Biomarkers of NAFLD progression an omics approach to an epidemic
|
|
- Jayson Barnett
- 5 years ago
- Views:
Transcription
1 Biomarkers of NAFLD progression an omics approach to an epidemic D. Lee Gorden 1,2, David S. Myers 3, Pavlina T. Ivanova 3, Eoin Fahy 4, Mano R. Maurya 4, Shakti Gupta 4, Jun Min 4, Nathanael J. Spann 5, Jeffrey G. McDonald 6, Samuel L. Kelly 7, Jingjing Duan 7, M. Cameron Sullards 7, Thomas J. Leiker 8, Robert M. Barkley 8, Oswald Quehenberger 9,10, Aaron M. Armando 10, Stephen B. Milne 3, Thomas P. Mathews 3, Michelle D. Armstrong 3, Chijun Li 11, Willie V. Melvin 1, Ronald H. Clements 1, M. Kay Washington 12, Alisha M. Mendonsa 2, Joseph L. Witztum 9, Ziqiang Guan 11, Christopher K. Glass 5, Robert C. Murphy 8, Edward A. Dennis 10,13, Alfred H. Merrill Jr. 7, David W. Russell 6, Shankar Subramaniam 4,13*, H. Alex Brown 3,14* 1 Department of Surgery, Vanderbilt University Medical Center, Nashville, TN, USA. 2 Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN, USA. 3 Department of Pharmacology, Vanderbilt University Medical Center, Nashville, TN, USA. 4 Department of Bioengineering, School of Engineering, University of California, San Diego, La Jolla, CA, USA. 5 Department of Cellular and Molecular Medicine and Department of Medicine, University of California, San Diego, La Jolla, CA, USA. 6 Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, TX, USA. 7 Schools of Biology, Chemistry, and Biochemistry, and the Parker H. Petit Institute for Bioengineering and Bioscience, Georgia Institute of Technology, Atlanta, GA, USA. 8 Department of Pharmacology, University of Colorado at Denver, Aurora, CO, USA. 9 Department of Medicine, School of Medicine, University of California, San Diego, La Jolla, CA, USA. 10 Department of Pharmacology, School of Medicine, University of California, San Diego, La Jolla, CA, USA. 11 Department of Biochemistry, Duke University Medical Center, Durham, NC, USA. 12 Departments of Pathology, Microbiology and Immunology, Vanderbilt University Medical Center, Nashville, TN, USA. 13 Department of Chemistry & Biochemistry, School of Medicine, University of California, San Diego, La Jolla, CA, USA. 14 Department of Biochemistry and the Vanderbilt Institute of Chemical Biology, Vanderbilt University Medical Center, Nashville, TN, USA. *To whom correspondence should be addressed: alex.brown@vanderbilt.edu; shankar@ucsd.edu Running Title: In search for NASH biomarkers
2 SUPPLEMENTARY MATERIALS Supplementary Figures Fig. S1. Plasma analytes participating in LDA-based discrimination between steatosis and NASH in Figure 5. Fig. S2. Lipid related genes by Ensembl ID. Fig. S3. Liver citric acid cycle and glycolysis pathways analytes with P<0.05 across histological categories. Fig. S4. Transcripts for collagen genes (COL1A1, COL1A2, COL3A1, COL4A4) consistently showed upregulation with disease progression. Fig. S5. Transcripts for interleukin IL1 (A), transforming growth factor beta 1 (TGF 1) (B), chemokine (C-C motif) ligand 2 (CCL2) (C), chemokine (C-X-C motif) ligand 1 (CXCL1) (D) and matrix metalloproteinase 9 (MMP9) (E) consistently showed upregulation with disease progression. MMP14 (F) also showed substantial upregulation between cirrhosis and other disease stages. Fig. S6. Comparison of log2 (fold-expression) levels between progressive disease states (columns: steatosis/normal; NASH/steatosis; cirrhosis/nash) for matrix metalloproteinase (MMP) related genes curated from the MMP module in WikiPathways. Fig. S7. LDA2 on plasma lipid data to classify NASH vs. steatosis samples. Supplementary Tables Table S1. Average lipid concentrations by class.
3 Table S2. Lipid metabolites with correlation coefficient r such that r >0.4 against transcripts for collagen genes when all normal, steatotic, and NASH patients are considered. Table S3. Single nucleotide polymorphisms with P<0.001 for steatosis vs.nash, assessed using PLINK. Table S4. Single nucleotide polymorphisms with P< for normal vs. cirrhosis, assessed using PLINK.
4 A B C D E F G H
5 I J K L M N O P
6 Q R S T Figure S1. Plasma analytes participating in LDA-based discrimination between steatosis and NASH in Figure 5. (A) PC(32:0), (B) PC(36:0e), (C) PC(36:1e), (D) PC(36:2e), (E) PE(36:3), (F) PI(32:1), (G) LPI(18:0), (H) LPI(20:4), (I) CE(22:6), (J) FA(20:2), (K) dolichol- 20, (L) 24,25- epoxycholesterol, (M) C14DH Cer, (N) C26:1DH HexCer, (O) C24:1DH deoxycer, (P) C26DH deoxycer, (Q) sphingosine, (R) F16BP, (S) phosphoglyceric acid- PGA, (T) adenosine monophosphate- AMP.
7 Figure S2. Lipid related genes by Ensembl ID.
8 A B C D E F Figure S3. Liver citric acid cycle and glycolysis pathways analytes with P<0.05 across histological categories. (A) Malate, (B) succinate, (C) citrate, (D) glutamate, (E) F16BP, (F) 6-phosphogluconate (6PG).
9 Figure S4. Transcripts for collagen genes (COL1A1, COL1A2, COL3A1, COL4A4) consistently showed upregulation with disease progression.
10 Figure S5: Transcripts for interleukin IL1β (A), transforming growth factor beta 1 (TGFβ1) (B), chemokine (C-C motif) ligand 2 (CCL2) (C), chemokine (C-X-C motif) ligand 1 (CXCL1) (D) and matrix metalloproteinase 9 (MMP9) (E) consistently showed upregulation with disease progression. MMP14 (F) also showed substantial upregulation between cirrhosis and other disease stages.
11 Figure S6. Comparison of log2 (fold-expression) levels between progressive disease states (columns: steatosis/normal; NASH/steatosis; cirrhosis/nash) for matrix metalloproteinase (MMP) related genes curated from the MMP module in WikiPathways. Differential expression of several MMP genes is present in the transition between steatosis and NASH, though the transcripts most upregulated in the transition to cirrhosis differs somewhat and includes several tissue inhibitor of metalloproteinease genes (TIMPs). When more than one transcript for a gene was detected, the one with the highest average abundance was used. Color key: values shaded red correspond to >1.5-fold differences, blue for <0.67-fold, and gray for transcripts not detected in the array. All genes had P<0.05 by ANOVA analysis except MMP1, MMP8, MMP15, MMP17, MMP21, and TCF20.
12 Figure S7. LDA2 on plasma lipid data to classify NASH vs. steatosis samples. Linear discriminant analysis is applied on top 30 plasma lipids (ANOVA-based) and then 20 lipids contributing most to the linear discriminant are identified (see Methods). Another LDA is applied on these 20 lipids. Good separation is achieved (see also Supplementary data file 5).
13 Average lipid concentrations by class. C: Cirrhosis, H: Steatohepatitis, S: Steatosis, N: Normal Source Lipid Class Subclass Average Units SEM Phenotype Liver CE Cholesteryl esters pmol/mg C Liver CE Cholesteryl esters pmol/mg H Liver CE Cholesteryl esters pmol/mg N Liver CE Cholesteryl esters pmol/mg S Liver CL Cardiolipins pmol/mg 7.20 C Liver CL Cardiolipins pmol/mg 8.43 H Liver CL Cardiolipins pmol/mg 8.06 N Liver CL Cardiolipins pmol/mg S Liver DG 1,2 DGs pmol/mg C Liver DG 1,2 DGs pmol/mg H Liver DG 1,2 DGs pmol/mg N Liver DG 1,2 DGs pmol/mg S Liver EM Eicosanoids 5.82 pmol/mg 0.98 C Liver EM Eicosanoids 6.08 pmol/mg 1.13 H Liver EM Eicosanoids 7.22 pmol/mg 0.99 N Liver EM Eicosanoids 6.32 pmol/mg 1.70 S Liver EM Fatty acids pmol/mg C Liver EM Fatty acids pmol/mg H Liver EM Fatty acids pmol/mg N Liver EM Fatty acids pmol/mg S Liver GP acyl PA pmol/mg C Liver GP acyl PA pmol/mg H Liver GP acyl PA pmol/mg N Liver GP acyl PA pmol/mg S Liver GP acyl PE pmol/mg C Liver GP acyl PE pmol/mg H Liver GP acyl PE pmol/mg N Liver GP acyl PE pmol/mg S Liver GP acyl PG pmol/mg 3.37 C Liver GP acyl PG pmol/mg 4.81 H Liver GP acyl PG pmol/mg 4.45 N Liver GP acyl PG pmol/mg 6.87 S Liver GP acyl PS pmol/mg C Liver GP acyl PS pmol/mg H Liver GP acyl PS pmol/mg N Liver GP acyl PS pmol/mg S Liver GP acyl PC pmol/mg C Liver GP acyl PC pmol/mg H Liver GP acyl PC pmol/mg N Liver GP acyl PC pmol/mg S Liver GP alkyl PE pmol/mg C Liver GP alkyl PE pmol/mg H Liver GP alkyl PE pmol/mg N Liver GP alkyl PE pmol/mg S Liver GP alkyl PC pmol/mg C Liver GP alkyl PC pmol/mg H Liver GP alkyl PC pmol/mg N Liver GP alkyl PC pmol/mg S Liver GP BMP pmol/mg C Liver GP BMP pmol/mg H Liver GP BMP pmol/mg N Liver GP BMP pmol/mg S Liver GP Lyso PC pmol/mg C Liver GP Lyso PC pmol/mg 9.16 H Liver GP Lyso PC pmol/mg N Liver GP Lyso PC pmol/mg S Liver GP Lyso PE pmol/mg C Liver GP Lyso PE pmol/mg H
14 Liver GP Lyso PE pmol/mg N Liver GP Lyso PE pmol/mg S Liver GP Lyso PG pmol/mg 5.20 C Liver GP Lyso PG pmol/mg H Liver GP Lyso PG pmol/mg N Liver GP Lyso PG pmol/mg S Liver GP Lyso PI pmol/mg 2.75 C Liver GP Lyso PI pmol/mg 5.98 H Liver GP Lyso PI pmol/mg 5.64 N Liver GP Lyso PI pmol/mg S Liver PR CoQs pmol/mg C Liver PR CoQs pmol/mg H Liver PR CoQs pmol/mg N Liver PR CoQs pmol/mg S Liver PR Dolichols pmol/mg 8.30 C Liver PR Dolichols pmol/mg H Liver PR Dolichols pmol/mg N Liver PR Dolichols pmol/mg S Liver SP Ceramides pmol/mg 8.83 C Liver SP Ceramides pmol/mg 8.96 H Liver SP Ceramides pmol/mg N Liver SP Ceramides pmol/mg S Liver SP DeoxyCeramides 2.47 pmol/mg 0.33 C Liver SP DeoxyCeramides 4.45 pmol/mg 0.47 H Liver SP DeoxyCeramides 2.69 pmol/mg 0.26 N Liver SP DeoxyCeramides 3.98 pmol/mg 0.92 S Liver SP Dihydro ceramides 2.87 pmol/mg 0.33 C Liver SP Dihydro ceramides 3.43 pmol/mg 0.28 H Liver SP Dihydro ceramides 2.98 pmol/mg 0.37 N Liver SP Dihydro ceramides 2.69 pmol/mg 0.27 S Liver SP Dihydro DeoxyCeramides 0.70 pmol/mg 0.11 C Liver SP Dihydro DeoxyCeramides 2.48 pmol/mg 0.39 H Liver SP Dihydro DeoxyCeramides 1.58 pmol/mg 0.27 N Liver SP Dihydro DeoxyCeramides 1.62 pmol/mg 0.37 S Liver SP Dihydro hexosylceramides 0.61 pmol/mg 0.11 C Liver SP Dihydro hexosylceramides 0.62 pmol/mg 0.15 H Liver SP Dihydro hexosylceramides 0.71 pmol/mg 0.19 N Liver SP Dihydro hexosylceramides 0.40 pmol/mg 0.08 S Liver SP Dihydro sphingomyelins pmol/mg 5.57 C Liver SP Dihydro sphingomyelins pmol/mg 4.89 H Liver SP Dihydro sphingomyelins pmol/mg 8.39 N Liver SP Dihydro sphingomyelins pmol/mg 6.25 S Liver SP GalactosylCeramides 0.67 pmol/mg 0.07 C Liver SP GalactosylCeramides 0.64 pmol/mg 0.06 H Liver SP GalactosylCeramides 0.72 pmol/mg 0.06 N Liver SP GalactosylCeramides 0.77 pmol/mg 0.09 S Liver SP GlcucosylCeramides pmol/mg 1.84 C Liver SP GlcucosylCeramides pmol/mg 2.73 H Liver SP GlcucosylCeramides pmol/mg 1.66 N Liver SP GlcucosylCeramides pmol/mg 1.77 S Liver SP Hexosyl ceramides pmol/mg 1.85 C Liver SP Hexosyl ceramides pmol/mg 2.73 H Liver SP Hexosyl ceramides pmol/mg 1.71 N Liver SP Hexosyl ceramides pmol/mg 1.77 S Liver SP Long chain bases pmol/mg 2.38 C Liver SP Long chain bases pmol/mg 6.31 H Liver SP Long chain bases pmol/mg 3.26 N Liver SP Long chain bases pmol/mg 6.67 S Liver SP Sphingomyelins pmol/mg C Liver SP Sphingomyelins pmol/mg H Liver SP Sphingomyelins pmol/mg N Liver SP Sphingomyelins pmol/mg S
15 Liver ST Sterols nmol/mg C Liver ST Sterols nmol/mg H Liver ST Sterols nmol/mg 8.32 N Liver ST Sterols nmol/mg S Liver TG TGs pmol/mg C Liver TG TGs pmol/mg H Liver TG TGs pmol/mg N Liver TG TGs pmol/mg S Plasma CE Cholesteryl esters nmol/ml C Plasma CE Cholesteryl esters nmol/ml H Plasma CE Cholesteryl esters nmol/ml N Plasma CE Cholesteryl esters nmol/ml S Plasma DG 1,2 DGs nmol/ml 3.55 C Plasma DG 1,2 DGs nmol/ml H Plasma DG 1,2 DGs nmol/ml 9.32 N Plasma DG 1,2 DGs nmol/ml S Plasma EM Eicosanoids pmol/ml C Plasma EM Eicosanoids pmol/ml H Plasma EM Eicosanoids pmol/ml N Plasma EM Eicosanoids pmol/ml S Plasma EM Fatty acids pmol/ml C Plasma EM Fatty acids pmol/ml H Plasma EM Fatty acids pmol/ml N Plasma EM Fatty acids pmol/ml S Plasma GP acyl PA pmol/ml C Plasma GP acyl PA pmol/ml H Plasma GP acyl PA pmol/ml N Plasma GP acyl PA pmol/ml S Plasma GP acyl PE pmol/ml C Plasma GP acyl PE pmol/ml H Plasma GP acyl PE pmol/ml N Plasma GP acyl PE pmol/ml S Plasma GP acyl PC pmol/ml C Plasma GP acyl PC pmol/ml H Plasma GP acyl PC pmol/ml N Plasma GP acyl PC pmol/ml S Plasma GP alkyl PE pmol/ml C Plasma GP alkyl PE pmol/ml H Plasma GP alkyl PE pmol/ml N Plasma GP alkyl PE pmol/ml S Plasma GP alkyl PC pmol/ml C Plasma GP alkyl PC pmol/ml H Plasma GP alkyl PC pmol/ml N Plasma GP alkyl PC pmol/ml S Plasma GP Lyso PC pmol/ml C Plasma GP Lyso PC pmol/ml H Plasma GP Lyso PC pmol/ml N Plasma GP Lyso PC pmol/ml S Plasma GP Lyso PE pmol/ml C Plasma GP Lyso PE pmol/ml H Plasma GP Lyso PE pmol/ml N Plasma GP Lyso PE pmol/ml S Plasma GP Lyso PI pmol/ml C Plasma GP Lyso PI pmol/ml H Plasma GP Lyso PI pmol/ml N Plasma GP Lyso PI pmol/ml S Plasma PR CoQs pmol/ml C Plasma PR CoQs pmol/ml H Plasma PR CoQs pmol/ml N Plasma PR CoQs pmol/ml S Plasma PR Dolichols pmol/ml 2.13 C Plasma PR Dolichols pmol/ml 1.78 H
16 Plasma PR Dolichols pmol/ml 1.61 N Plasma PR Dolichols pmol/ml 2.06 S Plasma SP Ceramides pmol/ml C Plasma SP Ceramides pmol/ml H Plasma SP Ceramides pmol/ml N Plasma SP Ceramides pmol/ml S Plasma SP DeoxyCeramides pmol/ml 9.18 C Plasma SP DeoxyCeramides pmol/ml H Plasma SP DeoxyCeramides pmol/ml N Plasma SP DeoxyCeramides pmol/ml S Plasma SP Dihydro ceramides pmol/ml 4.74 C Plasma SP Dihydro ceramides pmol/ml 8.28 H Plasma SP Dihydro ceramides pmol/ml 4.92 N Plasma SP Dihydro ceramides pmol/ml 6.54 S Plasma SP Dihydro DeoxyCeramides pmol/ml 3.94 C Plasma SP Dihydro DeoxyCeramides pmol/ml H Plasma SP Dihydro DeoxyCeramides pmol/ml N Plasma SP Dihydro DeoxyCeramides pmol/ml 7.54 S Plasma SP Dihydro hexosylceramides pmol/ml 3.22 C Plasma SP Dihydro hexosylceramides pmol/ml 1.96 H Plasma SP Dihydro hexosylceramides pmol/ml 1.45 N Plasma SP Dihydro hexosylceramides pmol/ml 1.69 S Plasma SP Dihydro sphingomyelins pmol/ml C Plasma SP Dihydro sphingomyelins pmol/ml H Plasma SP Dihydro sphingomyelins pmol/ml N Plasma SP Dihydro sphingomyelins pmol/ml S Plasma SP GalactosylCeramides pmol/ml 8.66 C Plasma SP GalactosylCeramides pmol/ml H Plasma SP GalactosylCeramides pmol/ml N Plasma SP GalactosylCeramides pmol/ml S Plasma SP GlcucosylCeramides pmol/ml C Plasma SP GlcucosylCeramides pmol/ml H Plasma SP GlcucosylCeramides pmol/ml N Plasma SP GlcucosylCeramides pmol/ml S Plasma SP Hexosyl ceramides pmol/ml C Plasma SP Hexosyl ceramides pmol/ml H Plasma SP Hexosyl ceramides pmol/ml N Plasma SP Hexosyl ceramides pmol/ml S Plasma SP Long chain bases pmol/ml C Plasma SP Long chain bases pmol/ml H Plasma SP Long chain bases pmol/ml N Plasma SP Long chain bases pmol/ml S Plasma SP Sphingomyelins pmol/ml C Plasma SP Sphingomyelins pmol/ml H Plasma SP Sphingomyelins pmol/ml N Plasma SP Sphingomyelins pmol/ml S Plasma ST Sterols pmol/ml C Plasma ST Sterols pmol/ml H Plasma ST Sterols pmol/ml N Plasma ST Sterols pmol/ml S Plasma TG TGs nmol/ml C Plasma TG TGs nmol/ml H Plasma TG TGs nmol/ml N Plasma TG TGs nmol/ml S Urine CE Cholesteryl esters pmol/ml C Urine CE Cholesteryl esters pmol/ml H Urine CE Cholesteryl esters pmol/ml N Urine CE Cholesteryl esters pmol/ml S Urine DG 1,2 DGs pmol/ml 2.33 C Urine DG 1,2 DGs pmol/ml H Urine DG 1,2 DGs pmol/ml N Urine DG 1,2 DGs pmol/ml S
17 Urine EM Eicosanoids pmol/ml C Urine EM Eicosanoids pmol/ml H Urine EM Eicosanoids pmol/ml N Urine EM Eicosanoids pmol/ml S Urine PR CoQs pmol/ml C Urine PR CoQs pmol/ml H Urine PR CoQs pmol/ml N Urine PR CoQs pmol/ml S Urine PR Dolichols pmol/ml 6.36 C Urine PR Dolichols pmol/ml 7.12 H Urine PR Dolichols pmol/ml 5.31 N Urine PR Dolichols pmol/ml S Urine SP Ceramides pmol/ml C Urine SP Ceramides pmol/ml 5.58 H Urine SP Ceramides pmol/ml N Urine SP Ceramides pmol/ml S Urine SP Deoxyceramides 0.57 pmol/ml 0.06 C Urine SP Deoxyceramides 0.46 pmol/ml 0.04 H Urine SP Deoxyceramides 0.52 pmol/ml 0.05 N Urine SP Deoxyceramides 0.64 pmol/ml 0.15 S Urine SP Dihydro ceramides 4.03 pmol/ml 0.48 C Urine SP Dihydro ceramides 4.75 pmol/ml 0.71 H Urine SP Dihydro ceramides 5.62 pmol/ml 0.69 N Urine SP Dihydro ceramides pmol/ml S Urine SP Dihydro deoxyceramides 0.67 pmol/ml 0.06 C Urine SP Dihydro deoxyceramides 0.81 pmol/ml 0.07 H Urine SP Dihydro deoxyceramides 0.92 pmol/ml 0.07 N Urine SP Dihydro deoxyceramides 1.02 pmol/ml 0.18 S Urine SP Dihydro hexosylceramides 2.07 pmol/ml 0.35 C Urine SP Dihydro hexosylceramides 1.95 pmol/ml 0.33 H Urine SP Dihydro hexosylceramides 2.40 pmol/ml 0.36 N Urine SP Dihydro hexosylceramides 2.55 pmol/ml 0.43 S Urine SP Dihydro sphingomyelins pmol/ml 8.95 C Urine SP Dihydro sphingomyelins pmol/ml 4.98 H Urine SP Dihydro sphingomyelins pmol/ml 7.53 N Urine SP Dihydro sphingomyelins pmol/ml S Urine SP Galactosylceramides 4.19 pmol/ml 1.51 C Urine SP Galactosylceramides 3.93 pmol/ml 0.57 H Urine SP Galactosylceramides 2.95 pmol/ml 0.52 N Urine SP Galactosylceramides 5.50 pmol/ml 2.35 S Urine SP Glcucosylceramides 5.38 pmol/ml 2.77 C Urine SP Glcucosylceramides 1.86 pmol/ml 0.21 H Urine SP Glcucosylceramides 2.19 pmol/ml 0.41 N Urine SP Glcucosylceramides 2.53 pmol/ml 0.69 S Urine SP Hexosyl ceramides pmol/ml C Urine SP Hexosyl ceramides pmol/ml 2.38 H Urine SP Hexosyl ceramides pmol/ml 4.22 N Urine SP Hexosyl ceramides pmol/ml 8.26 S Urine SP Long chain bases pmol/ml 3.28 C Urine SP Long chain bases pmol/ml 8.39 H Urine SP Long chain bases pmol/ml 5.73 N Urine SP Long chain bases pmol/ml S Urine SP Sphingomyelins pmol/ml C Urine SP Sphingomyelins pmol/ml H Urine SP Sphingomyelins pmol/ml N Urine SP Sphingomyelins pmol/ml S Urine TG TGs pmol/ml 6.55 C Urine TG TGs pmol/ml H Urine TG TGs pmol/ml N Urine TG TGs pmol/ml S
18 Table S2. Lipid metabolites with correlation coefficient r such that r >0.4 against transcripts for collagen genes when all normal, steatotic, and NASH patients are considered. When more than one transcript for a gene was detected, the one with the lowest p-value across categories was used. P=0.05 is reached for r > 0.2. crosscorrelation: COL1A1 COL1A2 COL3A1 COL4A1 COL4A2 COL4A4 COL4A6 COL5A1 COL5A2 COL5A3 COL6A2 COL6A3 COL6A6 COL11A1 COL11A2 6k PGE ,15 dk-,dh- PGF1a dhk PGF2a HETE HETrE oxoETE oxoETE ,15-EET FA(20:3 N3) FA(22:1) FA(22:2) CL (74:7) Dolichol Dolichol Dolichol Dolichol Cholestanol CE(18:3) CE(18:2) CE(18:1) CE(20:4) CE(20:3) CE(20:1) CE(22:6) CE(22:5) TAG(48:3) TAG(50:5) TAG(50:4) TAG(56:1) TAG(58:2) TAG(58:1) TAG(60:3) C22 Cer C24 Cer C16DH HexCer C16DH Sphingomyelin C26:1 GalCer PA(36:4) PA(40:6) PC(36:4) PC(38:5e) PE(32:1) PE(36:4p) PE(40:6) PI(38:4) PS(40:6)
19 Table S3. Single nucleotide polymorphisms with P<0.001 for steatosis vs. NASH, assessed using PLINK. SNP Gene P-value Odds ratio Alleles [WT/ mutation] Mutation information rs PIK3C2B 1.26E [A/G] Synonymous_N1198N rs ZNF E [A/G] Missense_T301A rs KATNAL2 3.37E [A/C] Silent,Missense_C254F exm PEAR1 4.90E [A/G] Missense_R885H rs ZNF E [A/G] Missense_R387H rs EFHB 7.81E [A/C] Missense_G99V Missense_R777Q,Missense_R917 exm VARS2 9.35E [A/G] Q,Missense_R947Q
20 Table S4. Single nucleotide polymorphisms with P< for normal vs. cirrhosis, assessed using PLINK. SNP Gene P Odds Ratio Alleles Mutation rs PNPLA3 1.77E [C/G] Missense_I148M exm NUAK1 2.39E [C/G] Missense_P543R exm8127 AJAP1 2.68E [A/G] Missense_G263R rs ARHGAP E [A/G] Synonymous_R85R rs9482 ATF6 3.27E [A/G] Synonymous_S632S rs SAMM E [A/G] Missense_D110G
Biomarkers of NAFLD progression an omics approach to an epidemic
Biomarkers of NAFLD progression an omics approach to an epidemic D. Lee Gorden 1,2, David S. Myers 3, Pavlina T. Ivanova 3, Eoin Fahy 4, Mano R. Maurya 4, Shakti Gupta 4, Jun Min 4, Nathanael J. Spann
More informationBiomarkers of NAFLD progression: a lipidomics approach to an epidemic
Biomarkers of NAFLD progression: a lipidomics approach to an epidemic D. Lee Gorden 1,2, David S. Myers 3, Pavlina T. Ivanova 3, Eoin Fahy 4, Mano R. Maurya 4, Shakti Gupta 4, Jun Min 4, Nathanael J. Spann
More informationPoly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1
Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species
More informationSUPPORTING INFORMATION. Nontargeted quantitation of lipid classes using hydrophilic interaction liquid
SUPPORTING INFORMATION Nontargeted quantitation of lipid classes using hydrophilic interaction liquid chromatography - electrospray ionization mass spectrometry with single internal standard and response
More informationMetabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
More informationAnti-Inflammatory Effects of Fish Oils
Anti-Inflammatory Effects of Fish Oils A. Macrophage Production of Eicosanoids B. w-3 PUFA Supplementation of Macrophages C. w-3 PUFA in IR & diabetes Oswald Quehenberger Departments of Medicine and Pharmacology
More informationSupporting information
Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo
More informationSupplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification
Cell Systems, Volume 6 Supplemental Information LipiDex: An Integrated Software Package for High-Confidence Lipid Identification Paul D. Hutchins, Jason D. Russell, and Joshua J. Coon Figure S1. Omics
More informationPrinciples of Shotgun Lipidomics
Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition
More informationSelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics
ANSWERS FOR SCIENCE. KNOWLEDGE FOR LIFE. SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics Baljit Ubhi, Ph.D ASMS Baltimore, June 2014 Lipidomics Profiling Needs and Deliverables
More informationLC/MS Method for Comprehensive Analysis of Plasma Lipids
Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,
More informationLipid and Bile Acids as NAFLD- Related Biomarkers
Lipid and Bile Acids as NAFLD- Related Biomarkers Puneet Puri, MBBS, MD Division of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University, Richmond, VA 1st International Workshop
More informationThe use of mass spectrometry in lipidomics. Outlines
The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid
More informationLIPIDS Introduction - complex lipids. Marek Vecka
LIPIDS Introduction - complex lipids Marek Vecka CLASSIFICATION OF LIPIDS IV - biosynthetic route Lipid class Fatty acyls Glycerolipids Glycerophospholipids Sphingolipids Sterol lipids Prenol lipids Other
More informationMetabolomic fingerprinting of serum samples by direct infusion mass spectrometry
Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry Raúl González-Domínguez * Department of Chemistry, Faculty of Experimental Sciences. University of Huelva, Spain. * Corresponding
More informationSurface and Interface Analysis. Journal: Surface and Interface Analysis
Surface and Interface Analysis C 0 -SIMS Studies of Glycerophospholipid in a LIPID MAPS Model Cell Line: KDO -Lipid A Stimulated RAW. Cells Journal: Surface and Interface Analysis Manuscript ID: Draft
More informationThermo Scientific LipidSearch Software for Lipidomics Workflows. Automated Identification and Relative. Quantitation of Lipids by LC/MS
Thermo Scientific LipidSearch Software for Lipidomics Workflows Automated Identification and Relative of Lipids by LC/MS The promise of lipidomics Lipidomics is a new field of study crucial for understanding
More informationMass Spectrometry based metabolomics
Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationSupplemental Information. Genetic Regulation of Plasma Lipid Species. and Their Association with Metabolic Phenotypes
Cell Systems, Volume 6 Supplemental Information Genetic Regulation of Plasma Lipid Species and Their Association with Metabolic Phenotypes Pooja Jha, Molly T. McDevitt, Emina Halilbasic, Evan G. Williams,
More informationOverview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer
Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel
More information2018 Kern Lipid Conference
2018 Kern Lipid Conference Metabolic Regulation of Immunity, Cardiometabolic Diseases and Cancer: New Therapeutic Approaches Monday, August 13, 2018 to Wednesday, August 15, 2018 - Vail, Colorado Organizers:
More informationAnnotation of potential isobaric and isomeric lipid species analyzed using the MxP Quant 500 Kit
Annotation of potential isobaric and isomeric lipid species analyzed using the MxP Quant 500 Kit Introduction The MxP Quant 500 kit enables the analysis of up to 630 metabolites covering 26 compound classes
More informationSupplementary material
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Epithelial-to-mesenchymal transition involves triacylglycerol accumulation in DU145
More informationLoss of protein association causes cardiolipin degradation in Barth syndrome
SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas
More informationImpact of Chromatography on Lipid Profiling of Liver Tissue Extracts
Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More informationMetabolomics and systems biology approaches to study health and disease. Matej Oreši
Metabolomics and systems biology approaches to study health and disease Matej Oreši 14.12.2011 1/19/2012 2 Biomarker concept in domain of human health [Wikipedia definition] A substance used as an indicator
More informationDECLARATION OF CONFLICT OF INTEREST. None
DECLARATION OF CONFLICT OF INTEREST None Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J Meikle 1, Gerard Wong 1, Despina Tsorotes 1, Christopher K Barlow 1, Jacquelyn
More information2 nd International Workshop on NASH Biomarkers, Washington DC, May 5-6, 2017
Hepatic Proton Density Fat Fraction Correlates With Histologic Measures of Steatosis and Is Responsive to Changes in Those Measures in a Multi-center Nonalcoholic Steatohepatitis Clinical Trial Michael
More informationBig Data Training for Translational Omics Research. Session 1, Day 3, Liu. Case Study #2. PLOS Genetics DOI: /journal.pgen.
Session 1, Day 3, Liu Case Study #2 PLOS Genetics DOI:10.1371/journal.pgen.1005910 Enantiomer Mirror image Methadone Methadone Kreek, 1973, 1976 Methadone Maintenance Therapy Long-term use of Methadone
More informationSupplementary information
Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,
More informationALLOSTERIC REGULATION OF GPCR ACTIVITY BY PHOSPHOLIPIDS
Supplementary Information ALLOSTERIC REGULATION OF GPCR ACTIVITY BY PHOSPHOLIPIDS Rosie Dawaliby 1, Cataldo Trubbia 1, Cédric Delporte 3,4, Matthieu Masureel 2, Pierre Van Antwerpen 3,4, Brian K. Kobilka
More informationCEU MASS MEDIATOR USER'S MANUAL Version 2.0, 31 st July 2017
CEU MASS MEDIATOR USER'S MANUAL Version 2.0, 31 st July 2017 1. Introduction... 2 1.1. System Requirements... 2 2. Peak search... 3 2.1. Simple Search... 3 2.2. Advanced Search... 5 2.3. Batch Search...
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationspecial report Shorthand notation for lipid structures derived from mass spectrometry
special report Shorthand notation for lipid structures derived from mass spectrometry Gerhard Liebisch, 1, * Juan Antonio Vizcaíno, Harald Köfeler, ** Martin Trötzmüller, ** William J. Griffiths, Gerd
More informationIdentification of Lipidomic Biomarkers for Coexposure to Subtoxic Doses of Benzo[a]pyrene and Cadmium: The Toxicological Cascade Biomarker Approach
Supporting Information Identification of Lipidomic Biomarkers for Coexposure to Subtoxic Doses of Benzo[a]pyrene and Cadmium: The Toxicological Cascade Biomarker Approach Harald Jungnickel,*,1 Sarah Potratz,
More informationPerfluoroalkyl Acids (PFAAs) in Plasma of the West Indian Manatee (Trichechus manatus)
Perfluoroalkyl Acids (PFAAs) in Plasma of the West Indian Manatee (Trichechus manatus) 6 th Florida Marine Mammal Conference March 29, 2018 Orlando, Fl John A. Bowden National Institute of Standards and
More informationFatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation
Fatty Acid Degradation Chapter 27, Stryer Short Course Catabolism verview Lipids as a fuel source diet Beta oxidation saturated Unsaturated dd chain Ketone bodies as fuel Physiology High energy More reduced
More informationUnderstanding Root Cause: Pathogenesis of Hepatic Fibrosis
10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis
More informationPathway overview. Glucose + 2NAD + + 2ADP +2Pi 2NADH + 2pyruvate + 2ATP + 2H 2 O + 4H +
Glycolysis Glycolysis The conversion of glucose to pyruvate to yield 2ATP molecules 10 enzymatic steps Chemical interconversion steps Mechanisms of enzyme conversion and intermediates Energetics of conversions
More informationMS/MS analysis of plasma from AD patients and healthy volunteers (n=8 healthy volunteers
Figure S. PGFα, - and -HETE are elevated in of patients with Acute Decompensation (AD) when compared with healthy volunteers. (a-g) Lipidomic LC/ESI- MS/MS analysis of from AD patients and healthy volunteers
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature22359 Supplementary Discussion KRAS and regulate central carbon metabolism, including pathways supplied by abundant fuels like glucose and glutamine. Under control
More informationDiscovery of a Small Molecule Inhibitor of the Wnt Pathway as a Potential Disease Modifying Treatment for Knee Osteoarthritis
Discovery of a Small Molecule Inhibitor of the Wnt Pathway as a Potential Disease Modifying Treatment for Knee Osteoarthritis Charlene Barroga, Ph.D., Yong Hu, Ph.D., Vishal Deshmukh, Ph.D., and John Hood,
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationDengue Virus Infection Perturbs Lipid Homeostasis in Infected Mosquito Cells
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Biochemistry -- Faculty Publications Biochemistry, Department of 2012 Dengue Virus Infection Perturbs Lipid Homeostasis
More informationMaster class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
More informationMEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS
December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,
More informationSupplemental Information for: Localization of anionic phospholipids in Escherichia coli cells
Supplemental Information for: Localization of anionic phospholipids in Escherichia coli cells Piercen M. Oliver, a John A. Crooks, a Mathias Leidl, b Earl J. Yoon, a Alan Saghatelian, b and Douglas B.
More informationNONALCOHOLIC FATTY LIVER DISEASE
NONALCOHOLIC FATTY LIVER DISEASE Kiran Bambha, MD, MSc Hepatology and Liver Transplantation University of Colorado Denver April 13, 2012 Non-Alcoholic Fatty Liver Disease (NAFLD) Terminology Pathogenesis
More informationSummary of fatty acid synthesis
Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty
More informationBiological markers for abuse and addiction
Biological markers for abuse and addiction - Tomáš Zima Institute of Clinical Chemistry and Laboratory Diagnostic Charles University Denial is the feature of the alcoholism Patient s history. Family Psychologic
More informationThe Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
More informationAnnotation of potential isobaric and isomeric lipid species measured with the AbsoluteIDQ p180 Kit (and p150 Kit)
We provide the Phenotype to the Genotype! DocNr. 35017 V 2 2017-02 Annotation of potential isobaric and isomeric lipid species measured with the (and p150 Kit) Introduction Lipidomics, a branch of metabolomics
More informationObtaining Answers to Biological Questions Sample Prep to Data Analysis. Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS
Obtaining Answers to Biological Questions Sample Prep to Data Analysis Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS OMICS Research Why Quantitative OMICS? 2 2015 AB Sciex SCIEX
More informationLipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague
Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation
More informationchapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists.
chapter 1 - fig. 1 The -omics subdisciplines. chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists. 201 figures chapter 1 chapter 2 - fig. 1 Schematic overview of the different steps
More informationYun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
More informationDiseases to Watch. Non-Alcoholic Fatty Liver Disease (NAFLD) and Non-alcoholic
Diseases to Watch Non-Alcoholic Fatty Liver Disease (NAFLD) and Non-alcoholic steatohepatitis (NASH) - Prevalence and Symptoms - Risk Factors and Potential treatments - Target identification for NASH Robert
More informationNew Frontiers for MS in Metabolipidomics
New Frontiers for MS in Metabolipidomics Giuseppe Astarita, PhD Principal Scientist Discovery & Life Sciences Milford, MA USA 2011 Waters Corporation 1 Why Metabolipidomics? Biomedical Sciences o Biomarker
More informationChem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols
Chem 431A-L24-F'07 page 1 of 5 Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols (0) REVIEW: FA s are very reduced
More informationImaging of lipid species by MALDI mass spectrometry
Imaging of lipid species by MALDI mass spectrometry Robert C. Murphy, 1 Joseph A. Hankin, and Robert M. Barkley Department of Pharmacology, MS 8303 University of Colorado Denver, Aurora, CO 80045 Abstract
More informationLipid Biosynthesis. Craig Wheelock February 2nd, 2009 Questions? Comments?
Lipid Biosynthesis Craig Wheelock February 2nd, 2009 Questions? Comments? craig.wheelock@ki.se Why do we care about lipids? ~80% of European population overweight ~ 1/3 obese =130 million obese adults
More informationMass-Spectrometric Analysis of Lipids (Lipidomics)
Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:
More informationSupplementary Information. Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a
Supplementary Information Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a High-throughput Targeted Metabolomics Approach Nanyang Yu, Si Wei, *, Meiying Li, Jingping
More informationMASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES. Cassie J.
MASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES By Cassie J. Fhaner A DISSERTATION Submitted to Michigan State University in partial
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationSupplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
More informationConflicts of Interest in the last 12 months
STEATOHEPATITIS Richard K. Sterling, MD, MSc, FACP, FACG VCU Hepatology Professor of Medicine Chief, Section of Hepatology Virginia Commonwealth University Richmond, VA Conflicts of Interest in the last
More informationOXIDIZED LIPIDS FORMED NON-ENZYMATICALLY BY REACTIVE OXYGEN SPECIES
JBC Papers in Press. Published on February 19, 2008 as Manuscript R800006200 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.r800006200 OXIDIZED LIPIDS FORMED NON-ENZYMATICALLY BY REACTIVE
More informationSphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids, Phytosphingosines, Inhibitors, Agonists
Avanti Price List January 2015 Lipidomics Products Monoclonal Antibodies, Lipid Snoopers, Lipidomix Toolbox, MS Standards General Products Sphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids,
More informationNON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD) NON-ALCOHOLIC STEATOHEPATITIS (NASH) ADDRESSING A GROWING SILENT EPIDEMIC
NON-ALCOHOLIC FATTY LIVER DISEASE () & NON-ALCOHOLIC STEATOHEPATITIS () ADDRESSING A GROWING SILENT EPIDEMIC PREVALENCE OF / USA Prevalence in Middle Age Patients San Antonio, Texas (Williams et al., Gastroenterology
More informationFigure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
More informationSupplementary Material. Contents include:
Supplementary Material Contents include: 1. Supplementary Figures (p. 2-7) 2. Supplementary Figure Legends (p. 8-9) 3. Supplementary Tables (p. 10-12) 4. Supplementary Table Legends (p. 13) 1 Wellen_FigS1
More informationNon-Alcoholic Fatty Liver Diseasean underestimated epidemic
Non-Alcoholic Fatty Liver Diseasean underestimated epidemic Amir Shlomai MD,PhD Head, Department of Medicine D The Liver Institute Rabin Medical Center, Beilinson Hospital The IASLD semi-annual meeting-
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
More informationChapter 13 Carbohydrate Metabolism
Chapter 13 Carbohydrate Metabolism Metabolism of Foods Food is broken down into carbohydrates, lipids, and proteins and sent through catabolic pathways to produce energy. Glycolysis glucose 2 P i 2 ADP
More informationSphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids, Phytosphingosines, Inhibitors, Agonists
Avanti Price List January 2016 Lipidomics Products Monoclonal Antibodies, Lipid Snoopers, Lipidomix Toolbox, MS Standards General Products Sphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids,
More informationNON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD) NON-ALCOHOLIC STEATOHEPATITIS (NASH) ADDRESSING A GROWING SILENT EPIDEMIC
NON-ALCOHOLIC FATTY LIVER DISEASE () & NON-ALCOHOLIC STEATOHEPATITIS () ADDRESSING A GROWING SILENT EPIDEMIC PREVALENCE OF / USA Prevalence in Middle Age Patients San Antonio, Texas (Williams et al., Gastroenterology
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationEffects of genotype and environment on metabolite profiling of Nicotiana tabacum
Effects of genotype and environment on metabolite profiling of Nicotiana tabacum China Tobacco Gene Research Center Jingjing JIN 2017.10.23 Outline Background Method Result Conclusion 1 / 22 Genotype,
More informationMetabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
More informationBiomarkers for Personalized Medicine and Regenerative Therapy
Biomarkers for Personalized Medicine and Regenerative Therapy Bettina Heidecker, MD University of Miami Division of Cardiology Interdisciplinary Stem Cell Institute Biomarkers in Heart Failure Growing
More informationTable 1 Demographic data of PD-patients. Data are represented as counts or median and full range.
Table 1 Demographic data of PD-patients. Data are represented as counts or median and full range. Parameter Number Patients 5 Diabetes mellitus 0 Previous NTX 0 Steroids 0 Patients with residual renal
More informationSuppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More informationCore E Analysis of Neutral Lipids from Human Plasma June 4, 2010 Thomas J. Leiker and Robert M. Barkley
Core E Analysis of Neutral Lipids from Human Plasma June 4, 2010 Thomas J. Leiker and Robert M. Barkley This protocol describes the extraction and direct measurement of cholesterol esters (CEs) and triacylglycerols
More informationSupporting Information
Supporting Information Mass Spectrometry Imaging Shows Cocaine and Methylphenidate have Opposite Effects on Major Lipids in Drosophila Brain Mai H. Philipsen *, Nhu T. N. Phan *, John S. Fletcher *, Per
More informationEARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES
EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES JAMES M. ANDERSON, MD, PhD DISTINGUISHED UNIVERSITY PROFESSOR DEPARTMENTS OF PATHOLOGY, MACROMOLECULAR SCIENCE, AND BIOMEDICAL ENGINEERING CASE WESTERN
More informationLife Science and Chemical Analysis Solutions. Baljit Ubhi, Jeff Patrick, David Alonso, and Joe Shambaugh 1 2 3
Complementary LC- and GC- Mass Spectrometry Techniques Provide Broader Coverage of the Metabolome Cross-Platform Metabolomics Data Analysis Combining AB SCIEX LC/MS, LECO GC/MS, and Genedata Software 1
More informationLipid Analysis. Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th Introduction to lipid structures
Lipid Analysis Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th 2005 Introduction to lipid structures Fatty acids Acylglycerols Glycerophospholipids Sterols Strategies involved in lipid
More informationPCs Acyl chain double bonds. PEs
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Male/Female ratio Male/Female ratio PCs 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4 0 1 2
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationA Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids
A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids Jeremy Netto, 1 Stephen Wong, 1 Federico Torta, 2 Pradeep Narayanaswamy, 2
More information10/10/2015. Disclosure. Fatty Liver Disease Significance in Children
Mixed Lineage Kinase 3 Mediates Release of C-X-C Motif Ligand 10-earing Extracellular Vesicles from lipotoxic hepatocytes 10/10/2015 Samar H. Ibrahim, Petra Hirsova, Steven F. ronk, Nathan W. Werneburg,
More informationLarge-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention
Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Piyushkumar A. Mundra,, Peter J. Meikle, LIPID Study Investigators JCI Insight. 2018;3(17):e121326..
More informationASSOCIATION OF KCNJ1 VARIATION WITH CHANGE IN FASTING GLUCOSE AND NEW ONSET DIABETES DURING HCTZ TREATMENT
ONLINE SUPPLEMENT ASSOCIATION OF KCNJ1 VARIATION WITH CHANGE IN FASTING GLUCOSE AND NEW ONSET DIABETES DURING HCTZ TREATMENT Jason H Karnes, PharmD 1, Caitrin W McDonough, PhD 1, Yan Gong, PhD 1, Teresa
More informationSYLLABUS. Departmental Syllabus DEPARTMENTAL SYLLABUS DEPARTMENTAL SYLLABUS DEPARTMENTAL SYLLABUS DEPARTMENTAL SYLLABUS
SYLLABUS DATE OF LAST REVIEW: 05/2018 CIP CODE: 24.0101 SEMESTER: COURSE TITLE: COURSE NUMBER: Departmental Syllabus Biochemistry CHEM-0250 CREDIT HOURS: 4 INSTRUCTOR: OFFICE LOCATION: OFFICE HOURS: TELEPHONE:
More informationFibrosis is a highly conserved response to hepatic
NEW HORIZONS Hepatic Inflammation and Fibrosis: Functional Links and Key Pathways Ekihiro Seki 1,2 and Robert F. Schwabe 3,4 Inflammation is one of the most characteristic features of chronic liver disease
More informationPrimer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
More information