10/10/2015. Disclosure. Fatty Liver Disease Significance in Children
|
|
|
- Justin McCarthy
- 5 years ago
- Views:
Transcription
1 Mixed Lineage Kinase 3 Mediates Release of C-X-C Motif Ligand 10-earing Extracellular Vesicles from lipotoxic hepatocytes 10/10/2015 Samar H. Ibrahim, Petra Hirsova, Steven F. ronk, Nathan W. Werneburg, Stephen. Harrison, Val S. Goodfellow, Harmeet Malhi & Gregory J. Gores MFMER slide-1 Disclosure Nothing to disclose 2015 MFMER slide-2 Fatty Liver Disease Significance in Children public health problem Striking increase in prevalence The most common liver disease 10% (2.5 millions) of US teens have NFLD 1,2 3% have NSH 2 59% of adolescent undergoing bariatric surgery have NFLD 3 Rapid progression of NSH to cirrhosis in pediatric patients common cause of liver transplantation in adults 1 Welsh et al., J. Pediatr Schwimmer et al., Pediatrics Xanthakos et al, Gastroenterology MFMER slide-3 1
2 Mlk3 -/- Mice are Protected gainst Dietinduced Steatohepatitis Saturated Free Fatty cid Mixed Lineage Kinase (MLK) 3 c-jun N- terminal Kinase (JNK) WT: Wild Type, Mlk: Mixed Lineage Kinase FFC: High Fat, Fructose, and Cholesterol Liver Injury & Inflammation Han et al. Science 2013 Jaeschke et al. Mol Cell 2007 Ibrahim et al. Liver Int MFMER slide-4 Hypothesis mediates obesity-induced liver injury & inflammation in NSH by promoting hepatocyte release of chemotactic EVs. s 1. Do lipotoxic hepatocytes release extracellular vesicles (EVs) by an - dependent pathway 2. Do generated hepatocyte EVs contain chemokines and induce macrophage chemotaxis 3. Is hepatoprotection against NSH in Mlk3 -/- mice associated with a reduction of hepatocyte EV release Chemokine Rich Lipotoxic EVs Lipotoxic Insult Macrophage Chemotaxis 2015 MFMER slide-5 Do lipotoxic hepatocytes release EVs by an - dependent pathway Lipotoxicity Lysophosphatidylcholine (LPC, 20 µm) 1 Extracellular vesicles Isolation by ultracentrifugation Nanoparticle tracking analysis (NT) by Nanosight NS300 inhibition Genetic: Mlk3 -/- primary mouse hepatocytes (PMH) Pharmacological: inhibitors (URMC, CLF from Califia io Inc., San Diego, C) 1 Kakisaka et al. m J Physiol Gastrointest Liver Physiol MFMER slide-6 2
3 Lipotoxic s Release EVs by an -dependent Pathway EV, Fold change EV, % of LPC induced release * p<0.05, **p< MFMER slide-7 Is there chemotactic cargo in lipotoxic EVs Mass Spectrometry (MS) Collect EVs Mass Spectrometry ±LPC CXCL10 Western blot Immunogold-electron microscopy 2015 MFMER slide-8 CXCL10 Is Highly Enriched in Lipotoxic EVs in an -dependent Manner CXCL10-Immunogold-electron microscopy Veh-WT LPC-WT LPC- mlk3 -/ MFMER slide-9 3
4 Do EVs induce macrophage chemotaxis by a CXCL10- dependent mechanism Migration assay Modified oyden chamber 4-h 10 µm pore membrane Chemoattractant (EVs, CXCL10) Migrated macrophages 2015 MFMER slide-10 Lipotoxic EVs Induce Macrophage Chemotaxis in a CXCL10-dependent Manner Migrated macrophages, % ***p< MFMER slide-11 Is hepatoprotection against NSH in Mlk3 -/- mice associated with reduction in hepatocytes EVs release Mice: C57L/6J wild type and Mlk3 -/- mice Diet: FFC 1 & Chow diet for 6 months Plasma LT level measurement by a veterinary chemistry analyzer CXCL10 In mouse plasma EVs by ELIS 1 Charlton et al. m J Physiol Gastrointest Liver Physiol MFMER slide-12 4
5 Mlk3 -/- in a Dietary NSH Mouse Model Protects against Liver Injury by Reducing EV Release CXCL10 plasma EVs 60 * * LT (U/L) EVs CXCL10, pg/ml C 0 WT Mlk3 -/- WT Mlk3 -/- Chow FFC Macrophage marker * p<0.05, * *p<0.01, ***p< MFMER slide-13 Conclusion Lipotoxic Insult CXCL10 Rich Lipotoxic EVs Inhibitors (URMC & CLF Califia io Inc., San Diego, C) CXCR3 Macrophage Chemotaxis 2015 MFMER slide-14 cknowledgement Dr. Gores and laboratory members Center for Clinical and Translational Science (CCaTS), KL2 program Mayo Center for Cell Signaling in Gastroenterology, Pilot and Feasibility program Pediatric Gastroenterology Division 2015 MFMER slide-15 5
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Non-Alcoholic Fatty Liver Disease
Non-Alcoholic Fatty Liver Disease None Disclosures Arslan Kahloon M.D Chief, Division of Gastroenterology and Hepatology University of Tennessee College of Medicine Chattanooga Objectives Understand the
Lipotoxic Lethal and Sublethal Stress Signaling in Hepatocytes: Relevance to NASH Pathogenesis
Lipotoxic Lethal and Sublethal Stress Signaling in Hepatocytes: Relevance to NASH Pathogenesis Petra Hirsova 1, Samar H. Ibrabim 2, Gregory J. Gores 1, Harmeet Malhi 1 1 Division of Gastroenterology and
Nonalcoholic Fatty Liver Disease in Children: Typical and Atypical
Nonalcoholic Fatty Liver Disease in Children: Typical and Atypical Disclosure Naim Alkhouri, MD discloses the following relationships with commercial companies: Membership in the Speakers Bureau for Alexion
Extracellular vesicles and ceramide: new mediators for macrophage chemotaxis? Natalie J. Torok
Extracellular vesicles and ceramide: new mediators for macrophage chemotaxis? Natalie J. Torok Department of Medicine, Gastroenterology and Hepatology, UC Davis, Sacramento, CA, and Northern California
Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST)
Jaemin Lee, Ph.D. Department of New Biology Daegu Gyeongbuk Institute of Science and Technology (DGIST) No Actual or Potential Conflict of Interest https://www.flickr.com/photos/luchoedu/2453267732/ 1985
Liver Disease NASH/Fibrosis Model
Liver Disease NASH/Fibrosis Model Please contact: Dipti Deshpande PhD ddeshpande@woodlandpharma.com or Carol Gebert PhD cgebert@woodlandbiosciences.com 617-513-5280 Liver Diseases Comprise a Growing Market
Intercellular communication is vital for multicellular
AMERICAN ASSOCIATION FOR THE STUDY OFLIVERD I S E ASES REVIEW HEPATOLOGY, VOL. 64, NO. 6, 2016 Extracellular Vesicles in Liver Pathobiology: Small Particles With Big Impact Petra Hirsova, 1 Samar H. Ibrahim,
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
Novel multiparametric magnetic resonance elastography (MRE) protocol accurately predicts NAS score for NASH diagnosis
Novel multiparametric magnetic resonance elastography (MRE) protocol accurately predicts NAS score for NASH diagnosis Alina M. Allen, Meng Yin, Sudhakar K. Venkatesh, Taofic Mounajjed, Todd A. Kellogg,
Examination of the Regulation of CXCL10 Expression, and CXCL10 DNA Sequence Variation and Disease Associations
Examination of the Regulation of CXCL10 Expression, and CXCL10 DNA Sequence Variation and Disease Associations Hayriye Senturk Ciftci, 1 Meltem Savran Karadeniz 1, Fatma Savran Oguz 1, Mehmet Tevfik Dorak
PEDIATRIC FOIE GRAS: NON-ALCOHOLIC FATTY LIVER DISEASE
PEDIATRIC FOIE GRAS: NON-ALCOHOLIC FATTY LIVER DISEASE Updates on New insights into NAFLD and NASH pathophysiology New AASLD/AGA/ACG guidelines for NAFLD and NASH, as pertains to pediatrics Evidence-based
Cell Death in Biology and Diseases
Cell Death in Biology and Diseases Series Editors Xiao-Ming Yin Zheng Dong More information about this series at http://www.springer.com/series/8908 Wen-Xing Ding Xiao-Ming Yin Editors Cellular Injury
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
removed replaced inflammation scar tissue
HOMEOSTASIS Normal maintenance and renewal of differentiated cells in many tissues This does NOT involve leukocytes. Leukocytes and inflammation occurs in response to damage NEED FOR REPAIR When tissue
Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
Evercore ISI Presentation- Madrigal
Evercore ISI Presentation- Madrigal Forward-Looking Statements Any statements, other than statements of historical facts, made in this presentation regarding our clinical studies and our research and development
Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016.
Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016. Outline Definition NAFLD and NASH Magnitude of the problem
CDHNF & NASPGHAN A Partnership for Research and Education for Children s Digestive and Nutritional Health
CDHNF & NASPGHAN A Partnership for Research and Education for Children s Digestive and Nutritional Health Obesity and NAFLD Definitions: Nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Tissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
Forward-looking Statements
NASDAQ:CNAT Forward-looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained in this presentation, including statements
Pathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
Improving Access to Quality Medical Care Webinar Series
Improving Access to Quality Medical Care Webinar Series Presented by The Arizona Telemedicine Program and the Southwest Telehealth Resource Center 2015 UA Board of Regents Welcome AZ, UT, CO, NM & NV FLEX
Supplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
The role of Hepatitis C Virus in hepatocarcinogenesis
The role of Hepatitis C Virus in hepatocarcinogenesis Laura Beretta Fred Hutchinson Cancer Research Center l8 Incidence and mortality of the five most common cancers worldwide, 2000 Incidence Lung Breast
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
NON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD) NON-ALCOHOLIC STEATOHEPATITIS (NASH) ADDRESSING A GROWING SILENT EPIDEMIC
NON-ALCOHOLIC FATTY LIVER DISEASE () & NON-ALCOHOLIC STEATOHEPATITIS () ADDRESSING A GROWING SILENT EPIDEMIC PREVALENCE OF / USA Prevalence in Middle Age Patients San Antonio, Texas (Williams et al., Gastroenterology
NON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD) NON-ALCOHOLIC STEATOHEPATITIS (NASH) ADDRESSING A GROWING SILENT EPIDEMIC
NON-ALCOHOLIC FATTY LIVER DISEASE () & NON-ALCOHOLIC STEATOHEPATITIS () ADDRESSING A GROWING SILENT EPIDEMIC PREVALENCE OF / USA Prevalence in Middle Age Patients San Antonio, Texas (Williams et al., Gastroenterology
Improving the Lives of Patients with Liver Diseases
Improving the Lives of Patients with Liver Diseases Corporate Presentation March 2019 Safe Harbor Statement This presentation contains "forward-looking" statements that involve risks, uncertainties and
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
Navneet K. Dhillon, Ph.D. Division of Pulmonary and Critical Care University of Kansas Medical Center
Navneet K. Dhillon, Ph.D. Division of Pulmonary and Critical Care University of Kansas Medical Center About 37 million people living with HIV/AIDS worldwide HIV-Related Cardio-pulmonary complications Chronic
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
Disclosures. The Typical Therapeutic Pyramid $$$ The NAFLD Umbrella. The Big Question: What are the treatment options for NASH?
Disclosures I have the following relationships to disclose: Ethicon Endo Surgery Inc. Galectin Therapeutics Synageva Biopharma Raptor Pharmaceuticals I will be discussing off label use of medications in
STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation
ORIGINAL ARTICLE STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation Anca D. Dobrian, 1 Elena V. Galkina, 2 Qian Ma, 1 Margaret Hatcher, 1 Sabai Myo Aye, 1 Mathew
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
NAFLD & NASH: Russian perspective
NAFLD & NASH: Russian perspective Vasily Isakov, MD, PhD Professor, Chief, Department Gastroenterology & Hepatology, Federal Research Center of nutrition, biotechnology and food safety Disclosures Received
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
University of California, San Diego La Jolla CA 92093
AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University
Challenges in the Diagnosis of Steatohepatitis
The Bugaboos of Fatty Liver Disease: Ballooning and Fibrosis Hans Popper Hepatopathology Society Companion Meeting San Antonio, Tx March, 2017 David Kleiner, M.D., Ph.D. NCI/Laboratory of Pathology Challenges
Nonalcoholic fatty liver disease (NAFLD) is the most common
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2008;6:1249 1254 Cytokeratin 18 Fragment Levels as a Noninvasive Biomarker for Nonalcoholic Steatohepatitis in Bariatric Surgery Patients DIMA L. DIAB,* LISA YERIAN,
Case Presentation. Mary Beth Patterson, MD Harbor-UCLA Medical Center February 23, 2010
Case Presentation Mary Beth Patterson, MD Harbor-UCLA Medical Center February 23, 2010 Case HPI: 4 yo female with PMHx of obesity sent to ED from clinic with BS of 353. Pt. has had polyuria for the past
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
Laboratory analysis of the obese child recommendations and discussion. MacKenzi Hillard May 4, 2011
Laboratory analysis of the obese child recommendations and discussion MacKenzi Hillard May 4, 2011 aka: What to do with Fasting Labs The Obesity Epidemic The prevalence of obesity in adolescents has tripled
Microglia-derived extracellular vesicles regulate the proliferation and differentiation of oligodendrocyte precursor cells
University of Turin CNR Institute of Neuroscience Microglia-derived extracellular vesicles regulate the proliferation and differentiation of oligodendrocyte precursor cells Roberta Parolisi Turin, December
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
FATTY LIVER DISEASE (NAFLD) (NASH) A GROWING
NON ALCOHOLIC FATTY LIVER DISEASE () & NON ALCOHOLIC S T E ATO H E PAT I T I S () ADDRESSING A GROWING SILENT EPIDEMIC Prevalence of & USA Prevalence in Middle Age Patients San Antonio, Texas (Williams
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway
Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
Non-Alcoholic Fatty Liver Disease
Non-Alcoholic Fatty Liver Disease Information for patients and families Read this information to learn: what non-alcoholic fatty liver disease is what causes it how it s treated how to prevent it where
Non-Alcoholic Fatty Liver Diseasean underestimated epidemic
Non-Alcoholic Fatty Liver Diseasean underestimated epidemic Amir Shlomai MD,PhD Head, Department of Medicine D The Liver Institute Rabin Medical Center, Beilinson Hospital The IASLD semi-annual meeting-
USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH. Eva Colás Ortega Postdoc researcher IRBLleida
USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH Eva Colás Ortega Postdoc researcher IRBLleida ecolas@irblleida.cat THERE ARE DIFFERENT TYPE OF VESICLES RELEASED BY CELLS MICROVESICLES Size: 100-1000nm
NON-ALCOHOLIC FATTY LIVER DISEASE:
NON-ALCOHOLIC FATTY LIVER DISEASE: ROLE OF THE PRIMARY PROVIDER Archita P. Desai, MD Assistant Professor of Medicine University of Arizona 25 th Annual Southwestern Conference on Medicine Outline Pathophysiology
NON-ALCOHOLIC STEATOHEPATITIS AND NON-ALCOHOLIC FATTY LIVER DISEASES
NON-ALCOHOLIC STEATOHEPATITIS AND NON-ALCOHOLIC FATTY LIVER DISEASES Preface Zobair M. Younossi xiii Epidemiology and Natural History of NAFLD and NASH 1 Janus P. Ong and Zobair M. Younossi Understanding
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results
Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
PREVALENCE OF NAFLD & NASH
- - PREVALENCE OF & USA Prevalence in Middle Age Patients San Antonio, Texas (Williams et al., Gastroenterology 2011; 140:124-31) Dallas Heart Study Prevalence Numbers (Browning et al., Hepatology 2004;40:1387-95)
DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
Adolescent Bariatric Surgery
Adolescent Bariatric Surgery. Roundtable on Obesity Solutions - April 6, 2017 Marc Michalsky, M.D., FACS, FAAP Professor of Clinical Surgery and Pediatrics - The Ohio State University, College of Medicine
Virchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation
Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis
End Stage Liver Disease & Disease Specific Indications for Liver Transplant. Susan Kang, RN, MSN, ANP-BC
End Stage Liver Disease & Disease Specific Indications for Liver Transplant Susan Kang, RN, MSN, ANP-BC Introduction (https://www.srtr.org) What does the liver do? STORAGE METABOLIC DETOXIFICATION SYNTHETIC
End Stage Liver Disease & Disease Specific Indications for Liver Transplant Susan Kang, RN, MSN, ANP BC
End Stage Liver Disease & Disease Specific Indications for Liver Transplant Susan Kang, RN, MSN, ANP BC Introduction (https://www.srtr.org) 1 What does the liver do? STORAGE METABOLIC DETOXIFICATION SYNTHETIC
Fatty Liver- how important is it? Jeremy F.L. Cobbold MA PhD MRCP Clinical Lecturer in Hepatology Imperial College London
Fatty Liver- how important is it? Jeremy F.L. Cobbold MA PhD MRCP Clinical Lecturer in Hepatology Imperial College London Fatty liver- how important is it? Importance in terms of: Prevalence Pathogenesis
NONALCOHOLIC FATTY LIVER DISEASE. Non-Alcoholic Fatty Liver Disease (NAFLD) Primary NAFLD. April 13, 2012
NONALCOHOLIC FATTY LIVER DISEASE Kiran Bambha, MD University of Colorado Denver April 13, 2012 Non-Alcoholic Fatty Liver Disease (NAFLD) Primary NAFLD Simple Steatosis Fatty hepatocytes Intracellular fat
Fatty Liver Disease A growing epidemic
Fatty Liver Disease A growing epidemic Updates in GIM for Primary Care Don C. Rockey March 9 th, 2018 Disclosures 2018 Research Funding (all to MUSC) NIH/NIDDK Actelion Pharmaceuticals Gilead Sciences
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Interleukin-20 is associated with delayed healing in diabetic wounds
Interleukin-20 is associated with delayed healing in diabetic wounds Phillip Finley, PhD Integrated and Applied Sciences Program Biology and Statistics/Research Methodology Normal Healing Body s natural
3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
Chemical aspects of the cell. Chemicals that control cell signaling: chemotaxis
Chemical aspects of the cell Chemicals that control cell signaling: chemotaxis Cellular responses Chemotaxis Cellular response to an environmental substance with a directional movement. Chemokinesis Cellular
Nature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
Disclosure. Objectives. Smash the Nash: A practical approach to fatty liver disease
Smash the Nash: A practical approach to fatty liver disease Bruce D. Askey, MS, ANP-BC Associate Lecturer North Andover, MA Adult Nurse Practitioner Dept. of Hepatology/Gastroenterology Guthrie Clinic
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
* Author to whom correspondence should be addressed; Tel.: ; Fax:
Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:
NAFLD/NASH. Definitions. Pathology NASH. Vicki Shah PA-C, MMS Rush University Hepatology
NAFLD/NASH Vicki Shah PA-C, MMS Rush University Hepatology Definitions NAFLD Evidence of hepatic steatosis by histology (5%) or imaging No causes for secondary fat accumulation EtOH, Drugs, hereditary
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
Mechanical Stress-Dependent Autophagy Components Release via Extracellular
Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Getting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis. Keith Sharkey
Getting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis Keith Sharkey Department of Physiology & Pharmacology University of Calgary Dr. Keith Sharkey Financial Interest
GPR84, a novel target for the development of therapies for IBD
GPR84, a novel target for the development of therapies for IBD Sonia Dupont 1, Frédéric Labéguère 1, Roland Blanqué 1, Steve de Vos 2, Philippe Clément- Lacroix 1, Isabelle Parent 1, Corinne Saccomani
Jung Han Kim, PhD Project 1 Project 2
Jung Han Kim, PhD Professor Joan C Edwards School of Medicine at Marshall University 1700 3 rd Ave, 435 BBSC Huntington, WV 25755 Tel: (304) 696-3873 Email: kimj@marshall.edu My long-term research interest
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Supplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
a surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
HBV Forum 2 April 18 th 2017 Hilton Amsterdam.
HBV Forum 2 April 18 th 2017 Hilton Amsterdam www.forumresearch.org Detection, Assessment and Management of DILI During Drug Development for HBV: The IQ DILI Initiative. Arie Regev, MD Global Patient Safety
Innate immunity. Abul K. Abbas University of California San Francisco. FOCiS
1 Innate immunity Abul K. Abbas University of California San Francisco FOCiS 2 Lecture outline Components of innate immunity Recognition of microbes and dead cells Toll Like Receptors NOD Like Receptors/Inflammasome
Risk Factors for Progression of and Treatment Options for NAFLD in Children
REVIEW Risk Factors for Progression of and Treatment Options for NAFLD in Children Phillipp Hartmann, M.D.,* and Bernd Schnabl, M.D., Nonalcoholic fatty liver disease (NAFLD) is a common disease and can
NASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
GCP-2. Alternative names. Discovery. Structure. Anja Wuyts*, Paul Proost and Jo Van Damme SUMMARY BACKGROUND
Anja Wuyts*, Paul Proost and Jo Van Damme Laboratory of Molecular Immunology, Rega Institute ± University of Leuven, Minderbroedersstraat 10, Leuven, 3000, Belgium * corresponding author tel: 32-16-337384,
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest