Pellino3 targets the IRF7 pathway and facilitates autoregulation of TLR3- and viral-induced expression of type I interferons

Transcription

1 Pellino3 trgets the pthwy n filittes utoregultion of TLR3- n virl-inue expression of type I interferons Jku Sienienko 1,, Ruihri Jkson 1,, Mrk Mellett 1,, Nezir Delgi 1, Shuo Yng 1, Bingwei Wng 1, Lis S Tng 1, John J Cllnn,3, Bernr P Mhon 1 & Pul N Moyngh 1 Toll-like reeptors (TLRs) sense pthogen-ssoite moleules n respon y inuing ytokines n type I interferon. Here we show tht geneti ltion of the E3 uiquitin ligse Pellino3 ugmente the expression of type I interferon ut not of proinflmmtory ytokines in response to TLR3 tivtion. Pellino3-efiient mie h greter resistne ginst the pthogeni n lethl effets of enephlomyoritis virus (). TLR3 signling inue Pellino3, whih in turn interte with n uiquitinte TRAF6. This moifition suppresse the ility of TRAF6 to intert with n tivte, resulting in ownregultion of type I interferon expression. Our finings highlight new physiologil role for Pellino3 n efine new utoregultory network for ontrolling type I interferon expression. Reognition of pthogen-ssoite moleules in miroes y TLRs les to tivtion of trnsription ftors suh s NF-κB tht promote inrese trnsription of proinflmmtory ytokines n interferons 1. All mmmlin TLRs, with the exeption of TLR3, use the ptor MyD88 s the reeptor-proximl signling moleule to trigger ownstrem tivtion of NF-κB. The ssoition of MyD88 with TLRs filittes reruitment of memers of the IRAK fmily of kinses tht in turn tivte the E3 uiquitin ligse TRAF6 (refs. 3 ). The formtion of polyuiquitin hins y TRAF6 serves to ring TAK1 into lose proximity with its sustrtes, inluing IκB kinses (IKKs). The TAK1-inue phosphoryltion n tivtion of IKKα n IKKβ promotes IKK-inue phosphoryltion of IκB proteins 6 tht normlly sequester NF-κB in n intive form in the ytoplsm. Phosphorylte forms of IκB re sujet to polyuiquitintion n susequently protesome-epenent egrtion, thus lierting NF-κB to trnslote to the nuleus n trnsriptionlly upregulte the expression of plethor of genes 7. Most TLRs use this MyD88- epenent pthwy to tivte NF-κB, ut TLR n itionlly eploy nother ptor protein, TRIF, to trigger MyD88-inepenent pthwy tht lso tivtes NF-κB 8. Among TLRs, TLR3 uses TRIF s its exlusive reeptor-proximl ptor protein. TRIF interts with RIP1 kinse to trigger ownstrem IKK-meite tivtion of NF-κB 9,1. TRAF6 hs een reporte to ssoite with TRIF n meite tivtion of NF-κB 11 13, ut other stuies h onlue tht TRAF6 is ispensle for TLR3 signling 1,1. Suh isrepnies in reltion to the role of TRAF6 in TRIF signling my e ue to ell-speifi roles for TRAF6 n/or funtionl reunny of TRAF6 with other memers of the TRAF fmily 11. In ition to tivtion of NF-κB, TRIF n lso trigger tivtion of interferon-regultory ftor (IRF) trnsription ftors. Thus, TRIF forms omplex with the kinses TBK1 n IKKi (lso known s IKKε) n oth kinses n tlyze phosphoryltion n tivtion of IRF3 n, leing to their nuler trnslotion n inution of type I interferons 1,16. The ltter re key ntivirl moleules tht lok virl replition 17,18. It is ler from the ove tht uiquitintion is importnt in TLR signl trnsution. Aitionlly, there is n emerging ppreition of the roles of the E3 uiquitin ligse fmily of Pellino proteins in TLR signling. The mmmlin Pellino fmily onsists of four memers: Pellino1, Pellino n splie vrints of Pellino3 terme Pellino3 long (Pellino3L; lso known s Pellino3) n Pellino3 short (Pellino3S; lso known s Pellino3) 19,. Eh Pellino fmily memer ontins n N-terminl forkhe ssoite (FHA) omin tht reognizes phosphothreonine resiues n meites ssoition with IRAKs 1, n C-terminl RING-like omin tht onfers E3 uiquitin ligse tivity n n ility to tlyze lysine 63 (Lys63)-linke polyuiquitintion of IRAKs. Pellino proteins re sujet to vrious forms of post-trnsltionl moifition, inluing phosphoryltion 8, uiquitintion 3 n sumoyltion 9 with phosphoryltion eing espeilly importnt for enhning the E3 ligse tivity. Pellino1 is regulte t the trnsriptionl level y TRIF signling, whih inues Pellino1 expression in n IRF3-epenent mnner 6. Although eh of the Pellino proteins hs most of the ove fetures, there re unique funtionl ifferenes. Pellino1 hs een shown to t s meitor in the NF-κB pthwy 3, wheres Pellino n Pellinove een ssoite with tivtion of MAPK pthwys 8,31 3. The genertion of Pellino1-efiient mie h revele role for Pellino1 s the E3 1 Deprtment of Biology, Institute of Immunology, Ntionl University of Ireln Mynooth, Mynooth, County Kilre, Ireln. University College Dulin (UCD) Shool of Veterinry Meiine, Dulin, Ireln. 3 Conwy Institute of Biomoleulr n Biomeil Reserh, UCD, Belfiel, Dulin, Ireln. These uthors ontriute eqully to this work. Corresponene shoul e resse to P.N.M. (pul.moyngh@nuim.ie). Reeive April; epte 1 August; pulishe online 7 Otoer 1; oi:1.138/ni.9 nture immunology VOLUME 13 NUMBER 11 NOVEMBER 1 1

2 TNF (pg/ml) IFN-α (pg/ml), 1, 1,, 1, 1, PmCSK Pm3CSK Zymosn e A Flgellin f CLO97 CpG 1 1 IL-6 (pg/ml) 3 1 ND Tnf mrna (fol) 3 1 PmCSK Pm3CSK Zymosn g 3 1 Flgellin CLO97 CpG Tnf mrna (fol) IFN-β (pg/ml) 1 1, 1, 1, ND CLO97 CpG h 3 1 CXCL1 (ng/ml) Cl mrna (fol) CLO97 CpG Tnf mrna (fol) 3 1 Figure 1 Pellino3 efiieny results in enhne TLR3-inue expression of IFN-β n relte genes. () ELISA of TNF n IL-6 expression in meium from BMDMs isolte from wil-type () n Pellino3-efiient (Peli3 / ) mie n trete with 1 ng/ml PmCSK, 1 ng/ml Pm3CSK, 1 µg/ml zymosn, µg/ml poly(i:c), 1 ng/ml lipopolyshrie (), 1 µg/ml flgellin, 1 µg/ml CLO97 n µg/ml CpG for h., untrete. (,) ELISA of IFN-β () n CXCL1 () in meium from n Peli3 / BMDMs stimulte with µg/ml poly(i:c), 1 ng/ml, 1 µg/ml CLO97 n µg/ml CpG for h. (,e) Expression of IFN-α ssye y ELISA () n iotive type 1 interferon ssye y lue sensor ells (e) in n Peli3 / BMDMs stimulte with µg/ml poly(i:c) for h. (f,g) Quntittive PCR of mrna expression for Ifn1 n Tnf in n Peli3 / BMDMs tht were untrete or stimulte with µg/ml poly(i:c) (f) or 1 ng/ml (g) for 6 h. ND, not etete. (h) Quntittive PCR of IFN-β, RANTES n TNF mrna expression in PECs isolte from n Peli3 / mie 8 h fter intrperitonel injetion with 1 mg/kg poly(i:c). Dt re representtive of three experiments (error rs, s.e.m.; n =3). P <., P <.1 n P <.1 (pire Stuent s t-test). uiquitin ligse for RIP1 n ritil meitor of TRIF-epenent tivtion of NF-κB in TLR3 n TLR pthwys 3. Pellino1 hs een shown to negtively regulte T ell tivtion n suppress utoimmunity y promoting uiquitintion n proteolysis of the NF-κB suunit -Rel in tivte T ells 36,37. To te the physiologil roles of Pellino n Pellino3 remin to e efine. We report the genertion of Pellino3-efiient mie n esrie new physiologil role for Pellino3 in TLR signling. We show tht Pellino3 is ispensle for TLR-inue expression of proinflmmtory ytokines ut hs negtive regultory role in TLR3- n virl-inue expression of type I interferon n relte genes. Mehnistilly, we show tht TRIF signling inues Pellino3 expression, whih in turn inhiits the ility of TRAF6 to tivte. These finings revel Pellino3 s n importnt plyer in new utoregultory system for ontrolling type I interferon expression. RESULTS Pellino3 regultes TLR3 inution of type I interferon We generte Pellino3-efiient mie with floxe Peli3 llele (Supplementry Fig. 1). We etete wil-type n reomine lleles y PCR nlysis (Supplementry Fig. 1). Semi-quntittive n rel-time RT-PCR nlysis of mrna isolte from mouse emryoni firolsts (MEFs) emonstrte sene of Pellino3 mrna expression in ells from Peli3 / mie (Supplementry Fig. 1,). Initilly we use one mrrow erive mrophges (BMDMs) from wil-type n Peli3 / mie to ssess the effets of Pellino3 efiieny on TLR signling. The ility of vrious TLR ligns to inue proinflmmtory ytokines, suh s TNF n IL-6, ws omprle in BMDMs from wil-type n Pellino3-efiient mie s etermine y enzyme-linke immunosorent ssy (ELISA; Fig. 1), initing nonessentil role for Pellino3 in meiting TLR-inue expression of proinflmmtory ytokines. Vrious TLR ligns were similrly effetive in inuing TNF in MEFs isolte from wiltype n Peli3 / mie (Supplementry Fig. ). Given tht TLRs re highly expresse in vrious enriti ell (DC) popultions, we hrterize the effets of Pellino3 efiieny on IL-6 expression in response to TLR3, TLR n TLR9 signling in myeloi DCs (mdcs) n plsmytoi DCs (pdcs; Supplementry Fig.,). Asene of Pellino no effet on the TLR-meite inution of IL-6 in these DC popultions. We next exmine potentil role of Pellino3 in regulting the expression of type I interferons n interferon-stimulte genes, suh s the hemokine CXCL1. We stimulte BMDMs with ligns for TLR3, TLR, TLR7 n TLR9 euse these re the preominnt TLR fmily memers tht inue type I interferons, n mesure the inution of interferon et (IFN-β). Eh of the ligns inue IFN-β in wil-type BMDMs, ut the TLR3 gonist polyrioinosini: polyrioytiyli i (poly(i:c)) ws unique in tht its effiy in inuing IFN-β ws ugmente in Pellino3-efiient BMDMs ompre with wil-type BMDMs (Fig. 1). Peli3 / ells lso exhiite seletive enhnement of poly(i:c)-inue expression of CXCL1 (Fig. 1). similrly inue higher IFN-α expression in Peli3 / BMDMs reltive to their wil-type ounterprts (Fig. 1). The type I interferon proue in these ells ws iotive, s shown in type I interferon reporter ell line (Fig. 1e). We lso mesure type I interferon n CXCL1 inution in MEFs, mdcs n pdcs stimulte with vrious TLR ligns (Supplementry Fig. ). We oserve enhne inution of type I interferon n CXCL1 y poly(i:c) in Pellino3-efiient MEFs n mdcs. This effet ws meite y inrese gene trnsription euse poly(i:c) inue greter mounts of Ifn1 mrna in Pellino3-efiient BMDMs reltive to wil-type ells, wheres poly(i:c)-meite inution of Tnf mrna ws inepenent of Pellino3 efiieny (Fig. 1f). The regultory effets of Pellino3 on type I interferon expression seeme to e restrite to TLR3 euse Pellino3 efiieny i not ffet meite inution of Ifn1 or Tnf mrna in BMDMs (Fig. 1g). 16 VOLUME 13 NUMBER 11 NOVEMBER 1 nture immunology

3 Figure Pellino3-efiient ells exhiit n enhne type 1 interferon response to infetion. (,) ELISA of IFN-β, IFN-α, CXCL1 n TNF expression in meium from BMDMs () or MEFs () isolte from wil-type () n Peli3 / mie n infete with ( PFU)) for the inite urtions. (,) Expression of iotive type 1 interferon ssye in lue sensor ells () n quntittive PCR of Ifn1, Cxl1, Ifn n Tnf mrna expression () in n Peli3 / MEFs infete with ( PFU) for the inite urtions. Error rs, s.e.m. (n = 3 experiments)., not signifint,p <., P <.1 n P <.1 (pire Stuent s t-test). To onfirm the regultory effets of Pellino3 in poly(i:c) signling in vivo, we injete wil-type n Pellino3-efiient mie intrperitonelly with poly(i:c), isolte peritonel exute ells (PECs) n ssye them for expression of genes enoing IFN-β, RANTES n TNF (Ifn1, Cl n Tnf, respetively). The hemokine RANTES ws inlue in this nlysis euse, similr to type I interferon, its expression is regulte y IRFs. In vivo ministrtion of poly(i:c) inue expression of Ifn1 n Cl in wil-type mie, n this ws enhne in Pellino3-efiient mie (Fig. 1h). In ontrst, poly(i:c)-meite inution of Tnf ws similr in wil-type n Peli3 / mie, initing tht Pellino3 seletively regultes expression of type I interferons n relte genes without ffeting expression of proinflmmtory genes. Given tht poly(i:c) n stimulte oth TLR3 n the ytosoli reeptor MDA- (ref. 38), we investigte whih of the two pthwys is potentilly moulte y Pellino3 in this experimentl system. We oserve loss of inution of Ifn1, Cl n Tnf mrnas, whih enoe IFN-β, RANTES n TNF, respetively, in response to poly (I:C) in TRIF-efiient BMDMs ut not in BMDMs efiient in the signling ptor MAVS (Supplementry Fig. 3). Given the role of TRIF in TLR3 signling n MAVS in MDA- signling, these results provie eviene tht TLR3 is the primry sensing reeptor for poly(i:c) in BMDMs. In ition, we pplie poly(i:c) to ells iretly, whih fvors stimultion of TLR3, wheres MDA- meite responses to poly(i:c) require trnsfetion of ells for elivery of the syntheti srna to the ytosol. To onfirm tht Pellino3 trgets TLR3 in our moel, we teste the effet of iret pplition or liposome-meite elivery of poly(i:c) to wil-type n Pellino3-efiient BMDMs on IFN-β expression. Both elivery methos inue IFN-β in wil-type BMDMs. IFN-β inution ws enhne in Pellino3-efiient ells in response to iret pplition of poly(i:c) ut not in response to trnsfetion-meite elivery (Supplementry Fig. 3). These finings suggest tht Pellino3 seletively trgets the TLR3 pthwy. We next resse the regultory effets of Pellino3 on TLR3- inue expression of type I interferon n relte genes in humn ells. We estlishe U373 ell lines trnsue with lentivirus to stly express PELI3-speifi short hirpin RNA (shrna) or ontrol shrna. We onfirme knokown of Pellino3 expression y RT- PCR (Supplementry Fig. ). Expression of IFNB1, IFNA1, CCL n CXCL1 mrna, in response to poly(i:c) stimultion for vrious times, ws gretly enhne uner onitions of Pellino3 knokown (Supplementry Fig. e). We lso oserve enhne expression t the protein level (Supplementry Fig. f,g). -inue expression of IL6 mrna or protein were not ffete in Pellino3 knokown U373 ells (Supplementry Fig. h,i). Together, these results inite seletive role for Pellino3 s negtive regultor of TLR3-inue expression of type I interferon ut not of proinflmmtory genes. Enhne protetion from infetion in Peli3 / mie Given tht poly(i:c) is syntheti nlog of virl srna, we investigte the role of Pellino3 in regulting the host response to, IFN-β (pg/ml) IFN-β (pg/ml) Ifn1 mrna (fol 1 3 ), 1, 1, 1, IFN-α (pg/ml) 1, ND ND ND ND IFN-α (pg/ml) Cxl1 mrna (fol 1 ) 1, 1, CXCL1 (ng/ml) 3 1 1, CXCL1 (pg/ml) 1, ND 1 whih genertes srna s prt of its life yle n for whih TLR3 signling hs een shown to e importnt for protetive response 39. inue IFN-β, IFN-α, CXCL1 n TNF in wil-type BMDMs. Wheres expression of type I interferon n CXCL1 ws itionlly enhne in Peli3 / ells, -inue TNF ws not ffete y Pellino3 efiieny (Fig. ). We otine similr results in Pellino3-efiient MEFs (Fig. ). The enhne proution of type I interferons ws iotive (Fig. ). Pellino3-efiient MEFs showe enhne inution of the mrnas enoing IFN-β, IFN-α n CXCL1 in response to hllenge reltive to wiltype ells (Fig. ). Loss of Pellino no effet on the Tnf mrna inue y, suggesting Pellino3 speifilly regultes type I interferon gene expression in response to. We next investigte the physiologil n pthologil relevne of these regultory effets of Pellino3 in the ontext of infetion with two lethl virl oses in wil-type n Peli3 / mie. The higher infetion ose of plque-forming units (PFU) per mouse h lethl effet in ll wil-type mie 7 fter infetion (Fig. 3), wheres 6% of Pellino3-efiient mie survive n remine helthy for the urtion of the infetion stuy. A lower ose of ( PFU per mouse) use % lethlity in wiltype mie 1 fter infetion, wheres ll Pellino3-efiient mie survive (Fig. 3). An inrese hert/oy weight rtio, hrteristi of infetions, ws lerly evient in wil-type mie ut not in Pellino3-efiient mie t low oses of infetion (Fig. 3). Exmintion of hert tissue from -infete wil-type mie y mirosopy revele histopthologil hnges with rnom multifol mononuler interstitil infiltrtes s well s myofier nuler kryolysis n myofier ell loss ompnie y mil eem (Fig. 3). We i not oserve these hnges in the hert tissue from -infete Peli3 / mie. Enhne protetion from the pthologil n lethl effets of infetion in Pellino3- efiient mie ws ssoite with lower virl lo in the herts, s mesure y expression of the replise gene from (Fig. 3). Ifn mrna (fol) TNF (pg/ml) 1, Tnf mrna (fol) TNF (pg/ml) A nture immunology VOLUME 13 NUMBER 11 NOVEMBER 1 17

4 Survivl (%) 1 PFU 7 PBS PBS 6 Time () PFU Time () infete Survivl (%) PBS PBS Hert/oy infete Figure 3 Peli3 / mie exhiit ugmente IFN-β expression n inrese virl lerne in response to infetion. () Survivl rtes of ge-mthe n sex-mthe wil-type (; n = 7) n Peli3 / (n = 7) mie fter intrperitonel injetion with PFU or PFU of virus or with PBS s vehile ontrol (P =., Kpln-Meier nlysis). Moriun mie were kille. Surviving mie were kille 1 or 1 fter infetion. (,) Hert/oy weight rtios () n hert smples stine with hemtoxylin n eosin () from n Peli3 / mie fter intrperitonel injetion with ( PFU)., untrete. Originl mgnifition, (top) n (ottom). ( f) Quntittive PCR of mrna expression for replise (), Ifn1 (e) n Tnf (f) in hert tissue from n Peli3 / mie fter intrperitonel injetion with PFU (n = 3 mie eh group). Error rs, s.e.m. (n = 3 experiments). P <.1 (pire Stuent s t-test). replise mrna (fol) infetion ( ) e 1 1 infetion ( ) f Tnf mrna (fol) 1 1 infetion ( ) This ws onsistent with enhne IFN-β expression in the herts from -infete Peli3 / mie (Fig. 3e), whih presumly filitte more effiient lerne of the virus. Expression of TNF in the hert of -infete Peli3 / mie ws lower thn tht in infete wil-type mie (Fig. 3f), orrelting with the lower gre of inflmmtion suggeste y the histohemil nlysis (Fig. 3). Thus, Pellinos n importnt regultory funtion in ontrolling type I interferon expression in response to virl hllenge. Pellino3 seletively regultes tivtion of Beuse the type I interferon n relte genes tht re inhiite y Pellino3 re strongly regulte y NF-κB n IRFs, we ompre these pthwys in response to poly(i:c) in wil-type n Pellino3- efiient ells. The sene of Pellino3 i not ffet the pity of poly(i:c) to inue phosphoryltion of IKKs or of their sustrte IκBα, oth of whih re tivtion inies of the nonil NF-κB pthwy (Fig. ). To investigte the tivtion of IRFs, we ssesse the ining of nuler extrts to n oligonuleotie ontining the IRF reognition motif from the positive regultory omins I/III (PRD I/III) of the enhner region of the Ifn1 gene. inue moest n time-epenent inrese in the ining of nuler extrt proteins from wil-type ells to the PRD I/III motif, wheres ining ws enhne in extrts from Pellino3-efiient ells (Fig. ), suggestive of role for Pellino3 in trgeting the IRF rm of the TLR3 pthwy. However, loss of Pellino3 i not ffet the ility of poly(i:c) to promote phosphoryltion of IRF3 or its upstrem kinse TBK1 (Fig. ). Given tht n lso in to the PRD I/III omin, we proe the regultory effet of Pellino3 on the phosphoryltion of, whih is require for its tivtion. Beuse ommerilly ville phosphospeifi ntioies re only suffiiently sensitive to etet overexpresse, we hrterize the poly(i:c)-inue phosphoryltion of expresse in HEK93 ells, stly expressing TLR3 n trnsfete with shrna trgeting PELI3. In this system, poly(i:c) promote time-epenent phosphoryltion of in ells trnsfete with ontrol shrna, n this ws enhne in Pellino3-knokown ells (Fig. ). We next proe the regultory effet of Pellino3 on the phosphoryltion of enogenous. Given the lk of sensitivity of the phospho- ntioy, we immunolotte for serine phosphoryltion of immunopreipitte from mdcs tht h een stimulte with poly(i:c). The mount of serine-phosphorylte ws higher in Pellino3-efiient mdcs reltive to tht in wil-type mdcs (Fig. e). Beuse phosphoryltion of is prerequisite for its nuler trnslotion, we next ssesse the effets of Pellino3 efiieny on the nuler loliztion of. We isolte nuler frtions from wil-type n Pellino3-efiient BMDMs tht h een stimulte with poly(i:c) for vrious urtions. Time-epenent poly(i:c)- inue nuler loliztion of ws stronger in Peli3 / thn in wil-type BMDMs (Fig. f). Wheres poly(i:c) lso use inrese nuler loliztion of IRF3, this ws not ffete y the sene of Pellino3. We use onfol mirosopy to omplement these oservtions on the suellulr loliztion of. In unstimulte MEFs from wil-type mie, lolize to the ytoplsm, n stimultion with poly(i:c) promote some nuler umultion of (Fig. g). However, the effet of poly(i:c) in Pellino3-efiient MEFs ws more notle, with ll etetle trnsloting to the nuleus fter poly(i:c) stimultion. Finlly, we ssesse whether the enhne poly(i:c)-inue nuler loliztion of in Pellino3-efiient ells trnslte into inrese ining of to responsive promoters. We stimulte wiltype n Pellino3-efiient BMDMs with poly(i:c) n ssye the in vivo ining of to the Ifn1 promoter y hromtin immunopreipittion. -inue ining of to the Ifn promoter ws inrese in Pellino3-efiient ells ompre to tht in wil-type BMDMs (Fig. h). All of the ove t strongly inite tht Pellino3 negtively regultes tivtion of ut not of IRF3. We iretly resse this y ssessing the effets of overexpresse Pellino3 on the inution of otrnsfete IRF3-regulte or -regulte reporter gene. Using this system, oth splie forms of Pellino3 inhiite poly(i:c)- inue tivtion of ut not of IRF3 (Supplementry Fig.,), onsistent with Pellino3 trgeting the pthwy. We lso hrterize the regultory effets of the splie forms of Pellino3 on nturlly ourring -responsive promoters. Both splie forms inhiite poly(i:c)-inue tivtion of the 18 VOLUME 13 NUMBER 11 NOVEMBER 1 nture immunology

5 p-iκbα p-ikkβ IKKβ β-tin 1 min 3 min 9 min 6 h 1 min 3 min 9 min 6 h PRD I/III ining Free proe P C 3 min 6 h 6 h 3 min p-irf3 IRF3 p-tbk1 β-tin 1 min min 3 min 1 h h 1 min 1 h h min 3 min Ctrl shrna PELI3 shrna (min) p- Flg β-tin e IB: p-ser 1 min 3 min 9 min 1 min 3 min 9 min HC p- g DAPI Untrete Merge DAPI (9 min) Merge f IRF3 Nuleolin 1 h h 1 min min 3 min 1 min min 3 min 1 h h Figure Pellino3 inhiits tivtion n nuler trnslotion of. () Immunolot nlysis of phosphorylte (p-)iκb-α, p-ikkβ n totl IKKβ in lystes of wil-type () n Peli3 / BMDMs stimulte with µg/ml poly(i:c) for inite urtions. β-tin ws use s loing ontrol. () Eletrophoreti moility shift ssy nlysis of ining of n oligonuleotie, ontining the onsensus PRD I/III omin of the Ifn1 promoter, to nuler extrt proteins from n Peli3 / MEFs stimulte with µg/ml h (h) Ifn promoter Input IP: IP: IgG IP: IP: IgG poly(i:c) for inite urtions. Controls: oligonuleotie proe run y itself (P) n nuler extrts (from Peli3 / ells stimulte with poly(i:c) for ) preinute for 1 min with the unlele ompeting oligonuleotie efore ssying for ining to the lele PRD I/III oligonuleotie (C). () Immunolot nlysis s in of p-irf3, p-tbk1 n totl IRF3. () Immunolot nlysis of p- n Flg-tgge in lystes of µg/ml poly(i:c)-trete HEK93 ells stly expressing TLR3 n previously trnsfete with n -Flg expression onstrut n ontrol or Peli3-speifi shrna. (e) Immunolot (IB) nlysis of phosphoserine (p-ser) n in lystes n immunopreipitte (IP) smples from n Peli3 / mdcs stimulte with µg/ml poly(i:c) for inite urtions. Arrows, IgG hevy hin (HC) n p-. (f) Immunolot nlysis of, IRF3 n nuleolin in nuler extrts from n Peli3 / BMDMs stimulte with µg/ml poly(i: C) for inite urtions. (g) Confol imges otine with 63 oil-immersion ojetive (totl mgnifition of imges, 63) of n Peli3 / MEFs stimulte with µg/ml poly(i:c) for 9 min. Cells were inute with nulei-stining DAPI. (h) Chromtin immunopreipittion nlysis of ining of to the Ifn1 promoter in n Peli3 / BMDMs stimulte with µg/ml poly(i:c) for h. Input DNA (efore immunopreiptition) n immunopreipitte (with nti- () or mouse IgG (IP: IgG) hromtin were nlyze y PCR ( yles) with primers speifi for the Ifn1 promoter. Dt re representtive of three experiments. IFNA n IFNB promoters (Supplementry Fig.,). Furthermore, given tht ins to the PRDI/III omins of the IFNB promoter, we onfirme tht Pellino3 trgets this region of the IFNB promoter (Supplementry Fig. e). These t suggest tht Pellino3 regultes the nuler trnslotion n tivtion of. Pellino3 regultes TRAF6-epenent uiquitintion of We next proe the mehnism y whih Pellino3 n trget the pthwy. Beuse loss of Pellino3 i not ffet poly(i:c)- inue phosphoryltion of TBK1, known tivtor of, we investigte the effets of Pellino3 efiieny on the uiquitintion sttus of. Previous stuies hve emonstrte tht uiquitintion of is prerequisite for IKKi-meite phosphoryltion n tivtion of (refs.,1). promote moest inrese in the uiquitintion of in MEFs from wil-type mie. This ws onsierly enhne in MEFs from Peli3 / mie (Fig. ). Given tht TRAF6 hs een shown to intert with n uiquitinte (refs.,1), we next proe the effets of Pellino3 on the TRAF6- intertion. promote the intertion of TRAF6 with in wil-type MEFs, n this ws ugmente in Peli3 / MEFs, s shown y inrese oimmunopreipittion of TRAF6 n (Fig. ). i not inue IFN-β in MEFs from TRAF6-efiient mie (Fig. ), emonstrting funtionl role for TRAF6 in poly(i:c)-inue expression of type I interferon. This efiieny in TLR3 signling ws resue y reonstitution of Trf6 / MEFs with wil-type TRAF6 ut not with point mutnt form of TRAF6 (C7A) tht olitertes its E3 uiquitin ligse tivity (Fig. ). These results re onsistent with moel in whih Pellino3 trgets TRAF6-inue uiquitintion of n IFN-β expression ownstrem of TLR3. Pellino3 meites uiquitintion of TRAF6 We next investigte the regultory proess y whih TLR3 eploys Pellino3 to negtively regulte TRAF6-meite tivtion of. inue expression of Peli3 mrna in wil-type BMDMs (Fig. 6) ut not in BMDMs lking TRIF, TBK1 or IKKi. In ition, poly(i:c) promote the intertion of Pellino3 with TRAF6 in time-epenent mnner, s eviene y oimmunopreipittion of the two proteins (Fig. 6). We proe the funtionl onsequene of this intertion y mesuring the uiquitintion of TRAF6 in wil-type n Pellino3-efiient ells. Beuse Pellino3 is n E3 uiquitin ligse, we espeilly investigte the uiquitintion of TRAF6. Stimultion with poly(i:c) use uiquitintion of TRAF6 in wil-type MEFs ut not in MEFs from Peli3 / mie (Fig. 6), initing n importnt role for Pellino3 in the uiquitintion of TRAF6 ownstrem of TLR3. This ws lso the se in humn ells, s HEK93 ells stly expressing TLR3 n trnsfete with PELI3- speifi shrna i not exhiit inrese uiquitintion of TRAF6 in response to poly(i:c), wheres ells trnsfete with ontrol shrnas strongly respone to poly(i:c) (Supplementry Fig. 6). nture immunology VOLUME 13 NUMBER 11 NOVEMBER 1 19

6 Figure Loss of Pellino3 enhnes ining of TRAF6 to n uiquitintion of. (,) Immunolot (IB) nlysis of n uiquitin () or TRAF6 () in lystes n immunopreipitte (IP) smples from wil-type () n Peli3 / MEFs stimulte with µg/ml poly(i:c) for inite urtions. β-tin ws use s loing ontrol. () Quntittive PCR of mrna expression for IFN-β in, Peli3 / n Trf6 / MEFs stimulte or untrete () with µg/ml poly(i:c) for 6 h. () Quntittive PCR of mrna expression for IFN-β in Trf6 / MEFs trnsfete with n empty vetor () onstrut or expression plsmis enoing TRAF6 or TRAF6 (C7A) (3 µg) n stimulte with µg/ml poly(i:c) for 6 h or untrete (). Expression of TRAF6 onstruts in Trf6 / MEFs ws etermine y immunolotting. Immunopreipittion experiments (,) re representtive of three experiments. Error rs (,), s.e.m. (n = 3 experiments). P <., P <.1 n, not signifint (pire Stuent s t-test). The responsiveness of Peli3 / MEFs to poly(i:c)-inue uiquitintion of TRAF6 ws restore y retrovirlly meite expression of mouse Pellino3 (Supplementry Fig. 6). The E3 ligse tivity of Pellino3 ws iretly require for the uiquitintion of TRAF6 euse mutnt form of Pellino3 tht lks funtionl RING omin i not reonstitute the poly(i:c)-inue uiquitintion of TRAF6 in Peli3 / MEFs (Fig. 6). We next evlute the funtionl link etween the ility of Pellino3 to meite poly(i:c)-inue uiquitintion of TRAF6 n the regultory effets of Pellino3 on IFN-β expression. Reintroution of mouse Pellino3 into Peli3 / MEFs lunte the ility of poly(i:c) to inue Ifn1 mrna n IFN-β protein, wheres the mutte form of Pellino3 with nonfuntionl RING omin i not exert this inhiitory influene (Fig. 6e). This lso pplies to humn ells euse exogenous expression of Pellino3 in HEK93 TLR3 ells expressing PELI3-speifi shrna inhiite poly(i:c)-inue expression of IFN-β, wheres the RING-mutte form of Pellino3 ws ineffetive (Supplementry Fig. 6). We next IB: U min 9 min Trf 6 / 3 min 9 min 1 1 explore whether uiquitintion of TRAF6 ffets its pity to uiquitinte. As expete, the oexpression of TRAF6 n le to strong uiquitintion of, n this ws lost with point muttion (C7A) of TRAF6 tht interferes with the E3 ligse tivity of TRAF6 (Fig. 6f). However, muttion of the primry uiquitintion site in TRAF6 (Lys1) le to slightly higher levels of uiquitinte, onsistent with the ie tht uiquitintion of TRAF6 hs n inhiitory effet on its E3 uiquitin ligse tivity. Furthermore, the TRAF6 mutnt lking the uiquitintion site ws more effetive thn its wil-type ounterprt in reonstituting poly(i:c)-inue expression of IFN-β in TRAF6-knokown ells (Fig. 6g). These t re onsistent with moel where poly(i:c) inues Pellino3 expression n promotes its intertion with n (min) TRAF6 () TRAF6 (C7A) + TRAF6 () TRAF6 (C7A) Peli3 mrna (fol) Tim1 / Ikke / Tk1 / Time (h) (min) (min) IB: Pellino3 IB: Pellino3 IB: U MSCV: IB: U IB: My Untrete Peli3 RING (9 min) Peli3 RING Figure 6 Pellino3 meites TLR3-inue uiquitintion of TRAF6, whih negtively regultes uiquitintion of n expression of IFN-β. () Quntittive PCR nlysis of Peli3 mrna expression in immortlize BMDMs generte from wil-type (), Tim1 /, Ikke / n Tk1 / mie n stimulte with µg/ml poly(i:c) for inite urtions. () Immunolot (IB) nlysis of Pellino3 n TRAF6 in lystes n immunopreipitte (IP) TRAF6 smples from U373 ells () n of uiquitin (U) n TRAF6 in lystes n immunopreipitte (IP) TRAF6 smples from n Peli3 / MEFs () stimulte with µg/ml poly(i:c) for inite urtions. β-tin ws use s loing ontrol. (,e) IB nlysis of uiquitin n TRAF6 in immunopreipitte (IP) TRAF6 smples (), expression of Ifn1 mrna ssye y quntittive PCR (e, top) n iotive type 1 interferon ssye y lue sensor ells (e, ottom) in untrete or µg/ml poly(i:c)-trete n Peli3 / MEFs, previously infete with MSCV retrovirus ontining n empty vetor () plsmi or one enoing mouse (m)pellino3 or mpellino3 with mutte RING omin. (f) IB nlysis of uiquitin n in immunopreipitte (IP) smples from HEK93 ells stly expressing TLR3 n previously trnsfete with onstruts enoing Flg-tgge, TRAF6, TRAF6 (C7A) n TRAF6 (K1R) (1 µg). (g) Quntittive PCR nlysis of IFNB1 mrna in untrete A 63 e 1 1 Untrete UI Pellino3 g IFNB1 mrna (fol) 8 6 Pellino3 Pellino3 RING Pellino3 RING f IB: U Mok GAPDH sirna TRAF6 sirna IB: Flg TRAF6 () TRAF6 (K1R) Untrete (6 h) or µg/ml poly(i:c)-trete HEK93 ells stly expressing TLR3 n previously trnsfete with TRAF6-speifi or GAPDH-speifi sirna n expression plsmis enoing TRAF6, TRAF6(K1R) or n empty vetor ontrol () ontrol (1 µg). Dt re representtive of three experiments (,f) or re presente s the men ± s.e.m. of t lest three experiments (,e,g)., not signifint, P <., P <.1 n P <.1 (pire Stuent s t-test for e n ANOVA for g). + TRAF6 () TRAF6 (C7A) TRAF6 (K1R) TRAF6 16 VOLUME 13 NUMBER 11 NOVEMBER 1 nture immunology

7 uiquitintion of TRAF6, thus negtively influening the ility of the ltter to uiquitinte n inue IFN-β expression. DISCUSSION Using Pellino3-efiient mie, in this stuy we hrterize the physiologil role of Pellino3 in innte immunity. Peli3 / mie were vile n evelope normlly. Our t inite tht Pellino3 oes not t s meitor of proinflmmtory ytokine expression in response to TLRs ut hs key regultory role in ontrolling TRIFepenent type I interferon expression in the TLR3 pthwy. We propose tht TLR3 speifilly uses Pellino3 s prt of n utoregultory signling network in whih stimultion of TLR3 y viruses or efine ligns, suh s srna, les to upregultion of Pellino3, filitting its intertion with TRAF6 n uiquitintion of the ltter. We propose tht this moifition of TRAF6 serves to terminte its ility to uiquitinte, thus shutting own key river of type I interferon expression. In ition to elineting new regultory network tht ontrols type I interferon expression, the finings lso highlight new funtion for Pellino proteins. Wheres overexpression n knokown pprohes hve previously implite Pellino proteins s regultors of the NF-κB n MAP kinse pthwys, stuies in physiologil setting hve een restrite to Pellino1 (refs. 3, 36). Using Pellino1-efiient mie, Pellino1 hs een shown to regulte the NF-κB pthwy n t s key meitor of TRIF-inue expression of proinflmmtory ytokines in the TLR3 n TLR pthwys. Our present stuies show tht Pellino3 regultes TRIF-epenent signling in mnner tht is very ifferent from tht of Pellino1, in tht Pellino3 regultes TRIF-inue expression of IFN-β. This emphsizes ivergent funtions for ifferent memers of the Pellino fmily n highlights speifi roles for Pellino proteins in these pthwys. We use s nturlly ourring gent tht triggers ntivirl immunity vi TLR3. TLR3 signling is essentil for meiting ytokine expression, virl lerne n reuing lethlity in response to infetion 39. Our finings inite tht sene of Pellino3 les to enhne virl lerne, iminishe pthology n greter survivl in mie, n this is onsistent with gretly ugmente TLR3- inue expression of type I interferons in response to infetion when Pellino3 is sent. This reffirms ritil role for Pellino3 in tempering type I interferon expression in response to TLR3 stimultion. However, our finings nnot exlue role for Pellino3 in similrly regulting the signling of the virl sensing retinoi iinuile gene (RIG-I)-like reeptors, s M- hs lso een reporte to etet poly(i:c) n t s sensor of infetion n s meitor of -riven type I interferon expression 38. However, responses to poly(i:c) meite y M- require ell trnsfetion to filitte elivery of the syntheti srna to the ytosol-resient M-. Uner onitions of trnsfetion-meite elivery, we showe tht loss of Pellino3 ws without effet, strongly suggesting tht Pellino3 trgets the TLR3 pthwy n not the M- pthwy. Furthermore, using our elivery protool, we oserve loss of ytokine inution in response to poly(i:c) in TRIF-efiient BMDMs ut not in MAVS-efiient BMDMs, reffirming tht Pellino3 is trgeting the TLR3 pthwy. In our moel, Pellino3 negtively regultes uiquitintion, nuler trnslotion n tivtion of, n thus inhiits mjor river ehin type I interferon expression. In serhing for the mehnism y whih Pellino3 oul exert suh effets on tivtion we looke eyon its immeite upstrem kinses, TBK1 n IKKi, given tht loss of Pellino3 i not ffet poly(i:c)-inue phosphoryltion of TBK1. A previous stuy hs shown tht Epstein-Brr virus LMP1 uses TRAF6 to uiquitinte on its lst three lysine resiues, with suh uiquitintion eing prerequisite for IKKi-meite phosphoryltion n tivtion of (ref. 1). TRAF6 lso hs een shown to fulfill ritilly importnt role in the uiquitintion n tivtion of y TLR7 n TLR9 in pdcs. TRAF6 hs role in the tivtion of the IFN-β promoter y poly(i:c) n, with the replition of eing onsierly enhne in the sene of TRAF6 (ref. ). These reports losely mirrore our finings in Pellino3- efiient mie n promote TRAF6 s the le trget for Pellino3. We foun tht TLR3 signling promote the intertion of Pellino3 with TRAF6, leing to strong uiquitintion of TRAF6, whih epene on the funtionl RING-like omin in Pellino3. These oservtions strongly suggest tht Pellino3 ts s the immeite E3 uiquitin ligse for TRAF6. However, this oes not exlue the possiility tht Pellino3 ssoites with TRAF6 n stimultes the utouiquitintion of TRAF6. In n in vitro uiquitintion ssy, we i not oserve iret uiquitintion of TRAF6 y reominnt Pellino3. This my e ue to reominnt Pellino3 lking some prerequisite moifition or nillry protein to mnifest its E3 ligse tivity to TRAF6. Inee the E3 ligse tlyti tivity of Pellino proteins is strongly enhne y phosphoryltion 8, n in the ontext of TLR3 signling it is espeilly interesting to note tht Pellino1 is inue n tivte y TBK1 n IKKi 6. We showe here tht the expression of Pellino3 similrly epens on TBK1-IKKi. Thus it is plusile to extrpolte moel where TLR3 signling uses TBK1 n IKKi, in n nlogous mnner to Pellino1, to phosphorylte n tivte Pellino3, thus leing to uiquitintion of TRAF6. We lso propose tht Pellino3-meite uiquitintion of TRAF6 negtively influenes the ility of TRAF6 to uiquitinte. Although the uiquitintion of TRAF6 hs een originlly propose to serve to ring TAK1 n IKK omplexes into lose proximity, thus llowing for IKK tivtion n ownstrem tivtion of NF-κB 3, this moel hs een questione reently. Thus, mutnt form of TRAF6 tht is refrtory to uiquitintion n still trigger tivtion of NF-κB, n TRAF6 n generte unnhore polyuiquitin hins to trigger ownstrem tivtion of NF-κB. We now propose new role for uiquitintion of TRAF6 in tht it suppresses the uiquitintion of y eresing the intertion of TRAF6 with. It is intriguing tht Pellino3 shoul ounterregulte interferon expression y trgeting the TRAF6- intertion, s the Thogoto virus uses its ML protein s virulene ftor to inhiit the expression of type I interferons y lso loking the intertion of TRAF6 with (ref. 6). This highlights ritil involvement for TRAF6-meite uiquitintion of in the inution of type I interferons. Given suh n importnt role, it is not surprising tht physiologil regultory system moultes this prt of the pthwy to ontrol type I interferon expression, wheres viruses trget this pthwy to suvert ntivirl innte immunity. Pellino proteins re very highly onserve throughout evolution, n so the notion of Pellino gene eing evolutionrily retine to ounter key ntivirl strtegy of prouing type I interferon ppers ounterintuitive. However, the expression of type I interferons must e tightly ontrolle euse exessive proution n ontriute to utoimmune inflmmtory iseses 7. It will e interesting to explore whether nturlly ourring efetive forms or expression of Pellino3 my provie geneti sis to some ses of interferon-riven inflmmtory isese. Suh stuies in onjuntion with the present finings will help unerstn the physiologil n pthologil roles of the Pellino fmily. Methos Methos n ny ssoite referenes re ville in the online version of the pper. nture immunology VOLUME 13 NUMBER 11 NOVEMBER 1 161

8 Note: Supplementry informtion is ville in the online version of the pper. Aknowlegments This work ws fune y Siene Fountion Ireln (7/IN.1/B97) n the Helth Reserh Bor of Ireln (uner grnt PhD/7/9). We thnk B. Clok n S.Worrell for tehnil ssistne with photomirosopy, n M. Hely for ssistne with flow ytometry. AHOR CONTRIBIO J.S., R.J. n M.M. evelope the onept, esigne n performe experiments, nlyze t n prepre the figures; N.D., S.Y., B.W. n L.S.T. esigne n performe experiments n nlyze t; J.J.C. performe generl pthology sreening n the pthology-relte experiments on hert smples; B.P.M. esigne n supervise the infetion stuies; P.N.M. oneive the stuy, supervise the projet, nlyze t n wrote the mnusript. COMPETING FINANCIAL INTERESTS The uthors elre no ompeting finnil interests. Pulishe online t Reprints n permissions informtion is ville online t reprints/inex.html. 1. Moyngh, P.N. TLR signlling n tivtion of IRFs: revisiting ol friens from the NF-κB pthwy. Trens Immunol. 6, ().. Mezhitov, R. et l. MyD88 is n ptor protein in the htoll/il-1 reeptor fmily signling pthwys. Mol. Cell, 3 8 (1998). 3. Li, S., Strelow, A., Fontn, E.J. & Weshe, H. IRAK-: novel memer of the IRAK fmily with the properties of n IRAK-kinse. Pro. Ntl. A. Si. USA 99, 67 7 ().. Co, Z., Xiong, J., Tkeuhi, M., Kurm, T. & Goeel, D.V. TRAF6 is signl trnsuer for interleukin-1. Nture 383, 3 6 (1996).. Suzuki, N. et l. Severe impirment of interleukin-1 n Toll-like reeptor signlling in mie lking IRAK-. Nture 16, 7 76 (). 6. Wng, C. et l. TAK1 is uiquitin-epenent kinse of MKK n IKK. Nture 1, (1). 7. Moyngh, P.N. The NF-κB pthwy. J. Cell Si. 118, 89 9 (). 8. Ymmoto, M. et l. Cutting ege: novel Toll/IL-1 reeptor omin-ontining pter tht preferentilly tivtes the IFN-β promoter in the Toll-like reeptor signling. J. Immunol. 169, (). 9. Cusson-Hermne, N., Khurn, S., Lee, T.H., Fitzgerl, K.A. & Kelliher, M.A. Rip1 meites the Trif-epenent toll-like reeptor 3- n -inue NF-κB tivtion ut oes not ontriute to interferon regultory ftor 3 tivtion. J. Biol. Chem. 8, (). 1. Meyln, E. et l. RIP1 is n essentil meitor of Toll-like reeptor 3-inue NF-κB tivtion. Nt. Immunol., 3 7 (). 11. Ssi, M. et l. Diret ining of TRAF n TRAF6 to TICAM-1/TRIF ptor prtiiptes in tivtion of the Toll-like reeptor 3/ pthwy. Mol. Immunol. 7, (1). 1. Sto, S. et l. Toll/IL-1 reeptor omin-ontining ptor inuing IFN-β (TRIF) ssoites with TNF reeptor-ssoite ftor 6 n TANK-ining kinse 1, n tivtes two istint trnsription ftors, NF-κB n IFN-regultory ftor-3, in the Toll-like reeptor signling. J. Immunol. 171, 3 31 (3). 13. Jing, Z., Mk, T.W., Sen, G. & Li, X. Toll-like reeptor 3-meite tivtion of NF-κB n IRF3 iverges t Toll-IL-1 reeptor omin-ontining pter inuing IFN-β. Pro. Ntl. A. Si. USA 11, (). 1. Goh, J., Mtsumur, T. & Inoue, J. Cutting ege: TNFR-ssoite ftor (TRAF) 6 is essentil for MyD88-epenent pthwy ut not toll/il-1 reeptor ominontining ptor-inuing IFN-β (TRIF)-epenent pthwy in TLR signling. J. Immunol. 173, (). 1. Hker, H. et l. Speifiity in Toll-like reeptor signlling through istint effetor funtions of TRAF3 n TRAF6. Nture 39, 7 (6). 16. Fitzgerl, K.A. et l. IKKε n TBK1 re essentil omponents of the IRF3 signling pthwy. Nt. Immunol., (3). 17. Stetson, D.B. & Mezhitov, R. Type I interferons in host efense. Immunity, (6). 18. Theofilopoulos, A.N., Bl, R., Beutler, B. & Kono, D.H. Type I interferons (α/β) in immunity n utoimmunity. Annu. Rev. Immunol. 3, (). 19. Moyngh, P.N. The Pellino fmily: IRAK E3 ligses with emerging roles in innte immune signlling. Trens Immunol. 3, 33 (9).. Shuvliege, R., Jnssens, S. & Beyert, R. Pellino proteins: novel plyers in TLR n IL-1R signlling. J. Cell. Mol. Me. 11, 3 61 (7). 1. Lin, C.C., Huoh, Y.S., Shmitz, K.R., Jensen, L.E. & Ferguson, K.M. Pellino proteins ontin rypti FHA omin tht meites intertion with phosphorylte IRAK1. Struture 16, (8).. Shuvliege, R., Jnssens, S. & Beyert, R. Pellino proteins re more thn sffol proteins in TLR/IL-1R signlling: role s novel RING E3-uiquitin-ligses. FEBS Lett. 8, (6). 3. Butler, M.P., Hnly, J.A. & Moyngh, P.N. Kinse-tive interleukin-1 reeptorssoite kinses promote polyuiquitintion n egrtion of the Pellino fmily: iret eviene for PELLINO proteins eing uiquitin-protein isopeptie ligses. J. Biol. Chem. 8, (7).. Orureu, A. et l. The IRAK-tlyse tivtion of the E3 ligse funtion of Pellino isoforms inues the Lys63-linke polyuiquitintion of IRAK1. Biohem. J. 9, 3 (8).. Smith, H. et l. Ientifition of the phosphoryltion sites on the E3 uiquitin ligse Pellino tht re ritil for tivtion y IRAK1 n IRAK. Pro. Ntl. A. Si. USA 16, 8 9 (9). 6. Smith, H. et l. The role of TBK1 n IKKepsilon in the expression n tivtion of Pellino 1. Biohem. J. 3, 37 8 (11). 7. Goh, E.T. et l. Ientifition of the protein kinses tht tivte the E3 uiquitin ligse Pellino 1 in the innte immune system. Biohem. J. 1, (1). 8. Strelow, A., Kollewe, C. & Weshe, H. Chrteriztion of Pellino, sustrte of IRAK1 n IRAK. FEBS Lett. 7, (3). 9. Kim, J.H. et l. Pellino-1, n ptor protein of interleukin-1 reeptor/toll-like reeptor signling, is sumoylte y U9. Mol. Cells 31, 8 89 (11). 3. Jing, Z. et l. Pellino 1 is require for interleukin-1 (IL-1)-meite signling through its intertion with the IL-1 reeptor-ssoite kinse (IRAK)-IRAKtumor nerosis ftor reeptor-ssoite ftor 6 (TRAF6) omplex. J. Biol. Chem. 78, (3). 31. Yu, K.Y. et l. Cutting ege: mouse pellino- moultes IL-1 n lipopolyshrie signling. J. Immunol. 169, 7 78 (). 3. Jensen, L.E. & Whitehe, A.S. Pellino tivtes the mitogen tivte protein kinse pthwy. FEBS Lett., 199 (3). 33. Jensen, L.E. & Whitehe, A.S. Pellino3, novel memer of the Pellino protein fmily, promotes tivtion of -Jun n Elk-1 n my t s sffoling protein. J. Immunol. 171, 1 16 (3). 3. Butler, M.P., Hnly, J.A. & Moyngh, P.N. Pellino3 is novel upstrem regultor of p38 MAPK n tivtes CREB in p38-epenent mnner. J. Biol. Chem. 8, (). 3. Chng, M., Jin, W. & Sun, S.C. Peli1 filittes TRIF-epenent Toll-like reeptor signling n proinflmmtory ytokine proution. Nt. Immunol. 1, (9). 36. Chng, M. et l. The uiquitin ligse Peli1 negtively regultes T ell tivtion n prevents utoimmunity. Nt. Immunol. 1, 1 19 (11). 37. Moyngh, P.N. Peli1 (rel)ieves utoimmunity. Nt. Immunol. 1, (11). 38. Gitlin, L. et l. Essentil role of m- in type I IFN responses to polyrioinosini: polyrioytiyli i n enephlomyoritis piornvirus. Pro. Ntl. A. Si. USA 13, (6). 39. Hrrson, H.S. et l. Toll-like reeptor 3 is n essentil omponent of the innte stress response in virus-inue ri injury. Am. J. Physiol. Hert Cir. Physiol. 9, H1 H8 (7).. Kwi, T. et l. Interferon-lph inution through Toll-like reeptors involves iret intertion of with MyD88 n TRAF6. Nt. Immunol., (). 1. Ning, S., Cmpos, A.D., Drny, B.G., Bentz, G.L. & Pgno, J.S. TRAF6 n the three C-terminl lysine sites on re require for its uiquitintion-meite tivtion y the tumor nerosis ftor reeptor fmily memer ltent memrne protein 1. Mol. Cell. Biol. 8, (8).. Konno, H. et l. TRAF6 estlishes innte immune responses y tivting NF-κB n upon sensing ytosoli virl RNA n DNA. PLoS ONE, e67 (9). 3. Chen, Z.J. Uiquitin signlling in the NF-κB pthwy. Nt. Cell Biol. 7, ().. Wlsh, M.C., Kim, G.K., Murizio, P.L., Molnr, E.E. & Choi, Y. TRAF6 utouiquitintion-inepenent tivtion of the NF-κB n MAPK pthwys in response to IL-1 n RANKL. PLoS ONE 3, e6 (8).. Xi, Z.P. et l. Diret tivtion of protein kinses y unnhore polyuiquitin hins. Nture 61, (9). 6. Buettner, N. et l. Thogoto virus ML protein is potent inhiitor of the interferon regultory ftor-7 trnsription ftor. J. Gen. Virol. 91, 7 (1). 7. Chouey, D. & Mougil, K.D. Interferons in utoimmune n inflmmtory iseses: regultion n roles. J. Interferon Cytokine Res. 31, (11). 16 VOLUME 13 NUMBER 11 NOVEMBER 1 nture immunology

9 ONLINE METHODS Plsmis n regents. Mouse Pellino3 ws lone from emryo rin n into the retrovirl MSCV.-IRES-GFP vetor. Humn TRAF6 C7A n K1R mutnts n Trf6 / MEFs were from A. Bowie (Trinity College Dulin). Immortlize wil-type, Tim1 /, Tk1 / n Ikke / BMDMs were from K. Fitzgerl (University of Msshusetts Meil Shool). FLT3 lign ws from C. Jefferies (Royl College of Surgeons Ireln). Anti-TRAF6 (s-71), nti-uiquitin (PD1), nti-irf3 (s-98) n nti- (F-1) ntioies for oimmunopreipittion were from Snt Cruz Biotehnology. The nti- ntioy (19) for immunolotting ws from Am. Anti-phospho IκBα (96), nti-phospho IKK (69), nti-ikk (68), nti-phospho TBK1 (DC), nti-tbk1 (313), nti-phospho IRF3 (DG), nti-phospho (18) n nti-my (9B11) ntioies were from Cell Signling Tehnology. The nti phospho-serine ntioy (AB163) ws from Millipore. The nti β-tin ntioy (AC-1) ws from Sigm. The ustomize nti-humn Pellino3 ntioy ws from GenSript. ws from Enzo Life Sienes n other TLR ligns were from Invivogen. Mie. Peli3 / mie were generte y Toni Artemis using proprietry tehnology (Supplementry Fig. 1). To generte onstitutive Peli3 / mie, mie tht were heterozygous for the trgete llele were re with mie ontining Cre reominse regulte y the Ros6 lous (C7BL/6 Gt(ROSA)6Sortm16 (Cre)Arte). This results in the eletion of exon 3 n loss of funtion of the Peli3 gene y generting frme shift in ll ownstrem exons. The Cre trnsgene ws remove y reeing the resulting Peli3 +/ mie with C7BL/6 mie uring olony expnsion. Mie were genotype y PCR nlysis of DNA isolte from er punhes using primers, CCCAACATAGGTGTTTCCTCTCC;, GTGCATACACATTCATGCAAGC;, GACACGTGTGGAGATAATGAGG; n, ACCCAGGCACAAGTCAAGC. All niml experiments were performe in orne with the regultions n guielines of the Irish Deprtment of Helth n protools pprove y the Reserh Ethis ommittee of Ntionl University of Ireln Mynooth. infetion. We injete PFU or PFU of intrperitonelly into 6-week-ol wil-type or Peli3 / mie. The y of virus inoultion ws efine s y. Mie tht eme moriun were onsiere to hve rehe the en point of the experiment n were kille. Mie were kille 1 or 1 fter infetion, n rtio of hert weight to oy weight ws mesure. Herts were then fixe, setione t µm n stine with hemtoxylin n eosin. The pthologist (J.J.C.) ws line to the geneti n infetious sttus of the mie. For ytokine n replise nlysis, mie were inoulte with PFU) n llowe reover for. Mie were kille n totl RNA ws extrte from tissue using TRI regent (Sigm). Cell ulture. Peli3 +/ mie were re to generte wil-type n Peli3 / emryos n MEFs. Bone mrrow ells were mintine in mrophge-olony stimulting ftor (M-CSF; ng/ml) for 7, or grnuloyte mrophgeolony stimulting ftor (GM-CSF; 1 ng/ml) or Fms-relte tyrosine kinse 3 lign (FLT3L; 1 ng/ml) for 8 1 to generte BMDMs, mdc or pdc ells, respetively. pdcs were enrihe using pdc isoltion kit (Miltenyi Biote). Purity of mdcs (~9% CD11 + CD11 + CDR/B ) n pdcs (~9% CD11 + CD11 CDR/B + ) ws ssye y flow ytometry using nti- CD11 (N18), nti-cd11 (M1/7) n nti-cdr/b (RA3-6B) on live ells s etermine y 7-AAD Viility Stining Solution (ebiosiene). Genertion of peritonel exute ells (PECs). Age-mthe n weightmthe wil-type n Peli3 / mie were injete intrperitonelly with 1 mg/kg poly(i:c) for 8 h. PECs were isolte n reltive expression of mrnas enoing IFN-β, RANTES n TNF ws etermine y quntittive rel-time RT-PCR. ELISA n type I interferon iossy. Mouse ells were seee ( 1 ells/ml; µl) in 96-well pltes n stimulte s inite. Conitione meium ws mesure for levels of TNF, IL-6 (DuoSet kits; R&D Systems), CXCL1 (ELISA evelopment kit; Peproteh) n IFN-α (mouse IFN α Pltinum ELISA; ebiosiene) n mouse type I interferon y lue sensor ells (Invitrogen) oring to mnufturer s instrutions. IFN-β protein levels were ssye y n in-house snwih ELISA system. Conitione superntnts from U373 shrna stle ell lines were ssye for RANTES, CXCL1 n IL-6 (DuoSet kits; R&D Systems). Elerophoreti moility shift ssy. MEFs were grown in 6-well pltes for h. Cells were then stimulte with µg/ml poly(i:c). Nuler extrts were generte s previously esrie 8 n inute with n oligonuleotie ontining the IFN-β PRD I/III-ining site -GTAAATGACATAGGAAAA CTGAAAGGGAGAAGTGAAAGTGG-3 n lele with IRDye 7 oring to the mnufturer s instrutions. Immunopreipittion stuies. Primry MEFs or mdcs were seee in ell-ulture 9-mm ishes ( 1 ells/ml or ells/ml, respetively) n stimulte with poly(i:c) for esignte times. Cells were wshe in 1 ml of ie-ol PBS n lyse in µl of rioimmunopreipittion (RIPA) uffer: mm Tris, 1 mm NCl,.1% SDS (w/v),.% soium eoxyholte (w/v), 1% Triton X-1 (v/v) ontining 1 mm N 3 VO, 1 mm ithiothreitol, 1 mm phenylmethylsulfonyl fluorie n omplete protese inhiitor mixture (Rohe). Cell lystes were trete with 1% SDS n inute t 9 C for min to issoite protein-protein intertions. Smples were then ilute tenfol with lysis uffer efore immunopreipittion n immunolotting using inite ntioies. Coimmunopreipittion stuies. MEFs or U373 ells were seee in 9-mm ishes ( 1 ells/ml) n stimulte with poly(i:c) for inite urtions. Cells were wshe in 1 ml ie-ol PBS n lyse in µl of lysis uffer ( mm Hepes ph 7., 1 mm EDTA, 1% glyerol (v/v),.% CHAPS (w/v),.% Triton X-1 (v/v), mm NCl ontining 1 mm N 3 VO, 1 mm ithiothreitol, 1 mm phenylmethylsulfonyl fluorie n omplete protese inhiitor mixture). Lystes were proesse s esrie ove for immunopreipittion stuies. Trnsfetion n luiferse reporter ssys. In ll trnsfetion-se stuies (inluing knokown experiments with nm sirna n µg/ml shrna) in HEK93 ells we use Lipofetmine (Invitrogen) oring to the mnufturer s instrutions. For luiferse reporter ssys, HEK93 TLR3 ells were seee (1. 1 ells/ml; µl) in 96-well pltes n trnsfete with onstruts enoing IFN-β, IFN-α or PRDI-III regulte firefly luiferse (8 ng) or pfr firefly luiferse reporter onstrut (6 ng) with Gl- IRF3 (3 ng) or Gl- ( ng), TK Renill luiferse reporter onstrut (phrl-tk; ng; Promeg Biosienes) n Pellino3 expression onstruts (1 ng). Totl DNA ws kept onstnt ( ng/well) using the pproprite empty vetor. Cells were trete s inite n ell lystes ssye for firefly luiferse tivity n normlize for trnsfetion effiieny using TK Renill luiferse tivity. For stuies using trnsfetion-meite elivery of poly(i:c), BMDMs were seee ( 1 ells/ml; µl) in 96-well pltes n grown for h. Cells were then trnsfete using Lipofetmine with µg/ml poly(i:c) n inute for h. Conitione superntnt ws ssye y ELISA. Lentivirl proution n trnsution. PELI3-speifi shrna ws use to suppress enogenous expression of Pellino3 in U373 ells s previously esrie 9. Knokown effiieny ws ssesse y RT-PCR. Retrovirl proution n trnsution. MEFs were seee (3 1 ells/ml; 3 ml) into 6-well pltes (for quntittive PCR) or in 9 mm ishes (for immunopreipittion) n were trnsue with MSCV retrovirl plsmi enoing mouse (m)pellino3 or the mpellino3 RING mutnt s esrie 9. Quntittive PCR. RNA ws extrte from ells using Tri-Regent (Sigm) n DNA generte using AMV reverse trnsriptse (Promeg). Smples were ssye y quntittive rel time PCR using the CFB- 31G Option therml yler (Bio-R Lortories) with Brillint SYBR Green QPCR mster mix (Strtgene) n the following primers: mifn-α forwr, GGCTTGACACTCCTGGTACAAATGAG; mifn-α reverse, CAGCACATTGGCAGAGGAAGACAG; hifn-α forwr, GAA ATACTTCCAAAGAATCACTCT; hifn-α reverse, GATCTCATGATTT oi:1.138/ni.9 nture immunology