Activation of sterol regulatory element-binding proteins in mice
|
|
- Joel Gordon
- 5 years ago
- Views:
Transcription
1 Activation of sterol regulatory element-binding proteins in mice exposed to perfluorooctanoic acid for 28 days Shengmin Yan, Jianshe Wang, and Jiayin Dai* Materials and methods Chemicals and antibodies Perfluorooctanoic acid (PFOA, CAS number , 96% purity) and WY-14,643 (CAS number , 98% purity) were obtained from Sigma-Aldrich (St. Louis, MO). Anti-SREBP1 mouse monoclonal antibody, anti-srebp2 rabbit polyclonal antibody, anti FBXW7 rabbit monoclonal antibody, and anti INSIG2 rabbit polyclonal were purchased from Abcam (Cambridge, MA). Anti-INSIG1 goat polyclonal antibody, anti-scap goat polyclonal antibody, HRP-conjugated goat anti-mouse, HRP-conjugated goat anti-rabbit, and HRP-conjugated donkey anti-goat were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-β-tubulin mouse monoclonal antibody was purchased from Beijing CoWin Bioscience Co, Ltd (Beijing, China). All other chemicals used were of the highest grade commercially available. Animal treatment Male Balb/c mice (age 6-8 weeks) were obtained from Weitong Lihua Experimental Animal Center (Beijing, China) and all experimental manipulations were described as our previous study (Yan et al. 2014). In brief, mice were randomly divided into six groups and dosed with either Milli-Q water or PFOA diluted in Milli-Q water at doses of 0.08, 0.31, 1.25, 5 and 20 mg/kg/d by gavage 1
2 for 28 days. The doses of PFOA were chosen according to earlier studies and our previous experiments. All animal treatment were approved by the Committee on the Ethics of Animal Experiments from the Institute of Zoology, Chinese Academy of Sciences (Permit Number: EET ). Liver PFOA determination Liver PFOA concentrations of each group (n = 3) were analyzed using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). Liver samples were weighted and prepared as homogenates with Milli-Q water for PFOA analysis. PFOA was extracted as our previous report with some modification (Zhang et al. 2012). Briefly, about 100 mg liver samples were extracted with acetonitrile (ACN) twice, with both extractants then combined and concentrated to nearly 0.5 ml under a nitrogen gas flow at 40 C. Each concentrated solution were added with 0.5 ml of methanol (MeOH) then diluted using 10 ml of Milli-Q water for SPE cleanup. We passed each solution through pre-equilibrated Oasis WAX cartridges (Oasis HLB; 150 mg, 6cc; Waters). The cartridges were first rinsed with Milli-Q water and then 25 mm of acetate buffer solution (ph 4) after loading all samples. Remaining water in the cartridges was removed using vacuum filtration. PFOA were eluted using 4 ml of MeOH and 4 ml of 0.1% NH 4 OH in MeOH then concentrated to approximately 1 ml under nitrogen gas. PFOA determination and data analysis were performed as our previous report (Yan et al. 2014). Cell culture The mouse hepatocellular carcinoma cell line Hepa 1-6 (Cell Resource Center, IBMS, CAMS/PUMC) was cultured in DMEM supplemented with 2
3 10 % fetal bovine serum (FBS) in 25-cm 2 tissue culture flasks at 37 C in a humidified atmosphere composed of 95 % air and 5 % CO 2. PFOA was dissolved as a stock solution of 10 mm in serum free DMEM and then filter sterilized (0.22 μm Millipore filter, Millipore, USA). WY-14,643 was dissolved in absolute ethanol as a stock solution of 10 mm. All stock solutions were diluted with DMEM supplemented with 10 % FBS before use. According to our Hepa 1-6 cell viability assessment by MTT test, we found PFOA did not reduce cell viability below the dose of 250 μm (Fig.S1) after 72 h treatment and doses of 50, 100 and 200 μm were chosen for determine toxic effects of PFOA on Hepa 1-6 cells. According to earlier toxicological study(takacs and Abbott 2007), WY-14,643 at the dose of 25 μm was used as a positive control for PPARα activation and 1/400 (V/V) ethanol (cell viability of Hepa1-6 after exposure to these two chemicals around the chosen concentration for 72 h was tested and shown in Fig. S2) were used as its solvent control. For total RNAs isolation, protein isolation, and determination of total cholesterol (TCHO) and triglyceride (TG) concentrations, cells were plated at a density of cells per well in 6-well tissue culture plates containing 2 ml of culture medium per well. The medium was replaced with PFOA, ethanol or WY-14,643 at the doses mentioned above overnight after plating and exposed for 72 h before later use. For flow cytometry, cells were plated at a density of cells per well in 12-well tissue culture plates containing 1 ml of culture medium per well and treated as mentioned above. 3
4 Determination of TCHO and TG concentrations Tissue total cholesterol assay kit and tissue triglyceride assay kit (Applygen Technologies, Beijing, China) were used for determination of TCHO and TG concentrations. Mouse liver homogenates or Hepa 1-6 cell lysates were prepared and TCHO and TG concentrations were determined according to the manufacturer s instructions. bicinchoninic acid (BCA) protein assay kit (Tiangen, Beijing, China) was used detect protein concentrations in the tissue homogenates or cell lysates and the concentrations of TCHO or TG were then adjusted by protein concentrations. Detection of neutral lipids change in cells Neutral lipids change in Hepa 1-6 cell after exposed to PFOA were detected by flow cytometry using the fluorescent neutral lipid dye BODIPY 493/503 (Molecular Probes, Carlsbad, CA). BODIPY 493/503 were prepared as a stock solution of 10 mg/ml in ethanol (Gocze and Freeman 1994) and diluted to 0.2 μg/ml in PBS as working solution before use. After exposed to PFOA for 72 h, cells were harvested by trypsinization, washed twice with PBS, and then incubated with 0.2 μg/ml BODIPY 493/503 for 30 min in the dark. Samples were then processed on a BD FACS Calibur with Cell Quest software (BD Bioscience, San Jose, CA) with the preset yellow channel that detected emitted light maximally at 520 nm. At least 20,000 cells in each sample were analyzed and the mean fluorescence intensity was used to calculate the fold change of neutral lipids contents. Real-time PCR analysis Total RNAs were isolated from mouse livers (n = 6) or Hepa 1-6 cells using TRIzol (Life Technologies-Invitrogen, Carlsbad, CA, USA) 4
5 according to the manufacturer s instructions and measured by a NanoDrop 2000 spectrophotometer (Thermo Scientific). cdnas were synthesized using an oligo-(dt) 15 primer and M-MLV reverse transcriptase (Promega, Madison, USA). The messenger RNA (mrna) expression levels of selected genes were quantified through real-time PCRs performed with the Stratagene Mx3000P q-pcr system (Stratagene, USA) using SYBR Green PCR Master Mix reagent kits (Tiangen, Beijing, China) according to the manufacturer s instructions. Mouse specific primers were designed for selected genes (Table S1 in supplementary Information). Data were analysis with MxPro QPCR software and the relative quantification of each mirna was calculated using the 2 ΔΔCt method using 18S ribosomal RNA (18S) as the endogenous control. Protein isolation Frozen liver specimens were homogenized in RIPA buffer (Thermo Scientific) containing 1 mm phenylmethanesulfonyl fluoride (PMSF) and then collect the supernatant after centrifuged at g for 15 min. After treated for 72 h, Hepa 1-6 cells were washed with ice cold PBS and lysed with RIPA buffer containing 1 mm PMSF. The cell lysates were collected and centrifuged at g for 15 min. Supernatant was transferred to a new tube for further analysis. Protein concentration was determined using BCA protein assay kit (Tiangen, Beijing, China). Western blotting The proteins (40 μg of tissue protein or 15 μg of cell protein) were separated using a 12 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, Massachusetts), which were then blocked for 1 h at room temperature using 5 % bovine serum albumin (BSA) in Tris-buffered 5
6 saline containing 0.1 % Tween 20 (TBST). Membranes were incubated with the appropriate primary antibody diluted with 5 % BSA in TBST containing 0.02 % NaN 3 at 4 C overnight and then washed with TBST before incubated with horseradish peroxidase-coupled secondary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) diluted with 5 % non-fat milk or BSA in TBST at room temperature. Protein bands were detected using enhanced chemiluminescence (ECL) system Western blot detection kit (Tiangen, Beijing, China) and were visualized by exposed to X-ray film (Kodak, NY). Membranes were subsequently washed and then reprobed for β-tubulin to equal protein loading. The intensities of protein bands were quantified using Quantity One software (Bio-Rad, Hercules, CA). TaqMan mirna assay About 50 ng RNA from mouse liver or Hepa 1-6 cells were used for TaqMan mirna assay as mentioned in our previous report (Yan et al. 2014). The mirnas analyzed in this study were mmu-mir-96-5p (assay ID ), mmu-mir-182-5p (assay ID ), mmu-mir-183-5p (assay ID ). U6 snrna (assay ID ) was selected as the endogenous control, and fold change of each mirna after exposed to PFOA was calculated using the 2 ΔΔCt method. Statistical analysis Statistical analyses were performed using SPSS for Windows 17.0 Software (SPSS, Inc., Chicago, IL). Data were represented as means with standard errors (mean ± S.E.). Differences between treatments were determined using one-way analysis of variance (ANOVA) followed by Fisher's least significant difference (LSD) test, with p-value of < 0.05 deemed significant. All represented 6
7 mean values ± S.E. from cell experiments were based on at least 3 independent experiments. References Gocze PM, Freeman DA (1994) Factors underlying the variability of lipid droplet fluorescence in MA-10 Leydig tumor cells. Cytometry 17(2):151-8 Takacs ML, Abbott BD (2007) Activation of mouse and human peroxisome proliferator-activated receptors (alpha, beta/delta, gamma) by perfluorooctanoic acid and perfluorooctane sulfonate. Toxicol Sci 95(1): Yan S, Wang J, Zhang W, Dai J (2014) Circulating MicroRNA Profiles Altered in Mice after 28 Days Exposure to Perfluorooctanoic Acid. Toxicol Lett 224(1):24-31 Zhang W, Zhang Y, Zhang H, Wang J, Cui R, Dai J (2012) Sex differences in transcriptional expression of FABPs in zebrafish liver after chronic perfluorononanoic acid exposure. Environ Sci Technol 46(9):
8 Viability (%) h Dose of PFOA ( M) Fig. S1 Hepa 1-6 cells viability after exposure to PFOA for 72 hours, Data are means ± SE from each of the three experiments was performed in quadruply. 8
9 Cell viability (%) * * 0 1/1000 1/400 1/ Ethanol (V/V) WY ( M) Fig. S2 Hepa 1-6 cells viability after exposed to Ethanol or WY-14,643 (WY) for 48 and 72 hours, Data are means ± SE from each of the three experiments was performed in quadruply, significantly different from control group (*p < 0.05, **p < 0.01). 9
10 Relative mrna level mg/kg/d 0.08 mg/kg/d 0.31 mg/kg/d 1.25 mg/kg/d 5 mg/kg/d 20 mg/kg/d 1 0 ** ** Hnf4 Aldob Cyp1a2 Cyp7a1 L-pk Pck1 Fig. S3 Relative mrna level of Hnf-4α and its representative target genes (n = 6). Data are means ± SE. Significantly different from control group (*p < 0.05, **p < 0.01). 10
11 Relative mrna level mg/kg/d 0.08 mg/kg/d 0.31 mg/kg/d 1.25 mg/kg/d 5 mg/kg/d 20 mg/kg/d ** ** * 1 0 Fbxw7 Insig1 Insig2 * Scap Fig. S4 Relative fold change of Fbxw7, Insig1, Insig2 and Scap mrna level (n = 6). Data are means ± SE. Significantly different from control group (*p < 0.05, **p < 0.01). 11
12 Fig. S5 A possible schematic model of how SREBP maturation pathway involved in the effects induced by PFOA on liver metabolism. 12
13 13
14 Table S1 Primers for qpcr MOUSE NM (bp) Forward (5 to 3 ) Reverse (5 to 3 ) 18S NR_ GCCGTTCTTAGTTGGTGGA GACCTGTTATTGCTCAATCTCG Acox1 NM_ TAACTTCCTCACTCGAAGCCA AGTTCCATGACCCATCTCTGTC Aldob NM_ GAAACCGCCTGCAAAGGATAA GAGGGTCTCGTGGAAAAGGAT Apoa4 NM_ GGAGCACCTGAAGCCCTAT ATGCGCTGGATGTATGG Apoc3 NM_ AAGTAGCGTGCAGGAGTC ATAGCTGGAGTTGGTTGG Cpt1a NM_ TGGCATCATCACTGGTGTGTT GTCTAGGGTCCGATTGATCTTTG Cyp1a2 NM_ AGTACATCTCCTTAGCCCCAG GGTCCGGGTGGATTCTTCAG Cyp4a10 NM_ CCCAAGTGCCTTTCCTA GCAAACCATACCCAATCC Cyp7a1 NM_ AATCTACCCAGACCCTT TTGCTTTCCCACTTTC Dbi (Acbp) NM_ GAATTTGACAAAGCCGCTGAG CCCACAGTAGCTTGTTTGAAGTG Fabp1(L-fabp) NM_ ATGAACTTCTCCGGCAAGTACC CTGACACCCCCTTGATGTCC Fasn NM_ GGCTCTATGGATTACCCAAGC CCAGTGTTCGTTCCTCGGA Fbxw7 NM_ GGCACTCTATGTGCTTTCATTCC TGTCTGATATACGCACTCTTCCA Hmgcr NM_ GATTCTGGCAGTCAGTGGGAA GTTGTAGCCGCCTATGCTCC Hmgcs1 NM_ AACTGGTGCAGAAATCTCTAGC GGTTGAATAGCTCAGAACTAGCC Hmgcs2 NM_ GAAGAGAGCGATGCAGGAAAC GTCCACATATTGGGCTGGAAA Hnf4α NM_ AAGGTGCCAACCTCAATTCATC CACATTGTCGGCTAAACCTGC Insig1 NM_ TGTCGGTTTACTGTATCCCTGT GTTGATGCCAACGAACACGG Insig2 NM_ GGAGTCACCTCGGCCTAAAAA CAAGTTCAACACTAATGCCAGGA Ldlr NM_ GTCTGTCACCTGTCAGTCCAATC TCTAGGCAATCTCGGTCTCC Lpl NM_ TCTCCTGATGACGCTGAT CTTGGAGTTGCACCTGTAT Pck1(Pepck) NM_ CTGCATAACGGTCTGGACTTC CAGCAACTGCCCGTACTCC Pklr(L-pk) NM_ TCAAGGCAGGGATGAACATTG CACGGGTCTGTAGCTGAGTG Ppar-a NM_ AGAGGTCCGATTCTTCCA ATCCAGTTCTAAGGCATTGA Ppar-d NM_ GCAGCCTCAACATGGAATGTC GAGCTTCATGCGGATTGTCC Ppar-g NM_ GGAAGACCACTCGCATTCCTT GTAATCAGCAACCATTGGGTCA Scap NM_ CTGACGCCCACACTCAATG CACCAACACGTTCTCTAGCCC Scd1 NM_ GACCTGAAAGCCGAGAA CGTTGAGCACCAGAGTGT Srebf1 NM_ CAAGGCCATCGACTACATCCG GCCCTCCATAGACACATCTGT Srebf2 NM_ GTGGGAGAGTTCCCTGATTTG CTCCACCATTGTTGCCTCTG Vldlr NM_ AGACCAATCAGACGAGTCTCTT CTGCCGTCCTTGCAGTCAG 14
15 Abbreviations PFAAs, perfluoroalkyl acids PFOA, perfluorooctanoic acid TCHO, total cholesterol TG, triglyceride 18S, 18S ribosomal RNA Acox1, acyl-coenzyme A oxidase 1, palmitoyl Aldob, aldolase B, fructose-bisphosphate Apoa4, apolipoprotein A-IV Apoc3, apolipoprotein C-III CAR, constitutive active receptor Cpt1a, carnitine palmitoyltransferase 1a, liver Cyp1a2, cytochrome P450, family 1, subfamily a, polypeptide 2 Cyp4a10, cytochrome P450, family 4, subfamily a, polypeptide 10 Cyp7a1, cytochrome P450, family 7, subfamily a, polypeptide 1 Dbi (Acbp), diazepam binding inhibitor Fabp1, fatty acid binding protein 1, liver Fasn, fatty acid synthase Fbxw7, F-box and WD-40 domain protein 7 FXR, farnesoid X receptor Hmgcr, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase Hmgcs1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 Hmgcs2, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 Hnf4a, hepatic nuclear factor 4, alpha Insig1, insulin induced gene 1 Insig2, insulin induced gene 2 Ldlr, low density lipoprotein receptor Lpl, lipoprotein lipase LXR, liver X receptor Pck1(Pepck), phosphoenolpyruvate carboxykinase 1, cytosolic Pklr(L-pk), pyruvate kinase liver and red blood cell Ppar-a, peroxisome proliferator activated receptor alpha Ppar-d, peroxisome proliferator activator receptor delta Ppar-g, peroxisome proliferator activated receptor gamma PXR, pregnane X receptor RXR, retinoid X receptors Scap, SREBF chaperone Scd1, stearoyl-coenzyme A desaturase 1 Srebf1, sterol regulatory element binding transcription factor 1 Srebf2, sterol regulatory element binding factor 2 Vldlr, very low density lipoprotein receptor 15
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationActivation of sterol regulatory element binding proteins in mice exposed to perfluorooctanoic acid for 28 days
Arch Toxicol (2015) 89:1569 1578 DOI 10.1007/s00204-014-1322-7 MOLECULAR TOXICOLOGY Activation of sterol regulatory element binding proteins in mice exposed to perfluorooctanoic acid for 28 days Shengmin
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More information1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
More informationSUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of
SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationOriginal Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells
Int J Clin Exp Pathol 2017;10(5):5039-5062 www.ijcep.com /ISSN:1936-2625/IJCEP0052419 Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationHuman Apolipoprotein A1 EIA Kit
A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationSupplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationLecithin Cholesterol Acyltransferase (LCAT) ELISA Kit
Product Manual Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Catalog Number STA-616 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol
More informationChemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,
More informationBMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice
SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana
More informationab SREBP-2 Translocation Assay Kit (Cell-Based)
ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic
More information2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
More informationSupporting Information
Supporting Information Chlorinated Polyfluorinated Ether Sulfonates Exhibit Higher Activity towards Peroxisome Proliferator-Activated Receptors Signaling Pathways than Perfluorooctane Sulfonate Chuan-Hai
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions.
ab139409 Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions. This product is for research use only and is not intended
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationProtocol for Western Blo
Protocol for Western Blo ng SDS-PAGE separa on 1. Make appropriate percentage of separa on gel according to the MW of target proteins. Related recommenda ons and rou ne recipes of separa on/stacking gels
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationElectronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Direct chemiluminescence detection of circulating
More informationSupplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationGladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of
More informationData Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002
Data Sheet PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 DESCRIPTION: The PCSK9[Biotinylated]-LDLR Binding Assay Kit is designed for screening and profiling purposes. PCSK9 is known to function
More informationEXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids
DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles
More informationEssential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in
Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing
More informationAnalysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
More informationAdvances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
More informationab65336 Triglyceride Quantification Assay Kit (Colorimetric/ Fluorometric)
Version 10 Last updated 19 December 2017 ab65336 Triglyceride Quantification Assay Kit (Colorimetric/ Fluorometric) For the measurement of triglycerides in various samples. This product is for research
More informationAnalyses of Intravesicular Exosomal Proteins Using a Nano-Plasmonic System
Supporting Information Analyses of Intravesicular Exosomal Proteins Using a Nano-Plasmonic System Jongmin Park 1, Hyungsoon Im 1.2, Seonki Hong 1, Cesar M. Castro 1,3, Ralph Weissleder 1,4, Hakho Lee 1,2
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationHuman LDL Receptor / LDLR ELISA Pair Set
Human LDL Receptor / LDLR ELISA Pair Set Catalog Number : SEK10231 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More informationMagCapture Exosome Isolation Kit PS Q&A
MagCapture Exosome Isolation Kit PS Q&A Specifications and performance P.1 Comparison of the conventional method P.2 Operation methods and composition P.4 Amount of starting sample P.5 Analysis after exosomes
More informationFor pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
More informationData Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002
Data Sheet PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 DESCRIPTION: The PCSK9[Biotinylated]-LDLR Binding Assay Kit is designed for screening and profiling purposes. PCSK9 is known to function
More informationSREBF2 Transcription Factor Assay Kit ( Cat # KA1379 V.01 ) 1
Background Lipid homeostasis in vertebrate cells is regulated by a family of transcription factors called sterol regulatory element binding proteins (SREBP s). SREBP s directly activate the expression
More informationData Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory
More informationEffect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis
212 66 4 329334 Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis a,c a* b b a a b a a b c 33 66 4 ʼ 6 6 6 28 6 5 5 5 28 45 ʼ ʼ ʼ
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationab Adipogenesis Assay Kit (Cell-Based)
ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended
More informationDefining the Role of Notch Signaling in Vascular Smooth Muscle Cell Differentiation. Honors Research Thesis
Defining the Role of Notch Signaling in Vascular Smooth Muscle Cell Differentiation Honors Research Thesis Presented in Fulfillment of the Requirements for graduation with research distinction at The Ohio
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Table S1. Primers and fluorescent probes used for qrt-pcr analysis of relative expression levels of PPP family phosphatases. gene name forward primer, 5-3 probe, 5-3 reverse primer,
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The
More informationSupplementary material: Materials and suppliers
Supplementary material: Materials and suppliers Electrophoresis consumables including tris-glycine, acrylamide, SDS buffer and Coomassie Brilliant Blue G-2 dye (CBB) were purchased from Ameresco (Solon,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 10.1038/NNANO.2012.80 Protein-Inorganic Hybrid Nanoflowers Jun Ge, Jiandu Lei, and Richard N. Zare Supporting Online Material Materials Proteins including albumin from bovine
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationProtein MultiColor Stable, Low Range
Product Name: DynaMarker Protein MultiColor Stable, Low Range Code No: DM670L Lot No: ******* Size: 200 μl x 3 (DM670 x 3) (120 mini-gel lanes) Storage: 4 C Stability: 12 months at 4 C Storage Buffer:
More informationSTUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS
STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS Xiannu Jin 1, Radharaman Ray 2, Guang Xu 1 and Prabhati Ray 1 1 Department
More informationDetermination of β2-agonists in Pork Using Agilent SampliQ SCX Solid-Phase Extraction Cartridges and Liquid Chromatography-Tandem Mass Spectrometry
Determination of β2-agonists in Pork Using Agilent SampliQ SCX Solid-Phase Extraction Cartridges and Liquid Chromatography-Tandem Mass Spectrometry Application Note Food Safety Authors Chenhao Zhai Agilent
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationSynthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Data Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationASSAY OF SPHINGOMYELINASE ACTIVITY
ASSAY OF SPHINGOMYELINASE ACTIVITY Protocol for Protein Extraction Stock Solution 1. Leupeptin/hydrochloride (FW 463.0,
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationLipoprotein Lipase Activity Assay Kit (Fluorometric)
Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General
More informationCholesterol determination using protein-templated fluorescent gold nanocluster probes
Electronic Supplementary Information for Cholesterol determination using protein-templated fluorescent gold nanocluster probes Xi Chen and Gary A. Baker* Department of Chemistry, University of Missouri-Columbia,
More informationSupplementary Figure 1. Method development.
Supplementary Figure 1 Method development. Titration experiments to determine standard antibody:lysate concentration. Lysates (~2 mg of total proteins) were prepared from cells expressing FLAG- tagged
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationPair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
More informationTotal Phosphatidic Acid Assay Kit
Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor
More informationJLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200
JLR Papers In Press. Published on October 16, 2003 as Manuscript D300024-JLR200 A method of direct measurement for the enzymatic determination of cholesterol esters Toshimi Mizoguchi 1, Toshiyuki Edano,
More informationEpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More information