qufeeds tht, in turn, cn supply n- LC-PUFA to frmed fish. The use of high levels of FM nd FO to mintin n- LC-PUFA levels in frmed fish is not sustinle prctice s they re finite (on n nnul sis) nd limited resources [9]. Sustinle lterntives to FO used t present re vegetle oils (VO), which re rich in C 8 ut lck n- LC-PUFA, which in turn reduces the proportions of EPA nd DHA in frmed fish, nd does not significntly increse glol production of n- LC-PUFA [9]. Otining lterntive sources of n- LC-PUFA from other mrine orgnisms such s microlge or zooplnkton (krill or copepods) poses significnt technologicl nd economic chllenges nd there re no currently fesile lterntives for mss supply [9]. Therefore, it is cler tht completely new, de novo sources of EPA nd DHA re required. In this respect, metolic engineering of oilseed crops such s Cmelin stiv or flse flxseed provides currently vile option to deliver n- LC-PUFA in the plce of fish oil [ ]. By the insertion of cssettes contining five or seven ftty cyl desturse nd elongse genes from severl lge species, geneticlly modified (GM) Cmelin is cple of producing EPA or oth EPA nd DHA in their seeds []. Recent studies hve successfully demonstrted the fesiility of using oth the high-epa nd EPA + DHA oils s sustitutes for FO in feeds for post-smolt Atlntic slmon (Slmo slr) without compromising fish growth or helth [ 5]. Totl replcement of FO in slmonids hs een shown to e fesile without compromising fish performnce, lthough reduction in tissue n- LC-PUFA ws oserved due to reduced dietry intke nd limited iosynthesis [6 8]. In contrst, totl sustitution of FO y VO in gilthed se rem (Sprus urt) feeds significntly reduced fish performnce [9] nd gretly ltered ftty cid profile of rem tissues [] given their incomplete LC-PUFA iosynthesis pthwy [, ]. In this context, the im of the present study ws to evlute the new GM Cmelinderived oils tht contin fetures of oth mrine fish (n- LC-PUFA) nd terrestril plnt (high levels of C 8 ftty cids) oils s sustitutes for FO in feeds for mrine teleost species tht hve very limited LC-PUFA iosynthesis cpcity from C 8 PUFA []. The specific ojectives were to evlute the efficcy of the high-epa nd EPA + DHA oils s replcements for dietry FO in feeds for gilthed se rem juveniles in terms of growth, feed efficiency, helth nd welfre, nd nutritionl qulity of the fish focussing prticulrly on tissue levels of EPA nd DHA. Additionlly, ssessment of the expression of genes of lipid metolism s well s moleculr mrkers of helth nd immune function ws lso performed.
3 Mterils nd Methods Diets nd Feeding Tril Four isonitrogenous nd isoenergetic diets were formulted to contin 5 g/kg crude protein nd g/kg crude lipid, nd mnufctured t BioMr Tech-Centre (Brnde, Denmrk). The four feeds were produced y vcuum coting identicl dry sl extruded pellets with either fish oil (FO), wild-type Cmelin oil (WCO), EPA-Cmelin oil (ECO) or EPA + DHA-Cmelin oil (DCO) nd were nmed ccording to the oils used (Tle ). ECO nd DCO oils were produced s previously descried [,, 5]. In line with commercil prctice, non-deftted fishmel ws employed s the mjor protein source to ensure EFA requirements were met [], nd yttrium oxide ws dded (.5 g/kg) s n inert mrker for clcultion of lipid nd ftty cid digestiility. A totl of juvenile gilthed se rem with n verge ody weight of 55.5 ±. g (men ± SD) were distriuted into sewter tnks (5 per tnk) nd fed one of the four experimentl feeds in triplicte for weeks. The experimentl system comprised 5 L tnks supplied y flow-through sewter (9 L/min) t mient temperture tht verged. ±.6 C. Experimentl feeds were delivered until pprent stition y hnd-feeding three times dy with uneten feed collected min lter in order to determine ccurte feed efficiency. Collected feed ws plced in n oven ( C) until constnt weight ws chieved in order to clculte feed intke sed on initil moisture content. All procedures were conducted in ccordnce with the regultions set forwrd y the Spnish RD 5/ (BOE 8th Ferury ) nd the Directive /6/EU of the Europen Prliment nd of the Council of Septemer on the protection of nimls used for scientific purposes. The experiment ws sujected to ethicl review y the Animl Welfre nd Bioethicl Committee t the University of Ls Plms de Grn Cnri (Ref 7/ CEBA ULPGC). Smple Collection nd Digestiility After weeks of feeding, fish were not fed for 8 h prior to eing smpled. All fish were nesthetised with clove oil nd weighed nd their length mesured. Ten fish for iometric mesurements (hepto-somtic nd viscero-somtic indices) nd tissue nlyses were killed y overdose with clove oil. Smples of nterior intestine, liver, gills, flesh nd rin from fish per tnk were immeditely frozen Tle Formultions, proximte nd ftty cid compositions (% of ftty cids) of the experimentl feeds n.d. not detected, WCO wild-type Cmelin oil feed Ftty cid compositions of the oils were provided previously [, 5] Includes 5:, : nd : c Includes 6:n-9, :n-, :n-7, :n-9 nd :n-9 d Includes :n-6 nd :5n-6 Feed ingredients (%) Fish mel, NA LT Fish mel, SA 68 Superprime.... Soy protein concentrte (6 %) Mize gluten Whet Fish oil.5 Wild-type Cmelin oil.5 EPA-Cmelin oil.5 EPA + DHA-Cmelin oil.5 Vitmins/minerls Yttrium oxide Anlysed composition Dry mtter (%) Crude protein (%) Crude lipid (%) Ash Ftty cid composition (mol%) Ʃ sturted Ʃ monounsturted c :n :n :n-6. n.d.7.8 :n :n-6.7 n.d. n.d. n.d. Ʃ n-6 PUFA d :n :n :n :5n :5n :6n Ʃ n- PUFA Ʃ PUFA e Totl n- LC-PUFA e Includes C 6 PUFA. DCO, feed contining EPA + DHA oil from trnsgenic Cmelin; ECO, feed contining high-epa oil from trnsgenic Cmelin; FO, fish oil feed; LC- PUFA, long-chin polyunsturted ftty cids (sum of :n-, :5n- :5n- nd :6n-)
4 nd stored t 7 C prior to totl lipid extrction nd ftty cid nlyses. Further smples of liver nd nterior intestine were collected from six fish per tretment (two per tnk) nd stilised in RNAlter (Sigm, Poole, UK) prior to RNA extrction. All remining fish were fed for further week prior to feces eing collected ccording to the method descried y []. Briefly, fish were killed y overdose with clove oil 7 h fter eing fed nd fecl smples collected fter dissecting the rectum of the fish. Fecl smples were pooled y tnk nd stored C prior to lipid nd ftty cid nlysis. The pprent digestiility coefficient (ADC) of lipid nd selected ftty cids ws clculted s: [ (Y O concentrtion in feed/ Y O concentrtion in feces) (lipid or ftty cid concentrtion in feces/lipid or ftty cid concentrtion in feed)]. The concentrtion of individul ftty cids in diets nd feces were clculted sed on the reltive proportion of ech ftty cid compred with known mount of the internl stndrd (7:) dded nd the totl lipid content determined in the smples. Yttrium ws estimted fter cid digestion of the smples vi Inductively Coupled Plsm Mss Spectrometry (Thermo Scientific, XSeries ICP-MS, USA) using rgon nd hydrogen s crrier gs. Proximte Composition Diets nd whole fish were ground efore determintion of proximte composition ccording to stndrd procedures [5]. Fish were pooled per tnk (n = ) nd freeze-dried until further nlysis wheres three technicl replictes of feeds (single tch production) were nlysed. Moisture contents were otined fter drying in n oven t C for h nd sh content determined fter incinertion t 6 C for 6 h. Crude protein ws mesured y determining nitrogen content (N 6.5) using utomted Kjeldhl nlysis (Tector Kjeltec Auto nlyser, Foss, Wrrington, UK) nd crude lipid content determined grvimetriclly fter Soxhlet lipid extrction (Tector Soxtec system 5 Auto Extrction pprtus). Feces nd Tissue Lipid Content nd Ftty Acid Composition Smples of feces, muscle (flesh), liver, gills, nterior intestine nd rin from three fish per tnk were prepred s pooled homogentes (n = per tretment) nd totl lipid extrcted y homogenising in chloroform/methnol (:, v/v) using n Ultr-Turrx tissue disrupter (Fisher Scientific, Loughorough, UK), with content determined grvimetriclly [6]. Ftty cid methyl esters (FAME) were prepred from totl lipid y cid-ctlysed trnsesterifiction t 5 C for 6 h [7], nd FAME extrcted nd purified s descried previously [8]. FAME were seprted nd quntified y gs-liquid chromtogrphy using Fisons GC-86 (Thermo Scientific, Miln, Itly) equipped with m. mm i.d..5 μm ZB-wx column (Phenomenex, Cheshire, UK), on-column injector nd flme ionistion detector. Dt were collected nd processed using Chromcrd for Windows (version.; Thermoquest Itli S.p.A., Miln, Itly). Individul FAME were identified y comprison to known stndrds nd pulished dt [8] nd results expressed s mole percentge. Histologicl Anlysis Smples of liver nd intestine from fish per tnk (n = 6 per tretment) were fixed in % uffered formlin dehydrted through grded lcohol, then xylene, nd finlly emedded in prffin wx. The prffin locks were sectioned t μm nd stined with hemtoxylin nd eosin [9] efore lind exmintion under light microscope. Stined sections of liver were ssessed for cytoplsmic lipid vcuoliztion nd peripncretic ft infiltrtion using four grded exmintion scheme:, not oserved;, few;, medium;, severe. Posterior intestine sections were exmined for integrity of the intestinl mucos nd the presence of ny inflmmtory response. RNA Extrction Liver nd nterior intestine from six individul fish per dietry tretment were homogenised in ml of TriRegent (Sigm-Aldrich, Dorset, UK) RNA extrction uffer using ed tissue disruptor (Bio Spec, Brtlesville, Oklhom, USA). Totl RNA ws isolted following the mnufcturer s instructions nd quntity nd qulity determined y spectrophotometry using Nnodrop ND- (Ltech Int., Est Sussex, UK) nd electrophoresis using 5 ng of totl RNA in % grose gel. cdna ws synthesised using μg of totl RNA nd rndom primers in μl rections nd the High cpcity reverse trnscription kit without RNse inhiiter ccording to the mnufcturer s protocol (Applied Biosystems, Wrrington, UK). The resulting cdna ws diluted -fold with milliq wter. Expression of genes of interest ws determined y quntittive PCR (qpcr) from fish fed ll diets (Tle ). Results were normlised using reference genes, elongtion fctor α (elfα) nd et-ctin (ct), s their expression did not vry mong tretments. The efficiency of the primers for ech gene ws previously evluted y seril dilutions to ensure tht it ws close to %. qpcr ws performed using Biometr TOpticl Thermocycler (Anlytik Jen, Goettingen, Germny) in 96-well pltes in duplicte -μl rection volumes contining μl of Luminris Color HiGreen qpcr Mster Mix (Thermo Scientific, Hemel Hempsted,
5 Tle Detils of primer used for qpcr or PCR nlysis Aim Trnscript Primer sequence (5 ) Amplicon (p) T ( C) Accession no. qpcr fds F: GCAGGCGGAGAGCGACGGTCTGTTCC 7 6 AY5579 R: AGCAGGATGTGACCCAGGTGGAGGCAGAAG elovl F: CGGTGGCAATCATCTTCC 79 6 JX9757 R: TCAACTGGCTGTCTGTGT elovl5 F: CCTCCTGGTGCTCTACAAT 6 AY66879 R: GTGAGTGTCCTGGCAGTA lpct F: CGTGATAGCCTTATCTGTCGTATGC 9 6 JQ96 R: CCGTCCTCCTCTGCCTCAA FABP F: CGAGCACATTCCGCACCAAAG 9 6 AM9576 R: CCCACGCACCCGAGACTTC hl F: TTGTAGAAGGTGAGGAAAACTG 6 EU579 R: GCTCTCCATCAGACCATCC lpl F: CGTTGCCAAGTTTGTGACCTG 9 6 AY9567 R: AGGGTGTTCTGGTTGTCTGC cpt F: GTGCCTTCGTTCGTTCCATGATC 8 6 JQ88 R: TGATGCTTATCTGCTGCCTGTTTG cpt F: CCACCAGCCAGACTCCACAG 78 6 DQ8668 R: CACCACCAGCACCCACATATTTAG srep F: AGGGCTGACCACAACGTCTCCTCTCC 77 6 JQ7779 R: GCTGTACGTGGGATGTGATGGTTTGGG PPARα F: TCTCTTCAGCCCACCATCCC 6 6 AY5999 R: ATCCCAGCGTGTCGTCTCC PPARγ F: CGCCGTGGACCTGTCAGAGC 6 AY59 R: GGAATGGATGGAGGAGGAGGAGATGG csp F: CCAGTCAGTCGAGCAGATGA 6 EU7 R: GAACACACCCTCGTCTCCAT pcn F: GATGTGGAGCAGCTGGGTAT 5 6 FG6675 R: TGTCTACGTTGCTGGTCTGG il8 F: CAGCAGAGTCTTCATCGTCACTATTG 66 6 JX97669 R: AGGCTCGCTTCACTGATGG ct F: TCCTGCGGAATCCATGAGA 5 6 X899 R: GACGTCGCACTTCATGATGCT ef F: ACGTGTCCGTCAAGGAAATC 9 6 AF87 R: GGGTGGTTCAGGATGATGAC PCR nptii F: CTCACCTTGCTCCTGCCGAGA 5 6 KJ879. R: CGCCTTGAGCCTGGCGAACAG cyt F: CCGCTTCTTTGCCTTCCATT 9 57 NC_6. R: AGATTAGGGGCGAATAGGGC fds ftty cid desturse, elovl ftty cid elongse, elovl5 ftty cid elongse 5, lpct lysophosphtidylcholine cyltrnsferse, FABP ftty cid inding protein, hl heptic lipse, lpl lipoprotein lipse, cpt crnitine plmitoyltrnsferse A liver isoform, cpt Crnitine plmitoyltrnsferse muscle isoform, srep sterol regultory element inding protein, PPARα peroxisome prolifertor-ctivted receptor α, PPARγ peroxisome prolifertor-ctivted receptor γ, csp cspse, pcn proliferting cell nucler ntigen, il8 interleukin 8, ct β-ctin, efα elongtion fctor, nptii neomycin phosphotrnsferse II, cyt cytochrome UK), μl of the primer corresponding to the nlysed gene ( pmol), μl of moleculr iology grde wter nd 5 μl of cdna, with the exception of the reference genes, which were determined using μl of cdna. In ddition mplifictions were crried out with systemtic negtive control (NTC-non templte control) contining no cdna. Stndrd mplifiction prmeters contined UDG pre-tretment t 5 C for min, n initil denturtion step t 95 C for min, followed y 5 cycles: 5 s t 95 C, s t 6 C nd s t 7 C.
6 Trcking of the nptii Gene in Gilthed Se Brem Liver, Intestine nd Muscle Genomic DNA ws extrcted from fish flesh, pyloric cec nd liver using REALPURE extrction kit (Vlenci, Spin) ccording to the mnufcturer s instructions. Briefly, tissue smples were incuted in μl of lysis solution overnight t 55 C with μl of Proteinse K. Following the incution, smples were cooled down nd RNse tretment performed (7 C for 6 min). After protein precipittion, DNA ws precipitted y dding 6 μl of isopropnol nd hydrted with 5 mm Tris. Totl DNA ws quntified y spectrophotometry nd qulity determined y electrophoresis s descried ove. Two primers pirs trgeting n endogenous se rem gene (cytochrome ; cyt) nd trnsgene mrker for ECO plnts (Knmycin resistnce gene, nptii) were used (Tle ). Fifty ng of extrcted DNA ws used in PCR mplifictions tht were performed in finl volume of μl, contining 5 μl of MyTq HS Mix (Bioline, London, UK). Ech set of PCR included positive control (DNA from geneticlly modified-cmelin) nd non-templte control (NTC). Sttisticl Anlysis All dt re men ± SE (n = ) unless otherwise specified. Percentge dt were sujected to rcs in squre-root trnsformtion prior to sttisticl nlyses. Dt were tested for normlity nd homogeneity of vrinces with Levene s test prior to one-wy nlysis of vrince followed y Tukey Krmer HSD multiple comprisons of mens. A non-metric multidimensionl scling plot (NMDS) ws performed in order to seprte the ftty cid profile of the five evluted tissues. Stress vlues <.5 indicted n excellent representtion of the clusters nd <. nd <. indicted good nd potentilly useful plots respectively. All sttisticl nlyses were performed using SPSS softwre (IBM SPSS Sttistics 9; SPSS Inc., Chicgo, IL, USA), excepting the NMDS nlysis (PAST) []. Results Fish Performnce Se rem fed ll the experimentl diets more thn douled in weight fter weeks feeding, nd no mortlities were recorded (Tle ). Fish fed ECO displyed the lowest finl weight nd totl length mong the dietry tretments, lthough not different to fish fed WCO, with highest growth chieved in fish fed the FO nd DCO feeds (Tle ). Finl weights reflected feed intke, which ws highest in fish fed FO nd DCO, lowest in fish fed ECO nd intermedite in fish fed WCO. There were no significnt differences in weight gin or specific growth rte (SGR) other thn it eing slightly lower in fish fed ECO compred to fish fed FO (Tle ). There were no differences in the heptosomtic or Tle Growth performnce, survivl, feed utiliztion nd sic nd whole ody proximte composition (% dry weight) of gilthed se rem fter weeks of feeding the experimentl diets Dt re expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, ECO feed contining high-epa oil from trnsgenic Cmelin, FI feed intke, FO fish oil feed, HSI heptosomtic index, k condition fctor, SGR specific growth rte, VSI viscerosomtic index, WCO wild-type Cmelin oil feed Initil weight (g) 55. ± ± ± ± 6. Finl weight (g) 9.9 ±.8. ± ± ±. Finl length (cm) 8. ±.5 8. ± ±.6 8. ±.9 Weight gin (g) 7.5 ±. 7.5 ± ±.6 7. ±. HSI. ±..6 ±.. ±..5 ±. VSI 8. ±. 8. ±. 7.8 ± ±. FI (g/tnk) 8. ± ± ± ± 7.9 FCR. ±.. ±.. ±.. ±. SGR. ±.. ±..9 ±.. ±. k. ±.. ±.. ±.. ±. Whole ody composition (% dry wt.) Crude protein 7.5 ±.7 8. ± ±. 9. ±.5 Crude lipid 5.7 ±. 8. ± ±. 7. ±. Ash 9.8 ± ± ± ±.
7 viscerosomtic index (HSI nd VSI, respectively), lthough vlues tended to e lowest in fish fed DCO nd ECO (p =.576 nd.869 respectively). No differences were oserved in other fish performnce prmeters including feed conversion rtio (FCR) or k condition fctor (Tle ). Lipid nd Ftty Acid Digestiility The pprent digestiility coefficients (ADC) were clculted for lipids nd ftty cids using yttrium oxide s n inert mrker. There were no significnt differences in crude lipid ADC mong the dietry tretments (Tle ). Figure represents the nlysed ftty cid composition of feeds nd feces in order to compre which ftty cid groups were preferentilly digested nd sored (i.e. those found in lower mounts in feces). There ws trend for higher proportions of sturted ftty cids (SAFA) in feces reltive to the feeds, with the ADC for SAFA vrying etween round 8 nd 87 %, generlly slightly lower thn the ADCs for the other ftty cids (Tle ). In contrst, proportions of PUFA in the feces were generlly lower compred to proportions in feeds with ADCs rnging from 9 to lmost 97 %, wheres proportions of monounsturted ftty cid (MUFA) were similr in diet nd feces with ADC rnging from round 8 to 9 % (Fig. ). Some vritions were found etween feeds, with ADC of SAFA eing highest in fish fed FO nd lowest in fish fed ECO, with ADC of MUFA eing higher in fish fed ECO nd DCO compred to fish fed FO (Tle ). Similrly, ADC of 8:n-6 nd n-6 PUFA were higher in fish fed DCO compred to fish fed FO. Digestiility ws highest with n- PUFA generlly lthough ADC for EPA ws lowest in WCO, lthough not different to tht of ECO. Regrding DHA, FO nd DCO showed the highest ADC, eing over 96 % (Tle ). Whole Fish Composition No differences were found in ny of the nlysed components mong fish fed the four dietry tretments (Tle ). However, there were trends for higher lipid content in fish fed the vegetle-sed feeds (p =.86), nd incresed protein in fish fed the ECO nd DCO feeds contining oil from trnsgenic Cmelin (p =.). Tissue Lipid Content The lipid content of flesh (muscle) vried etween round nd.5 % ut diet hd no significnt effect (Tle 5). In contrst, the lipid content of liver ws higher in fish fed WCO thn in fish fed FO with fish fed the oils derived from trnsgenic Cmelin showing intermedite vlues (Tle 6). Diet hd no significnt effect on the lipid content of other tissues including gill (Tle 6), nterior intestine nd rin (Tle 7). Tle Apprent digestiility coefficient (ADC) of lipid nd ftty cids in gilthed se rem fed the four experimentl diets differing in oil source Dt expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets. Sttisticl differences were determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, ECO feed contining oil from trnsgenic Cmelin, FO fish oil feed, WCO wild-type Cmelin oil feed A Includes : nd : B Includes 6:n-9 nd :n-9 C Includes :n-6 nd :5n-6 D Includes C 6 PUFA Tissue Ftty Acid Compositions Muscle (Flesh) Lipid ADC 8.8 ±. 8. ± ± ± 5. : 88.8 ±. 8. ±. 8. ± ± 6. 5: 99. ± ± ±. 98. ±.6 6: 8. ± ± ± ± 5.5 8: 78.9 ± ± ± ±. Totl 87. ± ±. 8. ±. c 8. ±.5 sturted A 6:n ±.8 8. ± ±. 9.8 ±. 8:n ± ± ± ± 8.6 8:n ± ± ± ± 6. :n ± ± ± ±. :n ± ± ± ±. :n- 9. ± ± ±.5 9. ±. :n ± ± ± ±.6 Totl 8. ± ± ± ±. monoenes B 8:n ± ±. 95. ± ±.6 :n ± ±. 9. ± ±. :n ±. 9.9 ±. 96. ± ±.5 Totl n-6 9. ±. 9. ± ±. 96. ±.5 PUFA C 8:n- 9.7 ±. 95. ± ±. 97. ±. 8:n ±. 9.9 ± ±. 98. ±. :n- 96. ±. 9.8 ±.5 9. ±. 95. ±.5 :n- 95. ±. 8. ± ± ±. :5n- 98. ± ± ±. 98. ±. :5n- 9. ±.5 8. ± ±. 9. ± 5. :6n ±. 9.6 ±. 9.6 ± ±. Totl n- 97. ±. 95. ± ±. 97. ±. PUFA Totl PUFA D 96. ±.7 9. ± ± ±. No differences were oserved in the proportions of totl n- PUFA in muscle (p =.58), lthough cler differences
8 9 8 7 SAFA MUFA PUFA FO nd DCO nd higher thn in fish fed WCO, with fish fed ECO showing intermedite vlues. Agin, the totls of EPA + DHA nd EPA + DPA + DHA in fish fed ll feeds were in the rnk order FO > ECO > DCO > WCO. Proportions of totl n-6 PUFA were higher in liver of fish-fed ECO nd DCO reflecting the higher dietry n-6 contents, prticulrly 8:n-6 nd rchidonic cid (ARA, :n-6). 6 Gills % 5 Diet Feces Diet Feces Diet Feces Diet Feces In generl terms, gill ftty cid compositions mirrored dietry input, lthough some smll differences were found (Tle 6). Proportions of EPA vried in the rnk order FO = ECO > DCO > WCO, DHA in the rnk order FO > DCO > ECO = WCO, nd EPA + DHA nd EPA + DPA + DHA in the rnk order FO > ECO > DCO > WCO. 8:n-6 ws higher in gills of fish fed the VO diets compred to fish fed FO while ARA vried in the rnk order ECO > DCO = FO > WCO (Tle 6). Fig. Ftty cid compositions (mol%) of the four experimentl feeds nd feces showing preferentil order of sorption with differing degree of unsturtion of dietry ftty cids were found in individul ftty cids (Tle 5). The mole percentges of EPA were highest in fish fed FO nd ECO, lowest in fish fed WCO nd intermedite in fish fed DCO. Proportions of DHA were similr in fish fed FO nd DCO nd higher thn in fish fed WCO, with fish fed ECO showing intermedite vlues. Fish fed the FO nd ECO diets displyed similr proportions of n- docospentenoic cid (DPA, :5n-) in flesh, which were significntly higher thn those found in fish fed WCO or DCO. The totls of EPA + DHA nd EPA + DPA + DHA in fish fed ll feeds vried in the rnk order FO > ECO > DCO > WCO. The proportions of 8:n-6 nd totl n-6 PUFA were higher in flesh of se rem fed ll the diets contining VO (WCO, ECO nd DCO) compred to fish fed FO (Tle 5). No differences were oserved in totl SAFA nd totl MUFA were higher in fish fed FO nd WCO compred to fish fed the oils from trnsgenic Cmelin. Liver The ftty cid profile of liver ws similr to tht of muscle nd minly reflected dietry compositions. No differences were found in totl n- PUFA mong the four dietry tretments s low levels of n- LC-PUFA were ssocited with high levels of short chin precursors (Tle 6). The percentges of EPA were similr nd highest in fish fed FO nd ECO, lowest in fish fed WCO nd intermedite in fish fed DCO. Proportions of DHA were similr in fish fed Anterior Intestine Proportions of EPA, DHA nd totl EPA + DPA + DHA vried in nterior intestine with essentilly the sme pttern s descried for gills (Tle 7). However, totl n-6 PUFA contents were higher in nterior intestine thn in the other tissues nlysed, prticulrly in fish fed the diets contining oil from trnsgenic Cmelin due to higher levels of 8:n-6 nd ARA. Brin The ftty cid composition of rin ws lest influenced y diet, with fewer individul ftty cids showing significnt differences nd the mgnitude of differences eing lower (Tle 7). Specificlly nd importntly, DHA, EPA + DHA, EPA + DPA + DHA nd EPA/DHA rtio did not vry etween fish fed the different diets, nd neither did 8:n-6 or the totls of n- PUFA, PUFA, SAFA nd MUFA. The non-metric multidimensionl scling (NMDS) plot clerly showed tht tissue ftty cid compositions were ffected y the dietry input rther thn y tissue type with the exception of rin, which clustered in different group (Fig., stress.7). This ws confirmed y the glol R vlue nd low p otined (R =.8; p <.) when compring the feeds. Pir-wise R indicted tht the segregtion ws strongest etween fish fed FO nd WCO (R =.7; p =.5), wheres the wekest seprtion ws oserved etween fish fed the ECO nd DCO diets (R =.; p =.). The tissue ftty cid profiles of fish fed the two trnsgenic-derived oils did not show high seprtion with WCO (R =. nd., nd p =. nd. for
9 Tle 5 Totl lipid content (percentge of wet weight) nd totl lipid ftty cid composition (mol%) of muscle (flesh) of se rem fter feeding the experimentl diets for weeks Lipid content (%).5 ±.6.6 ±.6.9 ±.6.5 ±.5 Ftty cid composition :.6 ±.. ±.. ±.. ±. 6: 9.6 ±. 7. ± ±. 6.6 ±. 8:. ±.. ±..6 ±..8 ±. :. ±.. ±..7 ±..6 ±. Totl sturted A 9. ±. 5. ±.9.7 ±..7 ±. 6:n ±.. ±.. ±.. ±. 8:n ±.6. ±.7 7. ± ±. 8:n-7. ±..5 ±.7.5 ±.. ±. :n-. ±.. ±.. ±.. ±. :n-9. ±.. ±.. ±.. ±. :n-7. ±.. ±.. ±.. ±. :n-. ±.. ±..9 ±..9 ±. :n-9. ±.. ±.5.7 ±..7 ±. Totl monounsturted.9 ±.5 5. ±. 9. ±.. ±.7 B 8:n ±.. ±..6 ±..6 ±. 8:n-6. ±. c. ±. c.6 ±..8 ±. :n-6. ±..8 ±.. ±..6 ±. :n-6. ±.. ±..9 ±.. ±. :n-6.9 ±. c.6 ±. c.7 ±.. ±. :n-6. ±. c. ±. c. ±.. ±. Totl n-6 PUFA C 8.5 ±.. ±. 9. ±. 8.7 ±. 8:n-. ±. d. ±..6 ±. c 5.8 ±. 8:n-. ±..6 ±. d.7 ±. c.7 ±. :n-. ±..6 ±.5.5 ±.. ±. :n-.7 ±..6 ±.. ±..5 ±. :5n- 8. ±..5 ±. c 7.8 ±. 5.7 ±. :5n-.9 ±.. ±. c.9 ±.. ±. :6n-.8 ±. 7. ±.9 c 8. ±.9 c 9.7 ±.6 Totl n- PUFA 5. ±. 5.6 ±. 6. ±. 6. ±.5 Totl PUFA D 5.8 ±.6 c 9.8 ±. c 6. ±. 5. ±.5 EPA + DHA 8.8 ±.. ±. 6. ±.. ±.5 EPA/DHA.7 ±..6 ±..9 ±..5 ±. EPA + DPA + DHA.7 ±.. ±. 9. ±. 6.6 ±.6 Dt re expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, DHA docoshexenoic cid (:6n-); DPA, docospentenoic cid (:5n-), ECO feed contining high-epa oil from trnsgenic Cmelin, EPA eicospentenoic cid (:5n-), FO fish oil feed, WCO wild-type Cmelin oil feed A Includes 5:, : nd : B Includes 6:n-9 nd :n-9 C Includes :5n-6 D Includes C 6 PUFA ECO nd DCO, respectively). Tissue-wise, wek segregtion ws oserved (glol R =.6; p =.8), lthough rin displyed strong seprtion from other tissues (i.e. R = for muscle nd.958 for gill). Tissue Histology Fish fed the FO diet showed regulr heptocyte morphology with lrge centrlly locted nuclei with few
10 Tle 6 Totl lipid content (percentge of wet weight) nd ftty cid compositions (mol%) of totl lipid of liver nd gills of se rem Liver Lipid content 7.6 ±.6. ± ±. 8.6 ±.6 Ftty cid composition 6:.8 ±. 8. ±. 6.7 ±.9 8. ±. Totl sturted A.7 ± ± ± ±.8 8:n-9. ±..6 ± ±. 8.6 ±.8 Totl monounsturted B 5. ±.7 7. ±. 9. ±.9. ±. 8:n-6.6 ±.7 c.9 ±.7.6 ±.6. ±.7 :n-6. ±..6 ±. c. ±..7 ±. :n-6. ±. c. ±. c. ±.. ±. Totl n-6 PUFA C 7. ±.6 c.8 ±.9 9. ±. 7.9 ±.9 8:n-.8 ±. c 9.8 ±.5. ±. 5. ±.5 :5n- 7. ±.. ±.6 c 6.9 ±.7.9 ±.6 :5n-.9 ±..9 ±. c. ±..9 ±. :6n-.8 ±. 6.5 ± ±.7 9. ±.7 Totl n- PUFA.7 ±.7. ±. 5. ±..9 ±. Totl PUFA D. ±.6 6. ±..9 ±.. ±. EPA + DHA 9. ± ±. c.7 ±.. ±. c EPA/DHA.6 ±.. ±. d.9 ±.. ±. c EPA + DPA + DHA. ± ±.5 c 7.9 ±.8 5. ±.5 Gills Lipid content.5 ± ±.7. ±..7 ±.5 Ftty cid composition 6: 9. ±. 5.6 ± ± ±. Totl sturted A 8. ±..6 ±.7. ±.6. ±.5 8:n-9. ±..8 ± ± ±.6 Totl monounsturted B 6. ±. 7. ±..9 ±.9.9 ±.8 8:n-6 7. ±. c. ±. 5. ±..8 ±. :n-6.9 ±.. ±. c.5 ±.. ±. :n-6. ±.. ±. c. ±.. ±. Totl n-6 PUFA C 9. ±. c 5. ±.5 9. ±. 8. ±.6 8:n-. ±. c. ±.6.6 ±. 5.6 ±. :5n- 7.5 ±..8 ±. c 7. ±..5 ±. :5n-.8 ±.. ±. c.7 ±.. ±. :6n-.6 ±. 6.9 ±.5 c 7. ±. c 8.8 ±. Totl n- PUFA. ±.. ±..7 ±..7 ±. Totl PUFA D 5.6 ±. c. ±.7.8 ±..7 ±.8 EPA + DHA 8. ±. 9.7 ±.6 d.5 ±.. ±. c EPA/DHA.7 ±.. ±. d.9 ±..5 ±. c EPA + DPA + DHA.8 ±.. ±.6 d 7. ± ±. c Dt re expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, DHA docoshexenoic cid (:6n-), DPA docospentenoic cid (:5n-), ECO feed contining high-epa oil from trnsgenic Cmelin, EPA eicospentenoic cid (:5n-), FO fish oil feed, WCO wild-type Cmelin oil feed A Includes 5:, : nd : B Includes 6:n-9 nd :n-9 C Includes :5n-6 D Includes C 6 PUFA
11 Tle 7 Totl lipid content (percentge of wet weight) nd ftty cid compositions (mol%) of totl lipid of nterior intestine nd rin of se rem Anterior intestine Lipid content 6.9 ±.8 5. ±..5 ±. 5. ±. Ftty cid composition 6: 9.7 ±.. ±.8.6 ±.5 5. ±.8 Totl sturted A. ±.. ±.9 c 5. ±. c 7. ±.5 8:n-9 5. ± ±..5 ±.5 8. ± 7. Totl monounsturted B.6 ±.5.9 ± ±.6.7 ±.8 8:n ±.8 5. ±.6 6. ± ±. :n-6. ±. c. ±.. ±..8 ±. :n-6. ±. c. ±. c. ±.. ±. :n-6.7 ±..8 ±.. ±..9 ±.7 :n-6. ±.. ±. c. ±.. ±. Totl n-6 PUFA C 8. ±. c 8. ±.5. ±.. ±. 8:n-.9 ±. c.9 ±.7 5. ± ±. :5n- 8. ±.5.6 ±. d 7. ±.. ±. c :5n-. ±.. ±. c.6 ±..7 ±. :6n-. ±. 7. ± ±..8 ±. Totl n- PUFA 5.7 ±. 6.6 ±. 5. ± ±.9 Totl PUFA D 6. ±.6 c 5. ± ±. 5. ±. EPA + DHA.6 ± ±.8 c.9 ±.6 5. ±. EPA/DHA.7 ±.. ±. c.9 ±.. ±. c EPA + DPA + DHA.9 ±.5.9 ±.8 c 7.5 ± ±. Brin Lipid content 9.6 ±. 9.6 ± ±. 8. ±. Ftty cid composition 6: 9. ±.6 9. ±. 8.9 ± ±. Totl sturted A. ±.9. ±.. ±..9 ±. 8:n-9. ±.5. ±.5. ±.6. ±.5 Totl monounsturted B. ±..8 ±.6.7 ±..6 ±.7 8:n-6. ±.8.8 ±.5. ±.6.5 ±.6 :n-6. ±.. ±.. ±.. ±. :n-6. ±. d. ±. c. ±.. ±. :n-6.7 ±..5 ±.. ±.. ±. :n-6. ±.. ±.. ±.. ±. Totl n-6 PUFA C. ±.8.8 ± ± ±.7 8:n-. ±..7 ±.5.9 ±.. ±. :5n-.6 ±..6 ±.. ±..7 ±. :5n-.6 ±.. ±..5 ±.. ±. :6n-. ±.9. ± ±.7. ±.8 Totl n- PUFA 7. ±.5 7. ±.5 7. ±. 7. ±. Totl PUFA D. ±.9.9 ±.8.9 ±.6.5 ±.6 EPA + DHA.6 ±.7.7 ±.8. ±.8.8 ±.7 EPA/DHA. ±.. ±.. ±.. ±. EPA + DPA + DHA 6. ±.6.9 ± ±.7 5. ±.6 Dt re expressed s men ± SD (n = ). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5) DCO feed contining EPA + DHA oil from trnsgenic Cmelin, DHA docoshexenoic cid (:6n-), DPA docospentenoic cid (:5n-), ECO feed contining high-epa oil from trnsgenic Cmelin, EPA eicospentenoic cid (:5n-), FO fish oil feed, WCO wild-type Cmelin oil feed A Includes 5:, : nd : B Includes 6:n-9 nd :n-9 C Includes :5n-6 D Includes C 6 PUFA
12 .5..5 Liver Intestine Muscle Hed kidney Gills FO WCO ECO Brin DCO infiltrtion, minly represented y cidophilic grnulocytes nd some lymphocytes ws oserved, minly in fish fed ECO (dt not shown). Most of the cidophilic grnulocytes were locted in the lmin propri lthough few could e found in sumucos nd were present oth in mid nd hindgut. PC (9.%)..5. Liver nd Anterior Intestine Gene Expression LC PUFA Biosynthetic Genes PC (6.%) Fig. Non-metric multidimensionl scling (NMDS) plot sed on logrithmiclly trnsformed ftty cid composition of liver, muscle, gill, nterior intestine nd rin from gilthed se rem fed the four dietry tretments for weeks Tle 8 Men scores for the lipid vcuolistion nd peripncretic ft infiltrtion in liver of gilthed se rem fed the experimentl diets for weeks Cytoplsmic lipid. ±. c. ±.7. ±.7.8 ±. c vcuolistion Peripncretic ft.5 ±.. ±.5. ±.. ±.7 Dt re expressed s men ± SD (n = 6). Different superscript letters within row denote significnt differences mong diets s determined y one-wy ANOVA with Tukey s comprison test (p <.5). Scoring ws on scle from to s descried in detil in the Mterils nd Methods section with = not oserved, = few, = medium, nd = severe DCO feed contining EPA + DHA oil from trnsgenic Cmelin, ECO feed contining high-epa oil from trnsgenic Cmelin, FO fish oil feed, WCO wild-type Cmelin oil feed cytoplsmic vcuoles tht did not lter heptocyte shpe or size (Tle 8). Fish fed wild-type Cmelin oil (WCO) displyed higher degree of vcuolistion, lthough no structurl chnges, such s inflmmtion, necrosis or perivsculr cuffing were oserved. Fish fed the feeds contining the GM-derived oils showed intermedite levels of vcuolistion, with no differences etween FO nd DCO-fed fish or etween WCO nd ECO-fed fish (Tle 8). No significnt differences were oserved in the infiltrtion of peripncretic ft lthough fish fed FO showed the lowest scores nd DCO-fed fish the highest (p =.9; Tle 8). With intestinl tissue, good integrity of the sorptive memrne ws oserved in the sections from fish fed ll the dietry tretments. However, cellulr In liver, higher expression of ftty cyl desturse (fds) ws oserved in fish fed ll three diets contining VO (WCO, ECO nd DCO), with expression significntly greter in liver of WCO-fed fish compred to FO-fed fish (Fig. ). Similrly higher expression in liver of fish fed ll VO ws oserved in ftty cid elongse (elovl), significntly so in fish fed oth GM-derived oils compred to fish fed FO (Fig. ). There ws lso non-significnt trend for incresed expression of ftty cid elongse 5 (elovl5) in fish fed VO diets compred to fish fed FO (Fig. ). In contrst, nterior intestine showed different nutritionl regultion of these genes. Firstly, only elovl expression showed similr pttern of expression to tht oserved in liver with higher expression, leit not significnt, in fish fed the VO compred to fish fed FO (Fig. ). Secondly, fold chnges (FC) were less with the highest eing.7 FC for elovl for ECO-fed fish (Fig. ) compred to.6 FC in liver for this gene in fish fed ECO (Fig. ). Only fds showed significnt regultion y dietry oil source, eing down-regulted in intestine in VO-fed fish compred to fish fed FO, nd similr, non significnt, trend ws found in elovl5 in intestine (Fig. ). Lipid Metolism Genes As ove, the nutritionl regultion of this group of genes ws more mrked in liver (Fig. ) thn in nterior intestine (Fig. ). Lysophosphtidylcholine cyltrnsferse (lpct) ws up-regulted in VO-fed fish in oth tissues, lthough the highest expression ws found in liver of ECO-fed fish, wheres fish fed WCO showed the highest significnt FC in intestine. Ftty cid inding protein (FABP) gene expression ws lso regulted in liver, with highest expression in fish fed ECO, wheres no dietry regultion of this gene ws oserved in nterior intestine. Both lipoprotein lipse (lpl) nd heptic lipse (hl) genes showed the sme pttern in liver, with highest levels of expression in fish fed oth diets with GM-derived oils, with WCO showing intermedite levels etween those of ECO/DCO nd fish fed FO (Fig. ). In contrst, no regultion ws oserved in the nterior intestine for lpl, lthough its expression showed downwrd trend in
13 Fig. Expression, mesured y qpcr of LC-PUFA iosynthesis pthwy genes in se rem liver () nd nterior intestine () fter eleven weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to onewy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). fds, delt-6-ftty cyl desturse; elovl, ftty cid elongse ; elovl5, ftty cyl elongse A B fds fds elovl elovl elovl5 elovl A lpct 8 6 fp hl lpl B lpct fp lpl FO WCO DCO ECO Fig. Expression, mesured y qpcr of lipid metolism genes in se rem liver () nd nterior intestine () fter weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to one-wy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). lpct, lysophosphtidylcholine cyltrnsferse ; FABP, ftty cid inding protein ; hl, heptic lipse; lpl, lipoprotein lipse
14 A 6 5 B c cpt c cpt cpt cpt Fig. 5 Expression, mesured y qpcr of energy metolism genes in se rem liver () nd nterior intestine () fter weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to one-wy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). cpt, crnitine plmitoyltrnsferse, isoform ; cpt, crnitine plmitoyltrnsferse, isoform VO-fed fish, nd hl could not e detected in intestinl tissue (Fig. ). Ftty Acid Ctolism Genes Gene expression of two isoforms of crnitine plmitoyltrnsferse, cpt nd cpt, were evluted in liver nd nterior intestine of se rem (Fig. 5). In generl terms, expression of oth cpt in liver ws higher in fish fed the VO compred to fish fed FO. However, WCO-fed fish showed intermedite vlues of cpt expression, lower FC thn fish fed ECO, ut in the sme rnge s DCO-fed fish (Fig. 5). Fish fed ll three VO diets showed similr nd higher levels of expression of cpt in liver thn fish fed FO. No significnt differences in expression of either cpt or cpt were oserved in nterior intestine of se rem fed the dietry tretments (Fig. 5). Nucler Receptors Liver expression of the three evluted nucler receptors ws generlly higher in fish fed ll of the VO diets compred to fish fed FO, lthough differences were not significnt for peroxisome prolifertor-ctivted receptor α (PPARα) (Fig. 6). Expression in liver of PPARγ ws highest in ECO- nd DCO-fed fish with WCO-fed fish showing intermedite vlues, wheres fish fed ll the VO diets showed higher expression of sterol regultory element inding protein (srep) (Fig. 6). Although there were no significnt differences in the expression of these genes Fig. 6 Expression, mesured y qpcr of trnscription fctor genes in se rem liver () nd nterior intestine () fter weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to onewy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). PPARα, peroxisome prolifertor-ctivted receptor lph; PPARγ, peroxisome prolifertor-ctivted receptor gmm; srep, sterol regultory element-inding protein A B ppr ppr pprg pprg srep srep...
15 Fig. 7 Expression, mesured y qpcr of fish helth nd immune system genes in se rem liver () nd nterior intestine () fter weeks of feeding. Different superscript letters denote differences in gene expression mong the tretments ccording to onewy ANOVA (p <.5). Results re normlized expression rtios (verge ± SEM; n = 6) of the expression of these genes in fish fed the different diets in reltion to fish fed FO feed. Diets contin either fish oil (FO), wild-type Cmelin oil (WCO), high-epa Cmelin oil (ECO) or EPA + DHA Cmelin oil (DCO). csp, cspse ; pcn, proliferting cell nucler ntigen; il8, interleukin 8 A B csp csp pcn pcn il8 il8... mong the dietry tretments in nterior intestine, consistent pttern of lower expression in fish fed the VO diets ws oserved for ll three nucler receptors (Fig. 6). Fish Helth nd Immune System Genes Agin the three evluted genes ll showed higher expression in liver of fish fed the VO diets compred to fish fed FO (Fig. 7). In the cse of cspse (csp), ECO-fed fish showed the highest expression levels, lthough no differences were found with WCO nd DCO-fed fish which lso showed similr levels of expression to FO-fed fish (Fig. 7). No sttisticl differences were oserved for proliferting cell nucler ntigen (pcn) expression in liver, lthough DCO, nd prticulrly ECO-fed fish, tended to hve higher levels of expression. DCO-fed fish showed cler up-regultion in heptic interleukin 8 (il8) expression, with WCO nd ECO-fed fish displying intermedite levels (Fig. 7). In contrst, lthough il8 ws lso differentilly regulted y dietry oil source in intestine, the pttern ws opposite to tht oserved in liver, with VO-fed fish showing lower expression compred to FO-fed fish (Fig. 7). Trnsgenes All nlysed se rem tissues (muscle, liver nd nterior intestine) tested negtive for the presence of the Cmelin T-DNA gene construct s monitored y the use of npt-ii primers (dt not shown). Discussion The replcement of FO in qufeeds depends on finding lterntive, sustinle sources of EPA nd DHA, with this currently eing one of the min issues in quculture nutrition, prticulrly in mrine species tht hve limited ility for endogenous synthesis of LC-PUFA. Previous trils completely replcing FO y VO in feeds for gilthed se rem resulted in reduced growth proly relted to reduced intke of essentil LC-PUFA, which re not found in VO [ ]. In the present study we evluted the complete sustitution of FO y two different oils otined from GM-oilseed crops rich in either EPA (ECO) or contining oth EPA nd DHA (DCO) in feeds for se rem juveniles. Both oils proved to e effective sustitutes of FO, displying growth rtes tht were similr to those chieved y fish fed FO (in the cse of DCO) or WCO (for ECO). Similrly, recent studies employing oth oil itertions s sustitutes for FO in Atlntic slmon feeds showed tht fish fed these oils were s successful s those fed FO [, 5]. The lck of effect on growth in WCO-fed fish in the present tril is explined y the inclusion of reltively high levels of FM which ensured tht n- LC-PUFA requirements were fully stisfied (.9 % n- LC-PUFA in WCO-feed), estimted to e.9 % of dry feed []. It ws surprising tht the ECO-fed fish showed slightly reduced performnce, leit no different to WCO-fed fish, given tht n- LC-PUFA requirements, including DHA, were stisfied. One reson for this could e relted to the
16 lnce etween the different dietry LC-PUFA including the dietry EPA/DHA rtio, which differed mong the feeds. An EPA/DHA rtio of : ws reported to e optiml for se rem juveniles [5] nd in the present tril ECO feed presented rtio of pproximtely :, perhps suggesting n imlnce in these essentil ftty cids. However, in previous trils in Atlntic slmon, where the EPA/ DHA rtio ws even higher (round 9:), given the higher oil inclusion nd lower FM level, no dverse effect ws oserved on growth []. However, it should e noted tht the optiml dietry EPA/DHA rtio is likely to e speciesspecific. Another ftty cid tht differed etween ECO nd the other feeds ws ARA, with the ECO diet hving more thn doule the ARA content of the FO diet. Incresed dietry ARA levels hve een ssocited with enhnced stress resistnce, survivl nd improved growth in se rem juveniles nd lrve [6 ] s occurs in other mrine wrm wter species such s Europen se ss (Dicentrrchus lrx) []. However, ARA produces pro-inflmmtory effects due to production of prostglndin E (PGE ), leukotriene B (LTB ) nd lipoxins [], nd so diets rich in n-6 PUFA, primrily ARA, could led to overproduction of PGE lthough tht cn, in turn, hve n immunosuppressnt effect []. Although no mjor or ovious ltertion in fish helth ws shown y the histology nd qpcr results in the present study, incresed ARA levels or even imlnced proportions of n- nd n-6 PUFA my prtly explin the slightly lower growth of ECO-fed se rem. On the other hnd, the rtios of ARA, EPA nd DHA to ech other re lso known to e of importnce for mrine finfish nutrition. For instnce, diet with high EPA nd low ARA (9:) significntly reduced performnce of Atlntic slmon when compred to fish fed more lnced rtio of EPA nd ARA (.5:) [], similr to wht ws oserved in the present tril. Additionlly, multiple regression nlysis demonstrted meningful reltionships etween ARA nd DHA in Cliforni yellowtil (Seriol dorslis) with ARA nd DHA contriuting positively to weight gin wheres EPA contriuted negtively [5]. Thus, the lower growth oserved in ECO-fed se rem could e due to imlnced proportions etween these three essentil LC-PUFA. Despite the slightly reduced performnce of ECO-fed fish compred to FO nd DCO-fed fish, no mrked differences were oserved in lipid or individul ftty cid digestiility, which is consistent with previous studies in slmon using the sme oil []. However, ECO-fed fish consumed less feed (g/tnk) thn fish fed FO or WCO diets, which my suggest pltility issue with this oil. However, it must e noted tht oth oils were extrcted using the sme process nd stilized using the sme concentrtion of ntioxidnt (ethoxyquin). In ddition, exctly the sme tch of ECO ws used in the erlier tril in slmon where no differences in performnce were oserved etween tretments []. Moreover, the se rem feeds were formulted with higher FM levels thn the erlier slmon feeds, which would in turn e expected to increse pltility. Thus, it ppers tht the slightly reduced performnce of ECO-fed fish is more likely to e relted to species-specific sensitivity to high dietry ARA/n-6 levels tht ffected feed intke rther thn prolem with pltility. Complete sustitution of dietry FO y VO is lso ssocited with incresed deposition of C 8 ftty cids nd reduced proportions of LC-PUFA in fish tissues. The two- GM derived oils investigted in the present tril cn e considered s hyrid oils given tht they contin fetures of oth vegetle nd mrine oils, nd the tissue ftty cid profiles reflected this chrcteristic. Thus, in generl terms tissues of ECO nd DCO fed fish hd higher proportions of n- LC-PUFA thn fish fed WCO, which in the cse of flesh enhnced the nutritionl vlue of the product. Some limited iosynthetic ctivity ws oserved prticulrly in fish fed ECO with high EPA (nd ARA), where higher levels of DPA (:5n-) nd :n-6 were oserved in liver, muscle nd gills compred to fish fed either WCO or DCO. This likely reflected the higher heptic expression of elovl, n enzyme tht prticiptes in the elongtion of ARA nd EPA to :n-6 nd :5n-, respectively [6], oserved in ECO nd DCO-fed fish. However, the incresed expression of fds ws not sttisticlly significnt in ECO fed fish, which showed intermedite vlues etween FO nd WCOfed fish. However, incresed expression of fds hs een reported previously in se rem fed VO compred to fish fed FO [, ]. The involvement of elovl in only lter stges of the iosynthetic pthwy (predominntly elongtion of C ), prticulrly the synthesis of very long chin ftty cids (VLC-FA), explins why se rem tissue ftty cid compositions lrgely reflected dietry ftty cid compositions. This ws cler in the PCA (NMDS Plot) nlysis where ll tissues, except rin, grouped ccording to the feeds, with ECO nd DCO clustering in the sme group. This indicted tht the ftty cid composition of rin ws more conserved nd less ffected y diet thn the other tissues, consistent with other studies in the sme species [] nd other teleost species [7, 8]. Inclusion of high levels of VO nd reduction of FO in feeds hs een ssocited with incresed tissue lipid deposition in severl fish species [,,, 9 5]. In the present study incresed lipid deposition ws oserved only in liver, eing highest in WCO-fed fish with ECO nd DCO-fed fish showing intermedite vlues, with liver histology following the sme trend. Similr results were found in Atlntic slmon fed high ECO, reflecting the hyrid nture of the GM-derived oil [, ]. The mechnism for incresed lipid deposition in fish fed VO is not cler lthough high n- LC-PUFA levels found in FO cn suppress tricylglycerol (TAG) ccumultion in
Optimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationThe Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes
The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationTHE EFFECT OF DIFFERENT STIMULI ON MEAGRE (Argyrosomus regius) FEEDING BEHAVIOUR.
THE EFFECT OF DIFFERENT STIMULI ON MEGRE (rgyrosomus regius) FEEDING EHVIOUR. Ionnis E. Ppdkis, Nikos Ppndroulkis, lkioni Sfendourki, Veronic Cmporesi 3, Mnolis Vsilkis, Constntinos C. Mylons Institute
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationOverview Background production, fermentable
Microes sustinle qufeed resource for the future Liv Torunn Mydlnd, Odd Helge Romrheim, Thor Lndsverk, Anders Skrede nd Mrgreth Øverlnd. Overview Bckground production, fermentle sustrtes, cell growth type
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationMartinez-Rubio et al. BMC Genomics 2014, 15:462
Mrtinez-Rubio et l. BMC Genomics 2014, 15:462 RESEARCH ARTICLE Open Access Effects of functionl feeds on the lipid composition, trnscriptomic responses nd pthology in hert of Atlntic slmon (Slmo slr L.)
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationThe Ever Changing World of Feed Additives in The Poultry Industry
The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationAquaculture Nutrition
Aquculture Nutrition 2011 17; 671 684... doi: 10.1111/j.1365-2095.2011.00869.x 1,2 1 2 1 ICBAS Instituto de Cieˆncis Biome dics Abel Slzr nd CIIMAR/CIMAR Centro Interdisciplinr de Investigç o Mrinh e Ambientl,
More informationScholarly Research Exchange
Scholrly Reserch Exchnge Volume 9 Article ID 7959 doi:1.3814/9/7959 Reserch Article Different Dietry Levels of Protein to Lipid Rtio Affected Digestive Efficiency, Skeletl Growth, nd Muscle Protein in
More informationProducts for weaners Benzoic acid or the combination of lactic acid and formic acid
Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationGoal: Evaluate plant health effects while suppressing dollar spot and brown patch
Newer Fungicide Products Alone nd In Rottion on Chicgo Golf Green Reserchers: Chicgo District Golf Assoc. Derek Settle, Tim Sibicky, nd Nick DeVries Gol: Evlute plnt helth effects while suppressing dollr
More informationImpact of essential fatty acid deficiency and temperature on tissues' fatty acid composition of European sea bass (Dicentrarchus labrax)
Plese note tht this is n uthor-produced PDF of n rticle ccepted for publiction following peer review. The definitive publisher-uthenticted version is vilble on the publisher Web site Aquculture Vol. 255,
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationEffects of phospholipids and HUFA levels on ontogene7c development and performance of pikeperch (Sander lucioperca) larvae
Effects of phospholipids nd HUFA levels on ontogene7c development nd performnce of pikeperch (Snder lucioperc) lrve DTU Aqu, FUNDP, ULPGC ACM 2017 Brcelon, Jnury 2017 The outcome of the experiments should
More informationThe Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers
Beef Reserch Report, 2000 Animl Science Reserch Reports 2001 The Effects of High-Oil Corn or Typicl Corn with or without Supplementl Ft on Diet Digestibility in Finishing Steers Crig R. Belknp Iow Stte
More informationNozzi Valentina, Graber Andreas, Mathis Alex, Schmautz Zala, Junge Ranka
Nozzi Vlentin, Grer ndres, Mthis lex, Schmutz Zl, Junge Rnk Interntionl conference quponics reserch mttes Ljuljn, 22-24 Mrch 216 Some nutrients from the quculture effluents re present in insufficient quntities
More informationB. Koven 1*, E. Gisbert 2, O. Nixon 1, I. Meiri-Ashkenazi 1, A. Gaon 1, M.M. Solovyev 3,4, A. Tandler 1, H. Rosenfeld 1
DESIGNING WEANING DIETS BASED ON THE ONTOGENY OF DIGESTIVE TRACT ENZYME ACTIVITY DURING THE CARNIVOROUS-OMNIVOROUS TRANSITION IN GREY MULLET (MUGIL CEPHALUS) JUVENILES B. Koven 1*, E. Gisert 2, O. Nixon
More informationThe Journal of Physiology
J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationReplacing Fish Meal with Soybean Meal and Brewer s Grains with Yeast in Diets for Australian Red Claw Crayfish, Cherax quadricarinatus
Replcing Fish Mel with Soyben Mel nd Brewer s Grins with Yest in Diets for Austrlin Red Clw Cryfish, Cherx qudricrintus Lur A. Muzinic*, Kenneth R. Thompson, & Crl D. Webster Introduction Soyben mel (SBM)
More informationEvaluation of Sun and Oven-Dried Broiler Offal Meal as Replacement for Fishmeal in Broiler and Layer Rations
Interntionl Journl of Poultry Science 5 (7): 646-650, 2006 ISSN 1682-8356 Asin Network for Scientific Informtion, 2006 Evlution of Sun nd Oven-Dried Broiler Offl Mel s Replcement for Fishmel in Broiler
More informationPreliminary investigation of antimicrobial effects of pomegranate (Punica granatum L.) leathery exocarp extract against some serious phytopathogens
Preliminry investigtion of ntimicroil effects of pomegrnte (Punic grntum L.) lethery exocrp extrct ginst some serious phytopthogens Elshfie H.S. 1,*, Skr S.H. 2, Mng S.M. 1, Frisullo S. 3, Cmele I. 1 1
More informationEffect of 1-Methylcyclopropene on the Physiology and Yield of Cotton. Derrick Oosterhuis Eduardo Kawakami and Dimitra Loka University of Arkansas
Effect of 1-Methylcyclopropene on the Physiology nd Yield of Cotton Derrick Oosterhuis Edurdo Kwkmi nd Dimitr Lok University of Arknss Cotton Crop Gossypium hirsutum Unique out cotton Perennil grown s
More informationVegetable oils affect the composition of lipoproteins in sea bream (Sparus aurata)
British Journl of Nutrition (2006), 96, 830 839 q The Authors 2006 DOI: 10.1017/BJN20061909 Vegetle oils ffect the composition of lipoproteins in se rem (Sprus urt) Mri José Cllero 1 *, Bente E. Torstensen
More informationEffects of Dietary Protein and Energy on Growth Performance and Carcass Characteristics of Betong Chickens (Gallus domesticus) During Growing Period
Interntionl Journl of Poultry Science 9 (5): 468-472, 2010 ISSN 1682-8356 Asin Network for Scientific Informtion, 2010 Effects of Dietry Protein nd Energy on Growth Performnce nd Crcss Chrcteristics of
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationInheritance of cholesterol metabolism of probands with high or low cholesterol absorption
Inheritnce of cholesterol metolism of pronds with high or low cholesterol sorption Helen Gylling* nd Ttu A. Miettinen 1, Deprtment of Clinicl Nutrition,* University of Kuopio, nd Kuopio University Hospitl,
More informationDr. Javier Polo Vice President Research & Development
Efecto de l suplementción con concentrdo de inmunoglobulins prtir del suero bovino en l Microbiot y su contribución l slud intestinl y l sistem nervioso centrl Dr. Jvier Polo Vice President Reserch & Development
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationSUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis
SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationRecent advances in cryopreservation od salmonid fish semen. Andrzej Ciereszko
Recent dvnces in cryopreservtion od slmonid fish semen Andrzej Ciereszko Institute of Animl Reproduction nd Food Reserch, Polish Acdemy of Sciences in Olsztyn, Polnd Justifiction for the studies Poor performnce
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationAOAC Official Method Determination of Isoflavones in Soy and Selected Foods Containing Soy
45.4.14 AOAC Officil Method 2001.10 Determintion of Isoflvones in Soy nd Selected Foods Contining Soy Extrction, Sponifiction, nd Liquid Chromtogrphy First Action 2001 (Applicble to the determintion of
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More informationAquaculture protein levels
Ž. Aquculture 189 2000 287 292 www.elsevier.nlrlocterqu-online Whole-ody mino cid pttern of F4 humn growth hormone gene-trnsgenic red common crp ž Cyprinus crpio/ fed diets with different protein levels
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationEffect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens
Interntionl Journl of Poultry Science 7 (12): 1232-1236, 2008 ISSN 1682-8356 sin Network for Scientific Informtion, 2008 Effect of Different Dietry Energy Sources on Induction of Ftty Liver-Hemorrhgic
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationPLACENTAL TRANSFER OF FATTY ACIDS AND FETAL IMPLICATIONS
Note: for non-commercil purposes only PLACENTAL TRANSFER OF FATTY ACIDS AND FETAL IMPLICATIONS Dr. Elvir Lrqué elvird@um.es Deprtment of Physiology Unversity of Murci (Spin) FETAL PROGRAMMING BRAIN 6%
More informationSoybean Hulls as an Alternative Feed for Horses
Animl Industry Report AS 650 ASL R1931 2004 Soyben Hulls s n Alterntive Feed for Horses Josie Booth Iow Stte University Howrd Tyler Iow Stte University Peggy Miller-Auwerd Iow Stte University Jenette Moore
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationAtlantic halibut larval nutrition and the drivers of pigmentation and eye migration in flounders. Kristin Hamre. MH (mm) Drawing: Øystein Sæle (2003)
8.5 8.0 7.5 MH (mm) 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 Stge 9 Stge 8 Stge 7 Atlntic hlibut lrvl nutrition nd the drivers of pigmenttion nd eye migrtion in flounders Kristin Hmre 2.5 Stge 6 2.0 1.5 Stge
More informationIbrahim, I. Hamid Animal Production Research Center-Khartoum North, Sudan
Interntionl Journl of Poultry Science 13 (8): 484-488, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 Investigtions into the Addition of Herl Methionine (Phytonin) As Sustitute of Synthetic
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationEFFECTS OF MANNAN-OLIGOSACCHARIDE ON GROWTH, SURVIVAL AND DISEASE RESISTANCE OF NILE TILAPIA (OREOCHROMIS NILOTICUS LINNAEUS) FRY
8 th Interntionl Symposium on Tilpi in Aquculture 2008 345 EFFECTS OF MANNAN-OLIGOSACCHARIDE ON GROWTH, SURVIVAL AND DISEASE RESISTANCE OF NILE TILAPIA (OREOCHROMIS NILOTICUS LINNAEUS) FRY C. SAMRONGPAN*,
More informationBritish Journal of Nutrition
(11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationlarvi 2013 Oxidative stress in sea bass (Dicentrarchus labrax) larvae interaction of high dietary DHA contents and several antioxidant nutrients
lrvi 2013 6th fish & shellfish lrviculture symposium Oxidtive stress in se ss (Dicentrrchus lrx) lrve interction of high dietry DHA contents nd severl ntioxidnt nutrients Monic Betncor ghent university,
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationAccepted 1 November 2006
149 The Journl of Experimentl Biology 21, 149-165 Pulished y The Compny of Biologists 27 doi:1.1242/je.2628 Chnges in mitochondril oxidtive cpcities during therml cclimtion of rinow trout Oncorhynchus
More informationEgg quality, fatty acid composition and immunoglobulin Y content in eggs from laying hens fed full fat camelina or flax seed
Cherin nd Quezd Journl of Animl Science nd Biotechnology (2016) 7:15 DOI 10.1186/s40104-016-0075-y RESEARCH Open Access Egg qulity, ftty cid composition nd immunogloulin Y content in eggs from lying hens
More informationChoice Feeding of Two Different Broiler Strains Using Diets with Constant Energy Level 1
Interntionl Journl of Poultry Science 7 (8): 726-737, 2008 ISSN 1682-8356 Asin Network for Scientific Informtion, 2008 Choice Feeding of Two Different Broiler Strins Using Diets with Constnt Energy Level
More informationEffect of processing on in vitro bioaccessibility of phenolics, flavonoids and antioxidant activity of vegetables with/without yoghurt
Effect of processing on in vitro ioccessiility of phenolics, flvonoids nd ntioxidnt ctivity of vegetles with/without yoghurt Assoc. Prof. Dr. Esr ÇAPANOĞLU GÜVEN Deprtment of Food Engineering Istnul Technicl
More informationAgilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide
Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte
More informationPerformance and Carcass Characteristics of Broiler Chickens Fed Diets Supplemented with Graded Levels of Roxazyme G
Interntionl Journl of Poultry Science 6 (5): 5-9, 2007 ISSN 1682-856 Asin Network for Scientific Informtion, 2007 Performnce nd Crcss Chrcteristics of Broiler Chickens Fed Diets Supplemented with Grded
More informationEnhanced glutathione peroxidases (GPx) activity in young barley seedlings enriched with selenium
Africn Journl of Biotechnology Vol. 10(55), pp. 11483-11487, 21 Septemer, 2011 Aville online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB11.1480 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationResponse of Commercial Egg-Type Pullets to Diets Varying in Protein and Energy Content in Arid Hot Climate
Interntionl Journl of Poultry Science 8 (9): 90-98, 2009 ISSN 682-8356 sin Network for Scientific Informtion, 2009 Response of Commercil Egg-Type Pullets to Diets Vrying in Protein nd Energy Content in
More informationGeographical influence on digit ratio (2D:4D): a case study of Andoni and Ikwerre ethnic groups in Niger delta, Nigeria.
Journl of Applied Biosciences 27: 1736-1741 ISSN 1997 5902 Geogrphicl influence on digit rtio (2D:4D): cse study of Andoni nd Ikwerre ethnic groups in Niger delt, Nigeri. Gwunirem, Isrel U 1 nd Ihemelndu,
More informationControl of Metamorphosis in Flatfish
Control of Metmorphosis in Fltfish K. Pittmn*, J. Solkken 1 & K. Hmre 2 *Dept of Fisheries nd Mrine Biology,University of Bergen, Norwy 1. Austevoll Mriculture Sttion, Inst of Mrine Reserch, Bergen 2.
More information2. Hubs and authorities, a more detailed evaluation of the importance of Web pages using a variant of
5 Web Serch Outline: 1. Pge rnk, for discovering the most ëimportnt" pges on the Web, s used in Google. 2. Hubs nd uthorities, more detiled evlution of the importnce of Web pges using vrint of the eigenvector
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More information