Farnesoid X receptor inhibits glucagon-like peptide-1 production by enteroendocrine L cells

Transcription

1 Reeive 27 Mr 215 Aepte 25 My 215 Pulishe 2 Jul 215 DOI: 1.138/nomms8629 Frnesoi X reeptor inhiits glugon-like peptie-1 proution y enteroenorine L ells Mohme-Smi Trelsi 1,2,3,4, Mehi Doui 1,2,3,4, Jnne Prwitt 1,2,3,4, Srh Dustel 1,2,3,4,Véronique Touhe 1,2,3,4, Sm I. Syin 5,6, Alessi Perino 7, Cheryl A. Brighton 8, Ysmine Seti 1,2,3,4,Jérôme Kluz 2,9, Olivier Brin 1,2,3,4,Hélène Dehont 1,2,3,4, Emmnuelle Vllez 1,2,3,4, Emilie Dorhies 1,2,3,4,Grégory Bu 1,2,1,11, Vleri Spinelli 1,2,3,4, Nthlie Hennuyer 1,2,3,4, Snrine Cron 1,2,3,4, Kiomo Bntuungi 1,2,3,4, Roert Cizzo 1,2,1,11, Frnk Reimnn 8, Philippe Mrhetti 2,9, Philippe Lefevre 1,2,3,4, Frerik Bäkhe 5,6,12, Fion M. Grile 8, Kristin Shoonjns 7, Frn ois Pttou 1,2,1,11, Anne Tilleux 1,2,3,4, Brt Stels 1,2,3,4 & Sophie Lestvel 1,2,3,4 Bile is re signlling moleules, whih tivte the trnsmemrne reeptor TGR5 n the nuler reeptor FXR. BA sequestrnts (BAS) omplex ile is in the intestinl lumen n erese intestinl FXR tivity. The BAS BA omplex lso inues glugon-like peptie-1 (GLP-1) proution y L ells whih potentites -ell gluose-inue insulin seretion. Whether FXR is expresse in L ells n ontrols GLP-1 proution is unknown. Here, we show tht FXR tivtion in L ells ereses proglugon expression y interfering with the gluose-responsive ftor Crohyrte-Responsive Element Bining Protein (ChREBP) n GLP-1 seretion y inhiiting glyolysis. In vivo, FXR efiieny inreses GLP-1 gene expression n seretion in response to gluose hene improving gluose metolism. Moreover, tretment of o/o mie with the BAS olesevelm inreses intestinl proglugon gene expression n improves glyemi in FXR-epenent mnner. These finings ientify the FXR/GLP-1 pthwy s new mehnism of BA ontrol of gluose metolism n phrmologil trget for type 2 ietes. 1 Europen Genomi Institute for Dietes (EGID), FR 358, Lille F-59, Frne. 2 Université e Lille, Lille F-59, Frne. 3 INSERM UMR 111, Lille F-59, Frne. 4 Institut Psteur e Lille, Lille F-59, Frne. 5 Wllenerg Lortory/Shlgrensk Center for Criovsulr n Metoli Reserh, Shlgrensk University Hospitl, Gothenurg , Sween. 6 Deprtment of Moleulr n Clinil Meiine, University of Gothenurg, Gothenurg 41345, Sween. 7 Institute of Bioengineering, Shool of Life Sienes, Eole Polytehnique Féérle e Lusnne, Lusnne CH-115, Switzerln. 8 Cmrige Institute for Meil Reserh n Institute of Metoli Sienes, Aenrooke s Hospitl, Hills Ro, Cmrige CB2 XY, UK. 9 INSERM U 837, Lille Ceex F- 5945, Frne. 1 Centre e Bio-Pthologie, Plte-forme e Biothérpie, Bnque e Tissus, Centre Hospitlier Régionl Universitire, Lille F-59, Frne. 11 INSERM UMR 859, Lille F-59, Frne. 12 Setion for Metoli Reeptology n Enteroenorinology, Novo Norisk Fountion Center for Bsi Metoli Reserh, Fulty of Helth Sienes, University of Copenhgen, Copenhgen 22, Denmrk. Corresponene n requests for mterils shoul e resse to B.S. (emil: rt.stels@psteur-lille.fr). NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

2 NATURE COMMUNICATIONS DOI: 1.138/nomms8629 Bile is (BAs) re mphipthi moleules erive from holesterol, synthesize n onjugte in the liver, store in the glller, expelle in the intestinl lumen fter mel ingestion n further metolize y the gut miroiot into seonry BAs. Initilly onsiere to e ietry lipi etergents, BAs re now reognize s signlling moleules whih, through ining n tivtion of the memrne reeptor TGR5, the nuler reeptors vitmin D reeptor, Pregnne X Reeptor n Frnesoi X Reeptor (FXR, NR1H4), ply key roles in the ontrol of energy homeostsis 1. Seonry ile is re more potent ligns for TGR5 (ffinity for TGR5: LCA4DCA4CDCA4CA) thn for FXR (ffinity for FXR: CDCA4DCA ¼ LCA4CA) (for review, see refs 1,2). TGR5, G protein-ouple reeptor, first esrie s regultor of ytokine proution in humn monoyte ell line 3, ws lso shown to promote glugon-like peptie-1 (GLP-1) seretion in response to BA y intestinl enteroenorine L ells 4. Although representing o1% of the intestinl epithelil ells, enteroenorine ells ply key roles in the regultion of energy metolism through their pity to serete vrious io-tive pepties. After foo ingestion, the inretins GLP-1 n gluoseepenent insulinotropi polypeptie re serete y L n K ells, respetively, n susequently potentite postprnil insulin seretion y pnreti ells in response to gluose, the so-lle inretin effet 5. Even though the insulinotropi property of GLP-1 is mintine, its seretion in response to mel is erese in type 2 ieti ptients 6,7. This oservtion hs le to the evelopment of DPP-IV inhiitors tht inrese GLP-1 hlf-life n GLP-1 mimetis, whih improve gluose homeostsis with less risk for hypoglyemi. Together with TGR5, FXR ontrols BA-inue signlling pthwys. FXR, preominntly expresse in the liver n intestine, ws first ientifie s regultor of hepti BA metolism through the inution of smll heteroimer prtner (SHP) in the liver n firolst growth ftor 15 (FGF15) in the intestine, resulting in the susequent inhiition of the rte-limiting enzyme in hepti BA synthesis, holesterol 7-hyroxylse (CYP7A1) n the regultion of BA trnsporters (for review, see refs 8,9). FXR in the liver lso plys moultory role in the regultion of lipi n gluose homeostsis. FXR tivtion with the syntheti gonist GW464 ereses hepti gluoneogeni gene expression n inreses glyogenesis 1 thus improving gluose homeostsis in ieti mie. In the postprnil stte, FXR tivtion in heptoytes lso inhiits the inution of glyolyti gene expression y gluose through negtive interferene with the rohyrte response element ining protein ChREBP (lso known s MlxIPL) 11,12. Reent stuies hve highlighte metoli role of non-hepti n speifilly intestinl FXR in mie uner pthophysiologil onitions suh s oesity Inee, orl tretment of high-ft-iet-fe mie with GW464 promotes hyperglyemi n oesity 13, wheres n opposite effet is oserve upon intrperitonel injetion of the rug 1. Moreover, in two ifferent moels of oesity, whole-oy FXR efiieny improve metoli prmeters, n effet not oserve in heptoytespeifi FXR-efiient nimls 14. Furthermore, intestinl speifi FXR-efiient mie re protete ginst iet-inue oesity n non-loholi ftty liver isese 15,16. These stuies lso ientifie ruil role of the intestinl miroiot in BA signlling y regulting the rtio of BAs with gonist or ntgonist tivity on FXR. Inee, the primry BA turo et-muriholi i (TMCA), whose levels re elevte in germ-free (GF) mie, ts s n FXR ntgonist to improve gluose metolism vi intestinl FXR 15,17. Finlly, BA pool omposition is moulte y BA sequestrnts (BAS) (for review, see ref. 18). BAS, suh s olesevelm, re nion exhnge resins tht trp BAs in the intestinl lumen. Initilly use for their holesterol-lowering effets, they hve more reently een shown to t s ntiieti rugs 2,14,19. In ieti / mie, BAS ministrtion etivtes intestinl FXR n inreses gluose lerne in peripherl tissues 19. Among the propose tion mehnism of BAS is TGR5-meite inrese of GLP-1 seretion in ietinue oese mie 2,21. In ition to their ute effets on GLP-1 seretion, BAS-oun BAs enhne proglugon gene expression through TGR5, nother mehnism vi whih this trnsmemrne reeptor regultes GLP-1 proution 2. Whether FXR is expresse n plys role in L ells hs not een reporte yet. Using the murine GLUTg L ell line, humn intestinl iopsies n ifferent mouse moels, we emonstrte tht FXR is expresse n funtionl in enteroenorine L ells. In mie n in humn ex vivo intestinl iopsies, tivte FXR ownregultes proglugon mrna levels. In vitro, FXR tivtion ereses oth proglugon mrna n protein levels y interfering with ChREBP-meite gluose-inution of proglugon mrna levels. FXR tivtion lso inhiits the glyolysis pthwy trnslting into erese intrellulr ATP levels, ontriuting to erese GLP-1 seretion in response to gluose. In vivo, FXR efiieny inreses proglugon mrna levels n gluose-inue GLP-1 seretion in how iet-fe mie, wheres the protetive effet of FXR efiieny on glyemi ontrol in high-ft-fe mie is lunte y the GLP-1 reeptor (GLP-1R) ntgonist Exenin-4(9-39). Finlly, tretment of o/o mie with olesevelm improves glyemi t lest in prt y n FXR-epenent inrese of proglugon mrna levels. Results FXR ereses proglugon mrna levels in mie n humns. Previous stuies hve reporte high expression of FXR in intestinl epithelil ells 22,23. However, its expression in enteroenorine L ells hs not yet een ssesse. We nlyse Fxr expression in L ells sorte y fluoresene-tivte ell sorting (FACS) from trnsgeni proglugon-venus mie 24,25. FACS-sorte L þ ells were seprte from L ells with purity 495% (ref. 24). As expete, the Fxr gene is more unntly expresse in ilel non-l ells (ileum L ) thn in oloni non-l ells (olon L ) (Fig. 1). Surprisingly, ompre with non-l ells, Fxr expression is higher in L ells from the ileum (ileum L þ ) n, leit nonsignifintly, the olon (olon L þ ) (Fig. 1). Confol mirosopy nlysis on humn intestinl iopsies revel tht FXR is expresse in GLP-1-positive ells from the jejunum (Fig. 1, Supplementry Movie 1) n olon (Supplementry Fig. 1). To ssess whether FXR tivtion ontrols the proution of GLP-1, one of the mjor io-tive pepties proue y L ells, 8-week-ol C57Bl6-J wil-type mie were ily trete y gvge with the FXR gonist GW464 (3 mpk) for 5 ys. As expete Fgf15 mrna levels inrese fter FXR gonist tretment (Supplementry Fig. 1), wheres proglugon mrna levels erese in oth the ileum n olon (Fig. 1). Sine tretment with GW464 moultes the ile i pool omposition leing to lower mount of TGR5 tivtors 13, proglugon mrna levels were mesure in intestines of Tgr5 / mie trete uring 5 ys with GW464 (3 mpk). FXR tivtion signifintly ereses proglugon mrna levels in the ileum of Tgr5 / mie n to lesser extent in the olon, suggesting rosstlk etween FXR n TGR5 in the olon, ut not the ileum (Fig. 1). This fining is onsistent with elevte levels of seonry BA tht tivte TGR5 in the olon. In ition, primry murine intestinl epithelil ells trete ex vivo with GW464 (5 mmol l 1 ) lso exhiite erese proglugon mrna levels 2 NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

3 NATURE COMMUNICATIONS DOI: 1.138/nomms8629 ARTICLE 3. Fxr 2. DAPI FXR L L+ L L+ Ileum Colon GLP-1 FXR/GLP-1/DAPI 2..5 Vehile GW464.5 TGR5KO-Veh TGR5KO-GW464 Ileum Colon Ileum Colon e.5 GW464 f.5 GW464 Figure 1 FXR ereses proglugon mrna levels in mie n in humn. () Fxr expression y qpcr in FACS-sorte proglugon-negtive n proglugon-positive ells from the ileum (ileum L ; ileum L þ ) n olon (olon L ; olon L þ ) of GLU-VENUS mie (n ¼ 3). () Twelve-mirometre-thik slies from humn jejunl iopsies were inute with ntioies ginst FXR (in green) n GLP-1 (in re). Nulei re in lue. Co-expression in GLP-1-positive ells (otte line) ws ssesse on onfol mirosope. Representtive of three ifferent FXR/GLP-1 immunostining experiments. Sle r, 2 mm. qpcr on DNA from ileum n olon of 8-week-ol wil-type () or Tgr5 / () mie trete y gvge for 5 ys with GW464 (3 mpk; n ¼ 5 mie per group. Dt re represente s men ±s.. (e) qpcr on DNA from isolte primry intestinl epithelil ells from two wil-type mie ex vivo trete for 24 h with or with GW464 (5 mmol l 1 ). (f) qpcr on DNA of humn jejunl iopsies from four normoglyemi ptients ex vivo trete for 16 h with or with GW464 (5 mmol l 1 ). Dt re represente s men ± s.e.m. Stuent s t-test, Pr5, Pr1 n Pr1. (Fig. 1e) showing tht in ition to hnges in ile i pool omposition, FXR tivtion iretly ereses proglugon gene expression. As FXR is lso expresse in humn intestinl L ells (Fig. 1), humn jejunl iopsies were trete with GW464 (5 mmol l 1 ). FXR tivtion results in the expete inution of mrna levels of FGF19, the humn FGF15 orthologue (Supplementry Fig. 1), wheres proglugon gene expression ereses (Fig. 1f). FXR tivtion ereses proglugon expression in vitro. To stuy the mehnisms unerlying the regultion of proglugon gene expression y FXR, the well-hrterize murine L-ell moel GLUTg ws use 26,27. FXR mrna (Fxr Ct ¼ 28; ylophilin Ct ¼ 22) n protein re expresse n enrihe in the nuler frtion (Fig. 2). Moreover, inution of GLUTg ells with inresing onentrtions of GW464 results in the inution of the FXR trget genes Shp (Fig. 2) n Fgf15 (Fig. 2). Similr s in humn n murine heptoytes 11,28, GW464 tretment (5 mmol l 1 ) inreses FXR mrna n protein expression, wheres sirna knokown of FXR ereses 45% FXR mrna (Fig. 2) n protein levels (Fig. 2e). The inution of Fgf15 y GW464 ereses y 1-fol in -trnsfete GLUTg ells (Fig. 2f). Altogether, these t inite the presene of funtionl FXR in GLUTg ells. Inution of GLUTg ells for 24 h with inresing onentrtions of GW464 or with GW464 (5 mmol l 1 ) for ifferent times in stnr ulture gluose onentrtions (5.6 mmol l 1 ) ereses proglugon mrna levels in ose- n timeepenent mnner with mximum effet t 5 mmol l 1 (Fig. 3), onentrtion often use to stuy FXR tivtion 12,28, fter 24 h of tretment (Fig. 3). Moreover, similr erese is oserve with the nturl FXR lign henoeoxyholi i (CDCA, 1 mmol l 1 ) (Supplementry Fig. 2). Using primer omintion overing exon 2 to intron 2 of the proglugon gene, similr erese of proglugon pre-mrna levels is oserve, suggesting tht FXR negtively regultes proglugon gene trnsription (Supplementry Fig. 2). GW464 inution NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

4 NATURE COMMUNICATIONS DOI: 1.138/nomms kd MW HepG2 Tot. Cyt. GLUTg Nu Shp GW464 (.1 μm) GW464 (1 μm) GW464 (5 μm) GW464 (1 μm) Fgf GW464 (.1 μm) GW464 (1 μm) GW464 (5 μm) GW464 (1 μm) 2..5 Fxr GW464 e GW464 FXR /β-tin protein (ritrry unit) FXR + + FXR β-atin GW kd 43 kd f Fgf15 GW464 Figure 2 FXR is expresse n funtionl in GLUTg L ells. () Representtive western lot of four experiments performe with frtione protein extrts from GLUTg ells. Totl proteins from HepG2 re use s ontrol. Shp () n Fgf15 () qpcrs on DNA from GLUTg ells trete for 24 h with GW464 (.1, 1, 5 n 1 mmol l 1 ). Dt re represente s men ± s.. One-wy nlysis of vrine (ANOVA) followe y Tukey s post ho test. Pr5, Pr1 n Pr1 versus (n ¼ 3; performe three times). () Fxr qpcr on DNA from GLUTg ells eletroporte with or n trete for 24 h with GW464 (5 mmol l 1 ; n ¼ 3; performe three times). (e) Representtive western lot of four experiments performe on protein extrts from GLUTg ells eletroporte with or with n trete for 24 h with GW464 (5 mmol l 1 ; upper pnel) n quntifition (lower pnel) of FXR from four western lots (n ¼ 3). (f) Fgf15 qpcr on DNA from GLUTg ells eletroporte with or n trete for 24 h with GW464 (5 mmol l 1 ; n ¼ 3; performe three times). Dt re represente s men ± s.. Two-wy ANOVA nlysis followe y Bonferronni s post ho test. Pr5, Pr1 n Pr1 versus of trnsfetion-mthe onition n yyy Pr1 versus of tretment-mthe onition. ereses proglugon mrna n protein levels in ells, wheres suh erese is not oserve in ells, initing tht FXR is require for the erese of proglugon gene expression upon GW464 tretment (Fig. 3,). FXR inhiits gluose-inue proglugon expression. It hs previously een shown tht gluose inues proglugon gene expression in GLUTg L ells 26. Moreover, in heptoytes, FXR tivtion inhiits the inution of glyolyti n lipogeni genes y gluose 12. To etermine whether FXR tivtion lso inhiits the gluose response in L ells, GLUTg ells were ulture for 12 h in gluose-free meium n susequently inute in meium ontining ltte (1 mmol l 1 ), gluose (5.6 mmol l 1 ) or 2-eoxygluose (5.6 mmol l 1 ; Fig. 4). As expete 26, gluose inreses proglugon gene expression (Fig. 4). 2-Deoxygluose, non-metolise gluose nlogue, oes not inrese proglugon mrna levels, highlighting tht gluose metolism is mntory for the gluose-inue proglugon gene expression. Moreover, FXR tivtion for 24 h with either 4 NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

5 NATURE COMMUNICATIONS DOI: 1.138/nomms8629 ARTICLE.5 GW464 (.1 μm) GW464 (1 μm) GW464 (5 μm) GW464 (1 μm).5 Time (h) GW GW kd.5 GW464 NS /β-tin protein (ritrry unit) β-atin NS 43 kd Figure 3 FXR tivtion ereses proglugon mrna in GLUTg ells. () qpcr on DNA from GLUTg ells trete for 24 h with GW464 (.1, 1, 5 or 1 mmol l 1 ; n ¼ 3; performe three times). Dt re represente s men ± s.. One-wy nlysis of vrine (ANOVA) followe y Tukey s post ho test. Pr1 n Pr1 versus. () qpcr on DNA from GLUTg ells trete for, 6, 12 or 24 h with GW464 (5 mmol l 1 ; n ¼ 3; performe three times). Dt re represente s men ± s.. One-wy ANOVA followe y Tukey s post ho test. Pr1 versus t. () qpcr on DNA from GLUTg ells eletroporte with or n trete for 24 h with GW464 (5 mmol l 1 ). () Representtive western lot of four experiments performe on protein extrts from GLUTg ells eletroporte with or with n trete for 24 h with GW464 (5 mmol l 1 ; upper pnel) n quntifition (lower pnel) of proglugon from four western lots (n ¼ 3). Dt re represente s men ±s.. Two-wy ANOVA nlysis followe y Bonferronni s post ho test. Pr1: effet of GW464 in eh trnsfetion onition. GW464 or CDCA inhiits proglugon gene expression only in L ells inute in stnr (5.6 mmol l 1 ), ut not in low gluose onentrtions (Fig. 4). As ChREBP is gluose-sensitive trnsription ftor tivte y gluose metolites 29 n sine FXR tivtion interferes with the ChREBP-meite inution of glyolyti enzyme gene expression y gluose in heptoytes 12, we next ssesse whether this regultory mehnism is opertionl lso in L ells. Using L ells isolte from GLU-VENUS mie, ChREBP is foun to e expresse t higher levels in L ells thn in non-l ells (Fig. 4). Moreover, ChREBP is lso expresse in GLUTg L-ells (Fig. 4 insert). FXR immunopreipittion from ytoplsmi n nuler protein frtions emonstrtes tht ChREBP n FXR physilly intert or re in the sme omplexes in high gluose onitions (Fig. 4), similr s in heptoytes 12. Finlly, sirna knokown of ChREBP, resulting in Z5% erese of Chrep mrna levels (Supplementry Fig. 3), prevents the inution of proglugon mrna levels y gluose (Fig. 4). FXR tivtion y GW464 inhiits the inrese of proglugon mrna levels y gluose in trnsfete ells, wheres this effet is not oserve in ChREBP knokown ells. Tken together, these t emonstrte tht gluose metolism through the glyolysis pthwy is neessry for the gluose-epenent ChREBP-meite inrese of proglugon gene expression, whih is inhiite upon FXR tivtion. FXR ereses glyolysis n gluose-inue GLP-1 seretion. GLP-1 seretion in response to gluose ours, t lest in prt, through gluose metolism y glyolysis 24,3,31. DNA mirorry followe y Gene Ontology nlysis ws performe on GW464-trete GLUTg ells. Interestingly, GW464 tretment ownregultes the expression of severl glyolyti genes leing to signifint inhiition of this pthwy (P ¼ ; Fig. 5). This erese trnsltes into lower sl n gluose-enhne intrellulr ATP levels (Fig. 5). GW464 tretment oes not erese mitohonril mss s ssesse y the Mitotrker Green ssy (Fig. 5). However, glyolyti pity ssesse y mesurement of the extrellulr iifition rte (ECAR) fter oligomyin tretment is lower in GW464 pre-trete ells (Fig. 5). In prllel, FXR tivtion ereses sl- n ATP-epenent oxygen onsumption rtes (OCR) in GW464-trete ells (Supplementry Fig. 4) likely refleting the erese in tivity of the glol glyolysis pthwy s lso suggeste y the mirorry results. Finlly, FXR tivtion results in lower sl n gluose-inue GLP-1 seretion (Fig. 5e). As GW464 oes not moulte KCl-inue GLP-1 seretion (Fig. 5e), it is unlikely tht FXR moultes eletrogeni events n tht its tion ours rther upstrem of memrne epolriztion. Even though initil reports suggeste tht the SGLT-1/eletrogeni pthwy is the min mehnism y whih gluose inues GLP-1 seretion in primry intestinl NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

6 NATURE COMMUNICATIONS DOI: 1.138/nomms GW464 CDCA 4 Chrep GLUTg WB ChREBP MW Cyt. Nu. -95 kd Ltte Gluose 2-Deoxygluose L L+ L L+ Ileum Colon IP-FXR Gl GW464 5 μm kd- WB ChREBP 55 kd- WB FXR Cyt. Nu Gl GW sichrep Figure 4 FXR inhiits gluose-inue proglugon expression. () qpcr on DNA from GLUTg ells strve for 12 h with ltte (1 mmol l 1 ) n then inute for 24 h in ltte (1 mmol l 1 ), gluose (5.6 mmol l 1 ) or 2-eoxygluose (5.6 mmol l 1 ) mei ontining, GW464 (5 mmol l 1 ) or CDCA (1 mmol l 1 ; n ¼ 3; performe three times). Dt re represente s men ±s.. Two-wy nlysis of vrine (ANOVA) followe y Bonferronni s post ho test. Pr1: effet of GW464 n CDCA on proglugon mrna levels in eh meium onitions. yyy Pr1: effet of gluose on proglugon mrna levels in, GW464 n CDCA onitions. () Chrep qpcr on DNA from FACS-sorte proglugon-negtive n proglugon-positive ells from the ileum (ileum L ; ileum L þ ) n olon (olon L ; olon L þ ) of GLU-VENUS mie (lower pnel; n ¼ 3) n ChREBP protein expression from ytoplsm n nuleus extrt from GLUTg ells (upper pnel; performe three times). Dt re represente s men ±s.. Stuent s t-test. Pr5 n Pr1 () ChREBP n FXR western lots fter FXR immunopreipittion on lystes from ytoplsm n nuleus of GLUTg ells trete or not with GW464 (5 mmol l 1 ) in the presene or not of gluose (5.6 mmol l 1 ; performe two times). () qpcr on DNA from GLUTg ells eletroporte with or sichrep, strve for 12 h with ltte (1 mmol l 1 ) n then inute for 24 h in ltte 1 mmol l 1 (Gl ) or gluose 5.6 mmol l 1 (Gl þ ) mei supplemente with or GW464 (5 mmol l 1 ; n ¼ 3; performe three times). Dt re represente s men ±s.. Two-wy ANOVA nlysis followe y Bonferronni s post ho test. Pr5 n Pr1: effet of tretments on eh trnsfetion onition. yyy Pr1: effet of sichrep in eh tretment onition. epithelil ells 24,27, reent oservtions on perfuse rt ileums inite tht, in ition to the SGLT-1 pthwy, the gluose metolism-meite pthwy ontriutes to the full GLP-1 seretion response to gluose 3,31. Therefore, the response to gluose (5.6 mmol l 1 ) with or without the GLUTs inhiitor phloretin on GLP-1 seretion in murine ilel iopsies ws teste. Gluose lone inues GLP-1 seretion y tissue explnts from vehile-trete mie, wheres o-inution with phloretin ompletely loke the gluose response (Fig. 5f). Moreover, in vivo GW464 tretment (5 ys, 3 mpk) prevents the inrese in gluose-inue GLP-1 seretion y the ileum ex vivo (Fig. 5f), ut is without effet in the presene of phloretin (Fig. 5f), initing tht gluose trnsport y the GLUT-trnsporter ppers mntory for the inhiitory effet of FXR tivtion on the GLP-1 response to gluose. Tken together, these t show tht FXR tivtion ereses the glyolysis pthwy leing to erese ATP levels n lower GLP-1 seretion in response to gluose. Fxr efiieny inreses proglugon mrna n GLP-1 levels. FXR-efiient mie isply elevte proglugon mrna levels in the ileum n olon (Fig. 6) n enhne tive GLP-1 plsm onentrtions 15 min fter orl gluose ministrtion (Fig. 6). Sine onventionlly rise (CONV-R) n GF mie isply ifferent FXR ntgonist:gonist rtios leing to FXR inhiition in GF mie 17, proglugon mrna levels were ompre in CONV-R n GF WT n FXR-efiient mie. As expete 17, Fgf15 gene expression is represse in GF ompre with CONV-R mie, similr to tht in Fxr / mie (Fig. 6). Moreover, CONV-R Fxr / mie isply higher proglugon mrna levels ompre with CONV-R Fxr þ / þ mie (Fig. 6), wheres in GF mie, FXR efiieny no further moultes proglugon mrna levels (Fig. 6). In vitro inution of GLUTg ells with TMCA (1 mmol l 1 ) ereses Fgf15 gene expression (Fig. 6e) n inreses proglugon gene expression (Fig. 6f), suggesting rosstlk etween BA, FXR n miroiot in the regultion of proglugon gene expression in L ells. Thus, moultion of enogenous FXR ligns y the miroiot my influene proglugon gene expression in n FXR-epenent mnner. FXR efiieny improves glyemi through the GLP-1R pthwy. It is well known tht FXR efiieny protets mie ginst iet-inue oesity n improves gluose homeostsis 14,32,33. To test the metoli impt of the FXR/GLP-1 pthwy in pthophysiologil ontext, Fxr þ / þ n Fxr / mie were fe high-ft iet (HFD) uring 6 weeks efore metoli tests with or without the GLP-1R ntgonist Exenin-4(9-39). 6 NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

7 NATURE COMMUNICATIONS DOI: 1.138/nomms8629 ARTICLE Kir6.2 Sur1 Cn1g C 2+ C 2+ DHAP Tpi1 ATP Gl Hk2 Gl6P Gpi1 Fru6P Pfkp,m,l Fru1,6iP Alo Alo Glyerlehye-3-P Gph 1,3-iP-glyerte Pgk1 3-P-glyerte Pgm1 2-P-glyerte Eno1-4 Mirorry fol hnge etween - n GW464- trete ells : 1.11 to 1.3 : 1.31 to 1.4 : < Reltive ATP levels Gluose GW464 NS + P-enolpyruvte Pyr Lh Ltte Mitohonri GLP % of mx Mitotrker green FL1-H CTRL GW ECAR (mph min 1 per1, ells) GW464 5 µm A B C D Time (min) A Gluose C 2-Deoxygluose B Oligomyin D Rotenone/ntimyin e f Vehile GW464 Reltive GLP-1 seretion Seretgogue GW464 pmol l 1 per mirogrm protein Gl KCl Gluose 5.6 mm + + Phloretin.5 mm GLP Figure 5 FXR inhiits GLP-1 seretion y eresing glyolysis. () DNA mirorrys on 24 h - n GW464(5 mmol l 1 )-trete GLUTg ells were performe using Agilent Tehnology. Genes whose expression is ownregulte y 1%, 1% 3% n upregulte y 5% fter GW464 tretment re written with lk letters in retngles fille in grey, with white letters in retngles fille in grey n with white letters in lk fille retngles, respetively. P vlue of the glyolysis iologil proess: P ¼ () ATP mesurements on GLUTg ells trete for 24 h with GW464(5 mmol l 1 ) n stimulte or not for 1 h with gluose(5.6 mmol l 1 ). yy Pr1: effet of gluose on ATP levels. Pr1: effet of GW464 on ATP levels. () Fluoresene mesurements y Mitotrker Green in GLUTg ells inute with or GW464 (n ¼ 3; performe three times). () Extrellulr iifition rte (ECAR) fter suessive injetion of gluose(1 mmol l 1 ), oligomyin(1 mmol l 1 ), 2-eoxygluose(1 mmol l 1 ) n rotenone(1 mmol l 1 )/ntimyin A(1 mmol l 1 ) on GLUTg ells inute 24 h with or GW464. yyy Pr1: effet of GW464 on ECAR etween t ¼ 15 min n t ¼ 4 min. Pr1 n Pr1: effet of GW464 on ECAR etween t ¼ 4 min n t ¼ 55 min. Representtive results of four inepenent experiments. (e) GLP-1 mesurements in superntnts of GLUTg ells trete for 24 h with GW464(5 mmol l 1 ) n stimulte or not for 1 h with 5.6 mmol l 1 of gluose- or 3 mmol l 1 of KCl-ontining uffer (n ¼ 3; performe four times). Pr1, Pr1: effet of GW464 tretment in eh seretion onition. yyy Pr1: effet of seretgogue in eh tretment onition. (f) GLP-1 mesurements in superntnts of intestinl iopsies from WT mie trete for 5 ys with vehile or with GW464(3 mpk) n then stimulte with meium lone, meium plus gluose(5.6 mm) or meium plus gluose(5.6 mol l 1 ) plus phloretin(.5 mmol l 1 ). Pr1: effet of GW464 tretment on GLP-1 seretion in eh seretion onition. yyy Pr1: effet of seretgogues on eh tretment onition. On the rs, numer of iopsies use from three vehile- or GW464 (3 mpk)-trete mie. Dt re represente s men ±s.. (, n e) or men±s.e.m. (f). Sttistil nlysis were performe using two-wy nlysis of vrine followe y Bonferronni s post ho test. NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

8 NATURE COMMUNICATIONS DOI: 1.138/nomms Fxr +/+ Fxr / pmol l 1 GLP-1 seretion Fxr +/+ Fxr / Ileum Colon Fgf Fxr +/+ Fxr /.5 Fxr +/+ Fxr / 2..5 CONV-R GF CONV-R GF e f 25 Fgf GW464 TβMCA 2..5 GW464 TβMCA Figure 6 Fxr / mie exhiit higher proglugon mrna n GLP-1 levels. () qpcr on DNA from ileum n olon of 8-week-ol Fxr þ/ þ or Fxr / mie. n ¼ 5 6 mie per group. () GLP-1 seretion in 8-week-ol Fxr þ/ þ or Fxr / mie 15 min fter n orl hllenge with gluose 2 g kg 1. n ¼ 5 6 mie per group. Dt re represente s men ±s.e.m. Stuent s t-test, Pr5 n Pr1. Fgf15 () n () qpcr on DNA from ileum of 8-week-ol GF or CONV-R mie on Fxr þ/ þ or Fxr / kgroun (n ¼ mie per group). Dt re represente s men ±s.e.m. Two-wy nlysis of vrine (ANOVA) followe y Bonferronni s post ho test. Pr1: effet of FXR efiieny on gene expression in eh rise onition. yy Pr1: effet of gut miroiot on gene expression in eh genotype. Fgf15 (e) n (f) qpcr on DNA from GLUTg ells trete for 24 h with GW464 (5 mmol l 1 ) or with TMCA (1 mmol l 1 ; n ¼ 3; performe three times). Dt re represente s men ±s.. One-wy ANOVA followe y Tukey s post ho test. Pr1, Pr1 versus. After 6 weeks of iet, Fxr þ / þ mie gin 44% of their initil oy mss, wheres, s expete 14,32,33, high-ft-fe Fxr / mie only gin 23%. Intrperitonel GTT (2 g kg 1 ) revels only minor, nonsignifint erese in gluose exursion urve in Fxr / versus Fxr þ / þ mie (Fig. 7). However, when hllenge with n orl gluose olus (2 g kg 1 ), Fxr / mie isply n improve gluose tolerne ompre with Fxr þ / þ mie (45% erese in integrte re uner the urve (iauc), Pr5, Fig. 7) refleting role of the intestine in the regultion of gluose homeostsis y FXR. To ssess the involvement of the GLP-1 pthwy in this improvement, the GLP-1R ntgonist Exenin-4(9-39) ws ministere efore the orl gluose gvge test. Gluose tolerne worsens in Exenin-4(9-39)-trete mie of oth genotypes (Fig. 7 ) with more pronoune effet in Fxr / mie (Fig. 7, þ 3% in iauc in Fxr þ / þ versus þ 8% in iauc in Fxr / mie), hene olishing the enefiil effet on orl gluose tolerne of FXR efiieny. These results show tht the GLP-1/GLP-1R pthwy ontriutes to the improve gluose homeostsis upon FXR efiieny. BAS improve glyemi n GLP-1 proution y FXR. To test the response to phrmologil trgeting of the FXR/GLP-1 pthwy, o/o Fxr þ / þ n o/o Fxr / mie were trete for 2 weeks with olesevelm, BAS known to etivte intestinl FXR 23. As expete, BAS ministrtion inhiits FXR tivity in the ileum n olon s reflete y repression of Fgf15 gene expression (Supplementry Fig. 5,). BAS improves gluose metolism fter n OGTT in o/o Fxr þ / þ mie, n effet not oserve in o/o Fxr / mie (Fig. 8 ). Moreover, BAS ministrtion inreses proglugon gene expression in the ileum (Fig. 8) n olon (Supplementry Fig. 5) only in o/o Fxr þ / þ mie, n effet whih my ontriute to the improve gluose ontrol. Disussion Using trnsgeni VENUS mie expressing the reporter gene only in proglugon-positive ells n humn iopsies, we show tht FXR is not only expresse in the enteroyte ut lso in L ells, where its tivity ws emonstrte y gonist-inue regultion of two on fie FXR trget genes, Fgf15 n Shp. 8 NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

9 NATURE COMMUNICATIONS DOI: 1.138/nomms8629 ARTICLE Bloo gluose (mg l 1 ) 6 IPGTT 4 2 Fxr+/+ Fxr / Time (min) iauc ( 1 3 ) Fxr+/+ NCl Ex-9 Fxr / Bloo gluose (mg l 1 ) 6 OGTT 4 2 Bloo gluose (mg l 1 ) 6 OGTT 4 2 Fxr+/+ (NCl) Fxr+/+ (Ex9) Fxr / (NCl) Fxr / (Ex9) Time (min) Time (min) Figure 7 FXR efiieny improves gluose metolism vi the GLP-1 pthwy. () Intrperitonel gluose tolerne test in 12-week-ol Fxr þ/ þ n Fxr / mie fe for 6 weeks with 6% HFD (n ¼ 6 mie per group). Dt re represente s men ±s.e.m. () Integrte re uner the urve (iauc) of gluose exursion urves fter.9% NCl or Exenin-4(9-39) (.5 mpk) injetion 45 min efore n orl gluose tolerne test (OGTT, 2 g kg 1 )in Fxr þ/ þ n Fxr / mie fe for 6 weeks with 6% HFD (n ¼ 6 mie per group). Dt re represente s men ±s.e.m. Two-wy nlysis of vrine (ANOVA) followe y Bonferronni s post ho test. Pr5 n Pr1: effet of Exenin-4(9-39) on iauc in eh genotype. y Pr5: effet of genotype in eh tretment onition. OGTT fter.9% NCl or Exenin-4(9-39) (.5 mpk) in 12-week-ol Fxr þ/ þ () n Fxr / () mie fe for 6 weeks with HFD 6% (n ¼ 6 mie per group). Dt re represente s men ±s.e.m. Two-wy ANOVA nlysis followe y Bonferronni s post ho test. Pr5, Pr1 n Pr1: effet of Exenin-4(9-39) tretment on gluose exursion in eh genotype. Bloo gluose (mg l 1 ) o/o Fxr+/+ ontrol o/o Fxr+/+ olesevelm Time (min) Bloo gluose (mg l 1 ) o/o Fxr / ontrol o/o Fxr / olesevelm Time (min) AUC ( 1 3 ) o/o Fxr+/+ Control Colesevelm o/o Fxr / Ilel 2..5 o/o Fxr+/+ Control Colesevelm o/o Fxr / Figure 8 BA sequestrtion improves glyemi n GLP-1 proution through FXR. OGTT fter 3 weeks of vehile or olesevelm tretment in o/o Fxr þ/ þ () n o/o Fxr / mie ()(n ¼ 6 7 mie per group). () Corresponing re uner the urve (AUC). () qpcr on DNA from ileum of these mie (n ¼ 6 7 mie per group). Dt re represente s men ±s.e.m. Two-wy nlysis of vrine (ANOVA) followe y Bonferronni s post ho test. Pr5 n Pr1: effet of Colesevelm tretment on gluose exursion urve uring n OGTT ( n ), on AUC () oron proglugon gene expression () in eh genotype. y Pr5, yy Pr1: effet of FXR efiieny on AUC () or on proglugon gene expression () in eh tretment onition. NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

10 NATURE COMMUNICATIONS DOI: 1.138/nomms8629 Proution Colesevelm L-ell tivte FXR Glyolysis pthwy GLP-1 Seretion Intrellulr ATP Figure 9 Propose mehnism y whih L-ell FXR ereses GLP-1 proution n seretion. Gluose inues proglugon gene expression in L-ells vi the glyolysis pthwy n ChREBP, n susequently promotes GLP-1 proution. Moreover, glyolysis inreses intrellulr ATP onentrtions n inues GLP-1 seretion. FXR tivtion, y inhiiting gluose metolism, ereses oth GLP-1 proution n seretion. Colesevelm, y inhiiting FXR trnsriptionl tivity in L-ells, promotes GLP-1 proution n seretion. Both in vitro, ex vivo n in vivo, in mie s well s in humn intestines, tivte FXR ereses proglugon mrna levels. This erese is the result of FXR tivtion in L ells rther thn n iniret effet of ile i pool moifition fter FXR tivtion. ChREBP is trnsription ftor tivte y gluose metolites. As previously evoke y mirorry t 25, we emonstrte y quntittive PCR (qpcr) nlysis tht ChREBP is expresse to higher extent in murine intestinl L ells thn in non-l ells. Moreover, gluose inution of proglugon mrna levels 26 is inhiite y FXR tivtion. We ientify here tht gluose-inue proglugon gene expression is epenent on gluose metolism n meite y ChREBP, ientifying role for ChREBP in enteroenorine L ells in the ontrol of proglugon gene expression. FXR physilly interts or is omplexe to ChREBP in L ells, result lso oserve in humn heptoytes where FXR tivtion inhiits the gluose-inue glyolyti gene expression y ChREBP 12. These oservtions re in orne with n overll erese of the glyolysis pthwy fter FXR tivtion in GLUTg ells similr to tht in humn heptoytes. Gluose sensing y L ells n susequent seretion of GLP-1 involves oth ATP-inepenent n -epenent pthwys 24,3,31. The ATP-inepenent mehnism is meite y the o-trnsport of N þ n gluose through the memrne trnsporter SGLT-1 (refs 27,31,34,35) n gluose ining to the tste reeptors Ts1R2 n Ts1R3 (ref. 36). The eletrogeni urrent generte y the N þ entrne is suffiient to epolrize L-ell memrnes leing to GLP-1 seretion. This mehnism hs een shown to e involve in gluose-inue GLP-1 seretion in GLUTg ells, in perfuse rt ileum n lso in primry intestinl epithelil ells 24,27,31,34. The ATP-epenent pthwy involves gluose metolism y glyolysis, thus inresing intrellulr ATP levels, losure of the voltgeepenent K ATP -epenent hnnel, memrne epolriztion, intrellulr C 2 þ inrese n GLP-1 seretion. Suh mehnism is involve in gluose-inue GLP-1 seretion in GLUTg ells 27, in perfuse rt ileum 31 ut not in primry intestinl epithelil ells 27. We show tht FXR tivtion oes not erese the expression of Sglt1, Ts1r2, Ts1r3 in GLUTg ells. Moreover, FXR tivtion i not hnge KCl-inue GLP-1 seretion, ut lowere GLP-1 seretion in response to oth low n high gluose onentrtions. Gluose trnsport y GLUT trnsporters is require for intrellulr ATP proution in L ells 24. Inee, inution of murine intestinl iopsies with the GLUTs inhiitor phloretin prevente gluose-inue GLP-1 seretion. FXR tivtion prevente gluose-inue GLP-1 seretion in isolte murine ilel iopsies to similr extent s phloretin. To elinete the mehnisms unerlying the erese of ATP-epenent GLP-1 seretion y FXR, we ssesse the tivity of the glyolysis pthwy n the funtionlity of mitohonri in GLUTg ells. FXR tivtion erese intrellulr ATP levels, inepenent of erese in mitohonril mss or efetive mitohonri, s seen with Mitotrker Green n OCR experiments. ECAR mesurements fter ATP-synthse inhiition with oligomyin showe tht GW464-trete ells hve lower pity to metolize gluose, whih trnsltes into lower ATP-epenent oxygen onsumption. Altogether, these results show tht FXR tivtion ereses the trnsription of glyolyti enzymes not only in humn heptoytes 12, ut lso in enteroenorine L ells leing to erese in intrellulr ATP levels n ATP-epenent GLP-1 seretion in response to gluose. An inresing oy of eviene shows tht BA pool size n omposition ontrol gluose homeostsis through BA reeptors. Although their tion through the trnsmemrne reeptor TGR5 is likely to our rpily fter foo ingestion, tivtion of the nuler reeptor FXR inues more elye response thus leing to shift etween erly postprnil positive effets of TGR5 tivtion n elye effets through FXR tivtion. FXR tivtion in the intestine inreses FGF15/19 seretion whih, in ition to its role in the regultion of BA synthesis, reues iposity, inreses rown ipose tissue energy expeniture n improves the metoli rte in ifferent oese murine moels 37,38. In ontrst, reent stuies in oese mie highlight tht intestinl FXR ntgonism results in improve energy homeostsis 15,16,39. Inee, reently ientifie s enogenous BA FXR ntgonists in GF mie 17,TMCA n TMCA intivte intestinl FXR 15,39 n protet mie ginst iet-inue oesity n improve gluose metolism 15,39. Tretment of GLUTg ells with CDCA, nturl FXR gonist, erese, wheres TMCA inrese proglugon gene expression. In greement with these finings, GF mie express higher intestinl levels of proglugon thn CONV-R mie 4. In ition, we show here tht the inrese of intestinl proglugon mrna upon FXR efiieny requires the gut miroiot sine FXR efiieny in GF mie oes not further enhne proglugon mrna levels. Assessing the ilogue etween ile is, gut miroiot n FXR in L ells oul e n interesting wy to inrese GLP-1 proution. Whole-oy n intestinl FXR-efiient mie re protete ginst oesity n hve n improve gluose metolism 14,15.By using the GLP-1R ntgonist Exenin-4(9-39), we emonstrte tht the improve gluose metolism in Fxr / mie fe HFD implies the GLP-1 pthwy. BASs re resins whih omplex BA, preventing ilel BA re-sorption n riving BA to the olon thus filitting their elimintion 41,42. Initilly use for their holesterol-lowering effet, BAS tretment hs een shown to lower loo gluose in T2D ptients (for review, see ref. 43). Among the propose mehnisms, FXR etivtion inreses energy expeniture in oese mie 2,14,41. Another mehnism my rely on the TGR5-meite inrese in GLP-1 proution n seretion. In the olon, whih ontins the highest ensity of GLP-1 expressing ells, BAS-oun BA inrese proglugon mrna levels n mel-inue GLP-1 seretion thus improving gluose metolism in high-ft-fe mie 2,21. In this stuy, we emonstrte role lso for FXR in the response to olesevelm resulting in n inrese of proglugon mrna levels in ileum n 1 NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

11 NATURE COMMUNICATIONS DOI: 1.138/nomms8629 ARTICLE olon trnslte to n improve response to orl gluose suggesting tht ompouns with TGR5 gonist FXR ntgonist tivity my e most optiml to enhne inretin proution. Tken together, our results emonstrte tht FXR tivtion ereses glyolysis n ATP proution, whih, in turn, ereses proglugon trnsription n GLP-1 seretion in response to gluose. In pthophysiologil onitions, the enefiil effet of FXR efiieny is, t lest in prt, relte to this newly ientifie FXR/GLP-1 pthwy. Our stuy further provies novel moleulr mehnism ontriuting to the enefiil effets of BAS on gluose ontrol in T2DM through inrese GLP-1 proution upon FXR etivtion in intestinl L ells (Fig. 9). Thus, inhiiting FXR in L ells through hnge in BA pool omposition or through omintion TGR5-gonist n FXR-ntgonist tretment oul e promising pproh to tret T2DM. Methos Chemils n regents. The DPP-4 inhiitors iprotin A, FFA-free ovine serum lumin (BSA), CDCA, TMCA, exenin-4(9-39), phloretin, n CMC were purhse from Sigm-Alrih (St Quentin-Fllvier, Frne). Sitgliptin ws purhse from MSD. The syntheti FXR gonist GW464 ws purhse from Toris (R&D Systems, Lille, Frne). For in vitro or ex vivo experiments, CDCA, TMCA n GW464 were issolve in imethylsulfoxie () t.1% finl. For in vivo experiments, GW464 ws issolve in 1% roxymethylellulose (CMC) n Exenin-4(9-39) ws issolve in NCl.9%. Chow n high ft iets were purhse from UAR (A4, Villemoison/Orge, Frne). Colesevelm HCl ws kin gift of Diihi Snkyo. Animl moels n experimentl protools. Eight-week-ol C57Bl6/J mle Fxr þ / þ, Fxr /, o/o Fxr þ / þ, o/o Fxr / littermtes (INSERM U111), 12-week-ol C57Bl6/J mle Tgr5 / (CNRS/INSERM/ULP, Illkirh) n WT mie (Chrles River Lortories, Wilmington, MA), fe how iet, were house in temperture-ontrolle room (22 C) on 12-h light rk yle. GLU-VENUS, germ-free (GF) n onventionlly rise (CONV-R) mie were house s previously stte 17,4. Wil-type (eight mie per group) n Tgr5 / (five mie per group) mie were gvge for 5 ys with 1% CMC ontining or not GW464 (3 mpk). After rnomiztion in four groups se on ge n oy weight, C57Bl6/J mle mie efiient (Fxr / ) or not (Fxr þ / þ ) for FXR were fe stnr how iet (five to six mie per genotype) or high-ft iet (12 mie Tle 1 Mouse smll interfering RNA sequenes use in sirna experiments. Trgete gene Dhrmon Smrtpool sequenes (5-3 ) Fxr GAAACUUCCUGCCGGACAU GUGUAAAUCUAAACGGCUA GAUUUGUGCCGGACGGGAU UGCCAGGAGUGCCGGCUAA Mlxipl CAUCCGACCUUUAUUUGAA AAGAGGCGGUUCAAUAUUA GCAGCUGCGGGAUGAAAUA UCAUGGAGAUAUCAGAUUU per genotype). Age-mthe C57Bl6/J mle mie germ-free (GF) or onventionl rise (CONV-R), on Fxr þ / þ or Fxr / kgrouns (11 12 mie per group) were fe stnr how iet (Liet). Eight-week-ol C57Bl6/J mle Fxr þ / þ n Fxr / mie on leptin-efiient (o/o) kgroun (six to seven mie per group) were fe liitum uring 3 weeks with stnr iet (UAR A4, Villemoison/Orge, Frne) supplemente or not with 2% of olesevelm HCl. Eight-week-ol Fxr þ / þ n Fxr / mie (12 mie per genotype) reeive HFD (D12492; Reserh Diets; 6% kl ft) n ontrols reeive how iet for 6 weeks. Boy weight ws monitore weekly n gluose tolerne tests were mesure s previously esrie 14. Briefly, fter 6 h fsting, mie were injete with NCl.9% (n ¼ 6 mie per group) ontining or not Exenin-4(9-39) (.5 mpk, n ¼ 6 mie per group) 45 min efore intrgstri gluose gvge (2 g kg 1 ). One week lter, the sme mie were sujete to intrperitonel gluose injetion (2 g kg 1 ). Glyemi were mesure t, 15, 3, 6, 9 n 12 min fter either gluose gvge or intrperitonel injetion. For the in vivo GLP-1 experiments, mie were fste 6 h, gvge with sitgliptin (25 mpk) 45 min efore gluose olus (2 g kg 1 ). Fifteen minutes fter gluose gvge, loo (25 ml) ws smple y retro-oritl venipunture uner isoflurne nesthesi n plsm GLP-1 ws mesure s esrie elow. After 6 h fsting, mie were kille y ervil islotion. Ileum (orresponing to the five terminl entimetres of the smll intestine) n olon were wshe one with phosphte-uffere sline (PBS), opene longituinlly on ie n the intestinl muos ws srppe n snp-frozen in liqui nitrogen. The experiment on GLU-VENUS mie ws pprove y lol ethis ommittees n onforme to Unite Kingom Home Offie regultions, the experiment on Tgr5 / mie were pprove y the lol niml experimenttion ommittee of the Cnton e Vu (liense no. 2614) n the experiment on GF/CONV-R mie ws performe with protools pprove y the University of Gothenurg Animl Stuies Committee. All the other experimentl protools were pprove y the Lille Psteur Institute Ethil ommittee n rrie out in greement with Europen Union (EEC no. 743). Ex vivo stuies. GLP-1 seretion on murine intestinl iopsies. Murine ilel iopsies from WT mie trete for 5 ys with CMC or GW464 (3 mpk) were isolte s previously esrie 4. Briefly, fter 6 h fsting, mie were kille y ervil islotion. The lst 8 m of the smll intestine, orresponing to the ileum, ws ple in ol Hnk s Blne Slt Solution (HBSS, Lonz) ontining 2% horse serum (Life Tehnologies). Peyer s pthes were remove n the ileum ws opene longituinlly n ut into 5-mm-long piees. Piees were wshe 5 in ol HBSS plus 2% horse serum n then inute for 1 min t 4 C in HBSS ontining 2% horse serum n 1,4-ithiothreitol (DTT, 1 mmol l 1 ). After itionl wshing in ol HBSS plus 2% horse serum, ileum piees were istriute in 48-well pltes n stilize for 3 h t 37 C in Isove s Moifie Duleo Meium (Life Tehnologies) ontining 1% fetl lf serum (Life Tehnologies). After 3 min gluose eprivtion in DMEM No Gl meium, 1 h-glp-1 seretion test in response to DMEM without gluose, to DMEM with gluose (5.5 mmol l 1 ) or in response to DMEM with gluose (5.6 mmol l 1 ) plus phloretin (.5 mmol l 1 ) ws performe t 37 C in DMEM plus 1% DPP-4 inhiitor (Ile-Pro-Ile, Sigm-Alrih). Finlly, meium ws remove, entrifuge for 5 min t 4 C t 13,g n immeitely frozen t 8 C. GLP-1 ontent in ulture meium ws mesure s esrie elow. The remining tissue ws wshe in ol PBS n frozen t 8 C in NOH 2 N. Protein ontent ws ssesse oring to BCA s metho (Thermosientifi). Culture n immunostining on humn intestinl iopsies. Fresh humn jejunum iopsies from normoglyemi sujets were otine with informe onsent s prt of the A Biologil Atls of Severe Oesity (ABOS) stuy (ClinilTrils.gov; NCT ). Muos were issoite from musulos n ut into smll piees of 1 m 2 efore tretment for 16 h with or GW464 (5 mmol l 1 ) in RPMI meium þ GlutMAX-1 (tlogue (Ct.) No , Life Tehnologies) ontining gluose (11 mmol l 1 ), soium pyruvte (1 mmol l 1 ) n supplemente with 1% FBS (Life Tehnologies) n peniillin/streptomyin (1, U l 1 per 1 mg l 1 )in37 C, 5% CO 2 ontrolle tmosphere. RNA extrtion n qpcr nlysis were performe s esrie elow. Tle 2 qpcr primer sequenes. Speies Gene Forwr (5-3 ) Reverse (5-3 ) Mouse Fgf15 GAGGACCAAAACGAACGAAATT ACGTCCTTGATGGCAATCG Shp AGGAACCTGCCGTCCTTCTG CTCAGCCACCTCGAAGGTCA GATCATTCCCAGCTTCCCAG CTGGTAAAGGTCCCTTCAGC Exon/Intron proglugon CACTTCCACTCACAGATCATTCC CTTCAGACTCTTACCGGTTCCTC Fxr CCTGAGAACCCACAGCATTT GTGTCCATCACTGCACATCC Humn GTTCCCAAAGAGGGCTTGCT GTTGCCAGCTGCCTTGTACC FGF19 GGAGGAAGACTGTGCTTTCGA GAAGAGCCTAGCCATGTGTAAC NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.

12 NATURE COMMUNICATIONS DOI: 1.138/nomms8629 For immunohistohemil nlysis, humn jejunl iopsies were overnight (O/N) fixe with prformlehye 4% (Sigm) efore inution with 2% surose uring 2 h n further inlusion in Jung Tissue Freezing Meium (Jung) n storge t 8 C efore proessing. Twelve-mirometre-thik slies were post-fixe in methnol/etone 5/5 (v/v) for 1 min t 2 C. After two wshes in Tris/NCl uffer (TRIZMA-Bse (2 mmol l 1, Sigm)/NCl (15 mmol l 1, VWR), ph 7.6), n ntigen retrievl step ws performe (52 W, 5 min; 16 W, 1 min) in itrte uffer (ThermoSientifi). After permeiliztion uring 1 min (Tris/NCl/.1% TRITON X1), unspeifi protein ining sites were mske y Dko Protein Blok (DAKO) uring 2 h t room temperture. Then, the smples were inute O/N with mouse nti-humn GLP-1 (SC-7358, Snt Cruz Biotehnology) n rit nti-humn FXR (A28676, Am) ntioies (1/1) t 4 C. The next y, immunoretive ells were revele fter inution with got nti-mouse IgG Alex 568 (for GLP-1) n got nti-rit IgG Alex 488 (for FXR; ilutions: 1/2, Moleulr Proes) n photogrphies were tken with onfol mirosope (LSM 71 Zeiss). Imge nlysis ws performe using the ImgeJ softwre (version 1.46; WS Rsn, Ntionl Institutes of Helth, Bethes, MD, USA, In vitro stuies. Cell ulture n tretment. The mouse enteroenorine L ell line GLUTg ws kinly provie y D.J. Druker (University of Toronto, Toronto, Cn) n grown in DMEM þ GlutMAX-1 meium (Ct. No , Invitrogen) ontining gluose (5.6 mmol l 1 ), soium pyruvte (1 mmol l 1 ) n supplemente with 1% FBS. For tretments, 42 h ulture ells were inute for 24h in DMEM þ GlutMAX-1 meium (Ct. No , Invitrogen) with gluose (5.6 mmol l 1 ), soium pyruvte (1 mmol l 1 ) n supplemente with.2% BSA ontining TMCA (1 mmol l 1 ), CDCA (1 mmol l 1 ) or GW464 (5 mmol l 1 ) uring 24 h unless speifie. In some experiments, ells were eprive of gluose y 12 h inution in gluose-free meium (DMEM GLUTmx, Ct. No ), supplemente with 1% glutmine, soium pyruvte (1 mmol l 1 ),.2% BSA n soium ltte (1 mmol l 1 ) efore FXR tivtion in either ltte (1 mmol l 1 )-, gluose (5.6 mmol l 1 )- or 2-eoxygluose (5.6 mmol l 1 )-ontining meium. Trnsient trnsfetion ssys. Cells were eletroporte using the Neon Trnsfetion System (Life Tehnologies) with smll interferene RNA ginst rnom (), Fxr () or Mlxipl (sichrep) sequenes (smrt pool sequenes otine from Dhrmon (Thermosientifi, Illkirh, Frne); see Tle 1). A totl 14, eletroporte ells m 2 seee into 24-well pltes uring 42 h were trete s esrie ove. GLP-1 seretion ssys, ATP n mitotrker-facs mesurement. After tretment, GLUTg ells were strve for 3 min in gluose-free Kres/phosphte uffer (NCl (12 mmol l 1 ), KCl (5 mmol l 1 ), MgCl 2 (.25 mmol l 1 ), CCl 2 (.5 mmol l 1 ) n NHCO 3 (2.2 mmol l 1 ), ph 7.2) supplemente with iprotin A (1 mmol l 1 ) n.2% BSA. Cells were susequently stimulte for 1 h with Kres uffer with or without gluose (5.6 mmol l 1 ) or with Kres uffer enrihe with KCl (3 mmol l 1 ). The ell superntnts were then trnsferre into ie-ol mirotues ontining n equl volume of iprotin A (1 mmol l 1 )in Kres uffer n entrifuge t 1,5g, 4 C for 5 min. Cells were lyse in NOH (.8 mol l 1 ) uner gittion n totl protein ontent ws etermine using the BCA Protein Assy Kit (Piere). Ative 7-37 n 7-36 mie GLP-1 were mesure with n enzyme-linke immunosorent ssy kit (EGLP-35K; Merk-Millipore) using Mithrs Tehnology (Berthol) n normlize to the totl quntity of ellulr proteins. ATP mesurement (Cell Titre Glow, Promeg) on GLUTg ells in response to gluose (5.6 mmol l 1 ) ws performe in the sme onition s GLP-1 seretion ssys oring to the mnufturer s protool n luiferse tivity ws mesure using Viktor pprtus (PerkinElmer). To estimte mitohonril quntity, 24 h - n GW464-trete GLUTg ells were wshe with PBS, trypsinize n inute t 37 C for 2 min with 1 nmol l 1 MitoTrker Green FM (Moleulr Proes). Smples were wshe 3 in PBS n sujete to flow ytometri nlysis on FACSCliur pprtus (Beton Dikinson, Sn Jose, CA). Anlysis of oxygen onsumption n glyolyti rtes. Mesurements of OCR n ECAR in GLUTg ells were performe using the XF24 nlyser (Sehorse Biosiene). A totl GLUTg ells per well were seee in XF24 V7 miropltes for 42 h efore GW464 tretment for 24 h. OCR n ECAR were mesure in Sehorse ssy uffer ontining si gluose-free DMEM meium (ph 7.4). The following ompouns n onentrtions were e suessively: gluose (1 mmol l 1 ); oligomyin (1 mmol l 1 ); 2-eoxygluose (1 mmol l 1 ); rotenone (1 mmol l 1 ) n ntimyin A (1 mmol l 1 ). Co-immunopreipittion n western lot nlysis. GLUTg ells were gluose-eprive for 12 h n then trete 24 h with or with GW464 (5 mmol l 1 ) in the presene of ltte (1 mmol l 1 ) or gluose (5.6 mmol l 1 ). After three wshes in ie-ol PBS, ells were srppe in ie-ol PBS ontining protese inhiitors (1, Rohe). Cells were entrifuge for 5 min t 3,5g t 4 C. One volume of the ell lysis uffer (KCl (1 mmol l 1 ), TRIS HCl ph 7.9 (1 mmol l 1 ), DTT (.5 mmol l 1 ), MgCl 2 ( mmol l 1 ), PIC.1%), orresponing to the ell volume ws e n ells were inute on ie uring 15 min. Cells were then entrifuge for 1 min t 11,5g t 4 C. Superntnts were ollete (tht is, ytoplsmi frtion) n pellets were lyse in moifie RIPA uffer (TRIS HCl ph 7.4 (5 mmol l 1 ), NCl (15 mmol l 1 ),.25% DOC,.5% NP4, EDTA (1 mmol l 1 ),.1% PIC) 3 min on ie. After entrifugtion (5 min t 13,g t 4 C) superntnts orresponing to the nuler frtion were ollete. After pre-lering step in whih protein frtions were inute with protein A grose es (1 h 3 min t 4 C), ells were entrifuge (5 min t 1,g t 4 C) n 2 mg of protein were immunopreipitte (O/N t 4 C) with ntioy ginst FXR (2 mg). Then immunoomplexes were pture with 1 ml protein A grose es 3 h t 4 C, entrifuge 1 min t 1,g n wshe three times with 8 ml of RIPA moifie uffer. Bes were resuspene in 2 migrtion uffer n hete for 3 min t 1 C. Western lots were generte s previously esrie 29 n inute with proglugon (SC-873, Snt Cruz), FXR (PP-933A, R&D), ChREBP (Novus Biologil, NB4-135) or -tin (SC-1616, Snt Cruz) ntioies (ilute: 1/5). After 1 h inution with horserish peroxyse-onjugte seonry ntioies (1/3,, Sigm), protein reveltion ws performe using the enhne hemiluminesene FEMTO Plus regents (ECL FEMTO, Thermofisher) y utoriogrphy (Cmer Gox, SynGene) n n intensity ws mesure (GeneTools softwre, SynGene). Mirorry nlysis. GLUTg ells were trete or not with GW464 (5 mmol l 1 ) for 24 h n four RNA smples of eh tretment onition were hyriize on mouse GEP 8 6 K rrys. Snning lusters n t quisition were rrie out following the mnufturer s instrutions (Agilent, One-olour mirorry Gene Expression Anlysis). Dt proessing n nlysis were performe using the Genespring Softwre. Biologil Proesses Anlysis ws performe using Gene Ontology Biologil Proesses on the Genomtix Softwre (Genomtix, Deutshln). Dt re eposite t EBI uner the E-MTAB-2199 numer. RNA extrtion n quntifition y qpcr. Totl RNAs from FACS-isolte ells were isolte using miro-sle RNA isoltion kit (RNAesy, Qigen, Crwley, UK) n were reverse trnsrie oring to stnr protools using Peltier Therml Cyler-225 (MJ Reserh, Wlthm, MA, USA). Quntittive PCR with reverse trnsription ws performe with 79 HT Fst Rel-Time PCR system (Applie Biosystems, Foster City, CA, USA). PCR retions mix onsiste of first-strn DNA templte, primers (TqMn gene expression ssys, Applie Biosystems) n PCR Mster mix (Applie Biosystems). Fxr gene expression ws ompre with tht of -tin mesure on the sme smple, in prllel, on the sme plte, giving yle threshol ifferene (DCT) for Fxr gene minus -tin. Totl RNAs from GLUTg ells, mouse n humn epithelil ells were extrte using Extrt-All Regent (Euroio, Courteoeuf, Frne) oring to the mnufturer s protool. After DNAse tretment (Ferments, St Rémy Les Chevreuse, Frne), totl RNA (.5 1 mg) ws reverse trnsrie using High- Cpity Multisrie Reverse Trnsriptse (Applie Biosystems, St Auin, Frne) oring to the mnufturer s protool. qpcr with reverse trnsription ws performe using the Mster MIX SYBR Green Brillnt Fst III (Agilent) on MX4 pprtus (Strtgene) using speifi oligonuleoties (see Tle 2). The results re presente using the DDCt metho normlize to referene gene (Cylophilin for in vitro n ex vivo experiments n TFIIB for in vivo experiments). Controls were set t 1 n ll onitions were expresse omprtively to ontrol. Dt nlysis. In vitro experiments were performe in triplites n repete t lest three times. The in vitro n ex vivo t re presente s men±s.. The in vivo t re presente s men±s.e.m. All sttistil nlyses were performe using two-tile Stuent s t-test or one-wy nlysis of vrine followe y Tukey s post ho test or two-wy nlysis of vrine followe y Bonferronni s post ho test n stte in the figure legens. P vlues r5 were onsiere s signifint. Referenes 1. Porez, G., Prwitt, J., Gross, B. & Stels, B. Bile i reeptors s trgets for the tretment of yslipiemi n riovsulr isese. J. Lipi Res. 53, (212). 2. Prwitt, J., Cron, S. & Stels, B. Gluose-lowering effets of intestinl ile i sequestrtion through enhnement of splnhni gluose utiliztion. Trens Enorinol. Met. 25, (214). 3. Kwmt, Y. et l. A G protein-ouple reeptor responsive to ile is. J. Biol. Chem. 278, (23). 4. Thoms, C. et l. TGR5-meite ile i sensing ontrols gluose homeostsis. Cell Met. 1, (29). 5. Bggio, L. L. & Druker, D. J. Biology of inretins: GLP-1 n GIP. Gstroenterology 132, (27). 6. Nuk, M., Stökmnn, F., Eert, R. & Creutzfelt, W. Reue inretin effet in type 2 (non-insulin-epenent) ietes. Dietologi 29, (1986). 7. Nuk, M. A. et l. Preserve inretin tivity of glugon-like peptie 1 [7-36 mie] ut not of syntheti humn gstri inhiitory polypeptie in ptients with type-2 ietes mellitus. J. Clin. Invest. 91, (1993). 8. Lefevre, P., Criou, B., Lien, F., Kuipers, F. & Stels, B. Role of ile is n ile i reeptors in metoli regultion. Physiol. Rev. 89, (29). 12 NATURE COMMUNICATIONS 6:7629 DOI: 1.138/nomms & 215 Mmilln Pulishers Limite. All rights reserve.