Serum mir-21 may be a Potential Diagnostic Biomarker for Diabetic Nephropathy

Transcription

1 417 Serum mir-21 my e Potentil Dignosti Biomrker for Dieti Nephropthy Authors J. Wng 1, L. Dun 2, L. Tin 1, J. Liu 1, S. Wng 3, Y. Go 4, J. Yng 5 Affilitions Affilition resses re liste t the en of the rtile Key wors serum mir-21 ieti nephropthy struture n funtion ignosti iomrker reeive first eision epte Biliogrphy DOI /s Pulishe online: Novemer 17, 215 Exp Clin Enorinol Dietes 216; 124: J. A. Brth Verlg in Georg Thieme Verlg KG Stuttgrt New York ISSN Corresponene Jinyng Wng Deprtment of Enorinology Gnsu Provinil People s Hospitl 24, Donggng West Ro Chenggun Distrit Lnzhou, 73 PR Chin otorwng@liyun.om Astrt MiRNAs ply importnt roles in initition n progress of mny pthologi proesses. MiR-21 ws losely ssoite with ieti nephropthy (DN). However, whether serum mir-21 ws s potentil ignosti iomrker for DN n the reltionship etween serum mir-21 n tissue mir-21 remine unler. In this stuy, rel-time RT-PCR, ell trnsfetion, luiferse reporter gene ssys, western lot n onfol mirosope were use, respetively. Here, we foun tht serum n renl tissue mir-21 ws signifintly elevte with the progress of DN. Moreover, luiferse reporter gene ssys showe tht Arevitions DN Dieti nephropthy ACR urine lumin retinine rtio Cr retinine lerne rtio AntgomiR-21 mir-21 ntgonist GBM glomerulr sement memrne GA glomerulr re CCF ontent of ollgen fiers Jinyng Wng n Lijun Dun ontriute eqully to this stuy. sm7 ws vlite mir-21 trget, ell trnsfetion showe tht mir-21 overexpression ownregulte trget sm7 expression. Interestingly, serum mir-21 ws signifintly onsistent with the ltertions of tissue mir-21 with the evelopment of DN. In ition, serum mir-21 ws lso positively orrelte with GBM, GA, ACR n CCF, while negtively orrelte with Cr. Importntly, ntgomir-21 not only llevite GBM, GA, ACR n CCF, ut lso meliorte Cr y inresing trget sm7. In onlusion, our t emonstrte tht serum mir-21 ws losely ssoite with renl struture n funtion, n serum mir-21 my e regre s potentil ignosti iomrker of DN. Introution Dieti nephropthy (DN) is hroni, progressive proess tht ultimtely les to renl firosis n en-stge renl filure, evstting isorer tht requires ilysis or kiney trnsplnttion [1 3]. KK-Ay mouse ws onsiere suitle s polygeni moel for humn type-2 ietes mellitus n ws proue y trnsferring the yellow oese gene (A y llele) into the KK-Ay/T mie. Renl lesions in KK-Ay mie losely resemle humn DN, whih evelop mrke high gluose, luminuri n renl firosis [4]. MiroRNAs (mirs) re enogenous non-oing smll RNA, 2 22 nuleoties in length, whih in to the 3 -UTR of trget genes, therey, repress trnsltion n/or inue egrtion of trget gene mrnas [5]. Inresing evienes hve inite tht mirnas ply signifint roles in mny iseses inluing ietes mellitus n its omplitions [6]. For exmple, mir-29 ggrvtes insulin resistne n inhiits firosis [7, 8]. mir-377 n le to inrese fironetin proution in DN [9]. mir-451 regultes p38 MAPK signling y trgeting of Ywhz n suppresses the mesngil hypertrophy in erly DN [1]. mir- 53 ontriutes to ietes mellitus-inue impirment of enothelil funtion n reprtive ngiogenesis fter lim ishemi [11]. mir- 192 my e ritil ownstrem meitor of TGF-β/Sm3 signling in the evelopment of renl firosis [12]. Reent reports hve oumente tht mir-21 plys ruil role in DN n kiney firoti iseses [13, 14]. For exmple, mir-21 expression ws inrese in kiney iopsies from ieti ptients n DN mie [15]. mir-21 expression inreses rpily in ulture

2 418 murine pooytes fter exposure to TGF-β1 n is higher in kineys of TGF-β1-trnsgeni mie thn wil-type mie [16]. MiR- 21 orhestrtes high gluose-inue signls to TOR omplex-1, resulting in renl ell pthology in ietes [17]. mir-21 promotes firosis of the kiney y silening metoli pthwys [18]. mir-21 protets from mesngil ell prolifertion inue y DN in / mie [19]. Interestingly, reent stuies hve shown tht mir-21 is key therpeuti trget for DN n renl firosis [14, 2]. Inrese irulting mir-21 levels re ssoite with kiney firosis [21]. More importntly, our previous experiments showe tht mir-21 ws extensively istruute in renl tuulr epithilil ells of ortil kineys in DN mie, mir-21 overexpression promote renl firosis y enhning TGF-β1-inue EMT [22, 23]. However, whether serum mir-21 ws s potentil ignosti iomrker for DN n reltionship etween serum mir-21 n tissue mir-21 in DN remine unler. The im of this stuy ws to ientify the reltionship etween serum mir-21 n tissue mir-21, n to explore whether serum mir-21 ws novel ignosti iomrker of DN. The results suggest tht oth serum mir-21 ws losely ssoite with renl struture n funtion, n serum mir-21 my e s novel ignosti iomrker for DN. Mterils n Methos Animls n ieti nephropthy moels Mle C57BL/6J (12 weeks of ge, 24 mie) n KK-Ay mie (12 weeks of ge, 48 mie) from Chinese Aemy of Meil Sienes (Beijing, Chin) were iniviully house in plsti ges with free ess to foo n wter throughout the experiment. All mie were mintine in the sme room uner onventionl onitions with regulr 12-h light/rk yle with the temperture ontrolle t 24 C ± 1 C. To inue DN, C57BL/6J mie were fe y ommon forge (12 % ft, 6 % rohyrte, n 28 % protein), KK-Ay mie reeive reserh iets (58 % ft, 25.6 % rohyrte, n 16.4 % protein) for 4 weeks, rnom loo gluose (RBG) ws heke y portle gluometer from til vein of eh niml, C57BL/6J mie were lssifie s norml ontrol group (NC group, n = 2), KK-Ay mie were onsiere DN when their RBG ws 3 mg/l (16.7 mmol/l) n ACR (urine lumin retine rtio) ws 3 ug/mg were etete, KK-Ay mie were onsiere s DN moel suitle for humn type-2 ietes mellitus [4]. KK-Ay mie were rnomly ivie into DN moel group (DN group, n = 24), whih were injete intrperitonelly with non-trgeting negtive ontrol sequenes n DN with ntgomir-21 tretment group (ntgomir-21 tretment group, n = 24), whih were injete intrperitonelly with ntgomir-21 (the ntgonist of mir-21, 3mg/kg/, Rioio, Chin) for 8 weeks. Antgomir is mirna ntgonist, whih ins with mture mirna in the oy. Antgomir prevents mirna n its trget gene mrna omplementry piring, n restrins the tion of mirna [24]. Renl tissue n serum smples were erive from 5 mie t every 4 weeks in eh group for lter use. Renl tissue from eh mouse for western lot, RT-PCR, Msson, Piro-sirius re, eletron mirosope n light mirosopy, respetively. Experiment protool ws pprove y the Institutionl Animl Cre n Use Committee. Biohemil ssys Serum retinine (SCr) n oy weight ws mesure t 12, 16, 2 n 24 weeks of ge. Urinry lumin n retinine were mesure y immunossy (DCA 2 system, Germny). Urinry lumin retinine rtio (ACR) ws lulte s: ACR = urinry lumin (μg)/urinry retinine (mg). Cretinine lerne (Cr) rtio ws lulte using the following eqution [1]: Cr (ml min 1 kg 1 ) = [urinry Cr (mg L 1 ) urinry volume (ml)/ serum Cr (mg L 1 )] [1 /oy weight (g)] [1/1 44 (min)] [25]. Light n eletron mirosopy Tissue for light mirosopy ws fixe in 1 % phosphte-uffere formlin n then emee in prffin. 4-mirometer-thik setions were proesse for hemtoxylin-eosin stining y light mirosopy. Tissues for eletron mirosope were fixe with 2 % glutrlehye in.1 mol/l phosphte uffer t 4 C for 12 min. Ultrthin setions were ollete on 1-mesh opper gris n oule stine with 4 % urnyl ette n le itrte. The setions were exmine with Hithi 7 1 trnsmission eletron mirosope. Morphologi nlyses were performe y n experiene pthologist who ws line to the soure of the tissue. Trnsfetion of ulture HKCs To investigte the role of mir-21 in norml humn kiney tuulr epithelil ells (HKCs), otine from Chinese Type Culture Colletion (CTCC), we performe mir-21 trnsfetion experiments, n ells were seee t ensity of ells/m 2 in serum-free DMEM/F12. In this stuy, ells were ivie into the following groups: ells without trnsfetion were use s lnk ontrol group. Cells trnsfete with mir-ontrol lentivirus vetor were use s mir-ontrol group. Cells trnsfete with mir- 21 over-expression (pre-mir-21) lentivirus vetor were use s mir-21 over-expression group (pre-mir-21 group). Cells trnsfete with mir-21 inhiitor lentivirus vetor were use s mir- 21 inhiitor group. After 12 h trnsfetion, the meium ws hnge n the HKCs were inute with fresh serum-ontining meium for nother 48 h. In our experiment, the most pproprite multipliity of infetion (MOI) for HKCs equls to 3, ll the trnsfete ells were mesure n sorte 48 h lter oring to the green fluoresent protein (GFP) intensity y flow ytometry, n the trnsfetion effiieny ws ove 97 %. The entire ovementione lentivirus vetor ws ustom-synthesize y Shnghi Genehem Co., Lt, Chin. After 3 ys of ulturing, ells were hrveste for RNA or protein isoltion. Luiferse reporter gene ssys To exmine whether mir-21 regultes the expression of sm7, we trnsiently trnsfete mir-ontrol plsmi, wil-type or mutnt luiferse-sm7 3 UTR reporter) n mir-21 overexpressing plsmi into 4 5 % onfluent T293 ells (Genehem, Shnghi, Chin), whih grown in 24-well plte. The ells were hrveste 48 h fter trnsfetion, n luiferse tivity ws mesure with ul luiferse reporter ssy kit (Promeg, Mison, WI, USA) on luminometer (Lumt LB957). Rel-time RT-PCR nlysis For nlysis of serum n renl tissue mir-21 expression, TqMn mirna ssys (Applie Biosystems, Cliforni, n USA) were use for quntittive etermintion of mir-21 expression oring to the mnufturer s instrutions. The reltive expression ws normlize to the expression of U6 RNA (Applie

3 419 Biosystems). Reltive fol hnges of gene expression were lulte y the CT metho n the vlues re expresse s 2 ΔΔ Ct. All Rel-time RT-PCRs were performe in uplite. Western lot nlysis Renl tissues were lyse in RIPA uffer with protese inhiitors (Rohe). Protein onentrtions were etermine y iinhonini ssy (Piere Biotehnology, Rokfor, IL, USA). Proteins were seprte on 1 % SDS-PAGE gels uner reuing onitions n trnsferre to polyvinyliene ifluorie memrnes. The memrnes ws performe with rit polylonl to ol-iv ntioy (Am) n polylonl to Col-I ntioy (Am), n then with seonry ntioies (1:5, Rohe), Memrnes were strippe n reproe with β-tin ntioy (Sigm) n seonry ntioy for t normliztion. Sttistil nlysis Sttistil nlyses were performe y one-wy ANOVA followe y the Bonferroni multiple omprison test (for omprison of more thn 2 groups) or Stuent t test (for omprison of 2 groups) n orrelte nlysis y Person s orreltion test. A proility vlue of < 5 ws onsiere signifint. Results Reltionship etween serum mir-21 n tissue mir-21 To explore the reltionship etween serum mir-21 n renl tissue mir-21, we mesure serum mir-21 n renl tissue mir- 21 y rel-time quntittive RT-PCR t ifferent weeks of ge. At 12 weeks of ge, serum mir-21 ws initilly inrese (p < 5). With the progress of DN, serum mir-21 level ws further elevte until 24 weeks of ge ( Fig. 1. p < 5). Interestingly, the ltertions of serum mir-21 were signifintly onsistent with the expressions of renl tissue mir-21( Fig. 1, p < 5). More importntly, serum mir-21 ws positively orrelte with tissue mir-21 expression y Person orreltion nlysis ( Fig. 1, r =.894, p < 5). Next, to lrify whether ntgomir-21 erese the expressions of serum n tissue mir-21, KK-Ay DN mie were injete intrperitonelly with ntgomir-21, we Serum mir-21 expression (normlize to U6) mir-21 fol hnge (normlize to U6) Serum mir-21 expression with the progress of DN mir-21 fol hnge (normlize to U6) Tissue mir-21 fol hnge foun tht serum n tissue mir-21 were signifintly erese in ntgomir-21 group ompre with DN group ( Fig. 1, p < 5). Tken together, our results suggeste tht irulting serum mir-21 my reflet the hnges of tissue mir-21. Reltionship etween serum mir-21 n renl funtion To evlute the reltionship etween serum mir-21 n ACR/ Cr, n to further eluite whether serum mir-21 oul e s novel ignosti iomrker for DN, the hnges of ACR n Cr were exmine. With the progress of DN (from 16 to 24 weeks of ge), ACR egn to inrese n Cr egn to eline ( Fig. 2, ). Aitionlly, ntgomir-21 ws le to signifintly erese ACR n inrese Cr ( Fig. 2, p < 5). Interestingly, serum mir-21 expression ws positively orrelte with ACR ( Fig. 2, r =.97, P = 6) n negtively orrelte with Cr ( Fig. 2, r =.95, P < 1). Importntly, we foun tht ntgomir-21 n erese the levels of ACR n inrese the levels of Cr ( Fig. 2,, p < 5), Thus, our results suggeste tht serum mir-21 ws losely ssoite with the mrkers of renl funtion (ACR n Cr), n tht serum mir-21 my e s novel ignosti iomrker for DN. Reltionship etween serum mir-21 n morphologil hnges Numerous stuies emonstrte tht key hrteristis of DN re hrterize y glomerulr sement memrne (GBM) thikene n mesngil mtrix hyperplsi [1]. Here, to evlute the reltionship etween serum mir-21 n morphologil hnges t 24 weeks of ge, renl morphology ws oserve y light n eletroni mirosopy (EM) ( Fig. 3). We foun tht GBM is norml n glomerulr foot proess is slener n tiy in ontrol group. In ontrst, GBM (145 ± 2.4 vs. 1 ± 18.6 nm) thikene, foot proess prtly fuse n struture isorere in DN group. Furthermore, ompre with NC group, glomerulr re (GA, 51.2 ± 2.4 vs ± 3.6 um 2, P < 5) inrese, GBM (145 ± 2.4 vs. 1 ± 18.6 nm, P < 5) thikene in DN group. Interestingly, the level of serum mir-21 ws positively orrelte with GBM n GA (Person orreltion, r GBM =.77, r GA =.63, P < 5). Importntly, ntgomir-21 erese GBM n GA ( Fig. 3, ). Tken together, the results suggeste tht Renl tissue mir-21 expression with the progress of DN 12 w 16w 2 w 24w 12 w 16 w 2 w NC DN ontrol AntgomiR-21 NC DN AntgomiR-21 Altertions of serum mir-21 were onsistent Serum mir-21 ws positively orrelte with of renl tissue mir-21 with tissue mir w 16w 2 w 24w tissue mir-21 serum mir-21 Serum mir Fig. 1 Reltionship etween serum mir-21 n tissue mir-21. Compre with NC group, from 12 to 24 weeks of ge, the expression of serum mir-21 ws signifintly inrese in DN group. After the tretment of ntgomir-21, serum mir- 21 ws remrkly erese (P < 5). with the progress of DN, the expression of renl tissue mir-21 ws signifintly inrese in DN group. After the tretment of ntgomir-21, mir-21 expression ws remrkly erese (P < 5). The ltere trens of renl tissue mir-21 were signifintly onsistent with serum mir-21. serum mir-21 ws positively orrelte with tissue mir-21 expression (r =.894, p < 5).

4 42 ACR(µg/mg) ACR (µg/mg) w The inrese of ACR with the progress of DN Reltionship etween ACR n mir mir-21 expression (2- CT) NC group serum mir-21 my e ssoite with the morphologil hnges of DN, wheres, ntgomir-21 meliorte renl morphology in ieti kineys. Serum mir-21 ws losely ssoite with ollgen fiers Collgen fiers(cfs) re the most importnt ingreients omprise of the glomerulus suh GBM n mesngil mtrix, ut the eposition of exessive CFs ltere renl struture, n versely ffets renl funtion [26]. To etermine the reltionship etween serum mir-21 n CFs, we exmine CFs y Pirosirius re n Msson stining, respetively. Pirosirius re stining y polrize light miroopy showe tht CFs ws right yellow or ornge (ol-i for re or yellow, ol-iv for light yellow ( Fig. 4). Similrly, Msson stining showe tht lrge numer of CFs were primrily eposite in GBM, mesngil region n renl interstitil region in DN group ompre with Cr grully erese with the progress of DN w 2w 24 w 12w 16 w 2w 24 w Cr (ml min-1kg-1) NC DN Antgomir-21 NC DN Antgomir-21 ACR Cr (ml min-1kg-1) DN group Rreltionship etween mir-21 n Cr mir-21 expression (2- CT) Cr AntgomiR-21 Fig. 2 Reltionship etween serum mir-21 n renl funtion (ACR n Cr). Compre with NC group, ACR ws inrese in DN ontrol group (P < 5). After the tretment of ntgomir-21, ACR ws erese (P < 5). Compre with NC group, Cr ws erese in DN ontrol group (P < 5). After the tretment of ntgomir-21, Cr ws inrese (P < 5). serum mir-21 ws positively orrelte with ACR (P < 5). serum mir-21 ws negtively orrelte with Cr (P < 5) Comprision of GA(um2) n GBM(nm) in eh group GA GBM NC DN AntgomiR-21 Fig. 3 Morphologil hnges of renl tissue setions t 24 weeks of ge. GBM thikene n mesngil mtrix hyperplsi in DN ontrol group, fter the tretment of ntgomir-21, the hnges of renl struture were oviously improve. Compre with NC group, GA n GBM were signifintly inrese in DN group, fter the tretment of ntgomir-21, GA n GBM ws slightly ut signifintly erese. Light mirosopy 4. Eletron mirosopy (EM) 2. (Color figure ville online only). NC group ( Fig. 4). Next, to isriminte the ollgen type, the expression of ol-i n ol-iv were exmine y western lot, we foun tht ol-iv n ol-i ws remrkly inrese in DN group ompre with NC group ( Fig. 4, ). Interestingly, serum mir-21 ws positively orrelte with the protein of ol-iv rther thn orrelte with ol-i (Person orreltion, r ol-iv =.87, P < 5, r ol-i =.39, P > 5). Importntly, fter KK-Ay DN mie were injete intrperitonelly with ntgomir-21, the ontent of ollgen fiers (CCF) n ol-iv were erese, inste of ol-i. ( Fig. 4 ). overll, these results suggeste serum mir-21 ws losely ssoite with exessive eposition of ollgen fiers, espeilly for ol-iv. mir-21 overexpression erese trget sm7 expression As esrie ove, serum mir-21 ws losely ssoite with renl struture n funtion of DN. then, mir-21 ws how to

5 421 NC group DN group AntgomiR-21 The ontent of ollgen fiers in eh group Piro-sirius re Msson NC DN Antgomir-21 Quntifition of ol-iv n ol-i western lot NC DN Anti-21 2 ol-iv ol-iv ol-i NC DN Antgomir-21 ol-i β-tin Fig. 4 Serum mir-21 ws losely ssoite with ollgen fiers t 24 weeks of ge. yellow or ornge stining represente for CFs y Pirosirius re stining n lue stining represente for CFs y Msson stining. Quntittive nlysis of CCF y Piro-sirius re n Msson stining, men optil ensity (MOD) vlue of CFs ws mrkely inrese in DN group ompre with NC group. After the tretment of ntgomir-21, ffet DN. Aoring to TrgetSn tse ( sm7, ut not ol-iv n ol-i, ws potentil trget of mir-21 ( Fig. 5). Interestingly, kiney-trgeting Sm7 gene trnsfer my e n effetive therpy for type-2 DN, ting vi simultneous moultion of the TGF-β/Sms n NF-κB signlling pthwys [27]. Sm7 suppresses renl firosis vi ltering expression of TGF-β/Sm3-regulte mirna [28]. Therefore, to further onfirm whether sm7 ws vlite mir-21 trget, we performe the luiferse report gene ssys. The results exhiite tht wil-type(wt)-luiferse-sm7-3 UTR reporter gene for luiferse tivity ws remrkly erese ompre with mutnt type(mt)-luiferse-sm7-3 UTR reporter n mir-ontrol plsmi, suggeste tht sm7 ws vlite mir-21 trget ( Fig. 5, p < 5). Next, to investigte whether mir-21 over-expression n inhiitor on sm7 protein, HKCs were trnsfete with mir-ontrol, mir-21 overexpression n mir-21 inhiitor lentivirus vetor, the results emonstrte tht mir-21 over-expression signifintly erese sm7 protein in vitro y Immunofluoresene ell hemistry (ICC) ( Fig. 5,, P < 5). In ontrst, mir-21 inhiitor signifintly inrese sm7 protein ( Fig. 5,, P < 5). Tken together, our t exhiite tht mir-21 ws involve in renl injury of DN y iretly own-regulting sm7, n tht sm7 ws vlite mir-21 trget. Men optil ensity vlue(mod) CFs ws slightly ut signifintly erese. Western lotting n of ol-iv n ol-i protein. Quntifition of ol-iv n ol-i for western lotting results. The grey vlue of ol-iv n ol-i ws mrkely inrese in DN group ompre with NC group. After the tretment of ntgomir-21, ol-iv ws signifintly erese, wheres ol-i ws not hnge. Light mirosopy 4. (Color figure ville online only). Disussion In reent yers, mny stuies hve estlishe mny mirs re losely ssoite with DN [9, 1, 2, 22], mostly fousing on their tions insie the ell from the tissues smples [29]. Beuse of the presene of potent rionuleses, most investigtors oute tht extrellulr RNA oul survive in the loo [3]. Up to now, mny stuies hve oumente irulting lrge numer of serum mirs remin stle n onsistent in severe onitions [31 34]. It is very possile to etet serum mirs whih help to ignose this isese. Therefore, to inentify the reltionship etween serum mir-21 n tissue mir-21 expression, we exmine serum n tissue mir-21 expression y rel-time RT-PCR with the ourse of DN. We foun tht serum mir-21 expressions were shown to e inrese in KK-Ay DN mie t weeks of ge. More surprisingly, the ltere trens of serum mir-21 levels were signifintly onsistent with the expressions of renl tissues mir-21. Importntly, ntgomir-21 n erese the expressions of serum n tissue mir- 21. These results suggeste tht iretly eteting serum mir-21 ws the est sustitute for tissue mir-21. Alumin retinine rtio (ACR) hs een onsiere s goo linil preitor of renl lesions in DN [35]. Cretinine lerne rtio (Cr) is generlly onsiere s mrker of renl filtrtion funtion [25]. We foun tht serum mir-21 expression ws positively orrelte with ACR n negtively orrelte with Cr. Moreover, the hnge tren of mir-21 ws onsistent with ACR, suggesting tht mir-21 my e iomrker refleting for

6 422 3 AGUUGUA-GUC AGACUAUUCGAU 5 hs-mir-21 Luiferse report gene ssys of Sm7 5 CUCCCAUCCUG UGUGUUAAGCUC 3 SMAD7 3 AGUUGUAGUCAGACUAUUCGAU 5 mmu-mir-21 5 GUUUAGAAUUUAACAUAAGCUA 3 Sm7 Luiferse tivity Fig. 5 mir-21 overexpression erese trget sm7 expression. Alignment of hs-mir-21 n mmu-mir-21 with sm7-3 -UTR se on trgetsn softwre from ( severl nuleoties in the 5 -region of mir-21 ontin perfet mth with the 3 -UTR sequene of sm7 genes. The results of luiferse report gene ssys. Representtive photogrph of sm7 protein y ICC. The fluoresene intensity of sm7 proteins (p < 5). (Color figure ville online only). the volume of urine protein exretion. More importntly, ntgomir-21 n not only erese serum mir-21 n ACR ut lso inrese Cr. Tken together; we onlue tht the hnges of irulting serum mir-21 n iniretly reflet renl funtion, whih my e s potentil ignosti iomrker for DN. A well-orgnize ollgen fier ws neessry to mintin struturl n funtionl integrity of renl tissue. Exessive CFs umulte in the kiney, whih versely ffets the struture of the kiney n further le to the loss of renl funtion [36]. Aitionlly, CFs ws the most importnt ingreients omprise of GBM n mesngil mtrix. Moreover, GBM n glomerulr re (GA) were sensitive mrkers of DN [37]. Aumulting stuies showe tht sm7 my e n effetive therpy for DN n renl firosis vi ltering expression of TGF-β1/Sm3-regulte mirs. Moreover, mir-21 prtiiptes in firogeni events in kineys, lungs, hert, or other orgns y regulting unique rry of trgets [14, 38, 39]. Interestingly, our luiferse report gene ssys suggeste tht sm7 ws vlite mir-21 trget, mir- 21 over-expression signifintly erese sm7 expression. All these results showe tht mir-21 ws involve in the pthogenesis of DN y ownregulting trget sm7, ue to the erese of sm7, le to the epostion of ol-iv n ol-i, further resulte in GBM thikene n mesngil mtrix hyperplsi. Aitionlly, we foun tht serum mir-21 ws positively orrelte with GBM, GA, CFC n ol-iv, wheres, unrelte to ol-i. AntgomiR-21 n erese GBM, GA, CFC n ol-iv ut not ol-i. Thus, we speulte tht oth irulting serum mir- Fluoresene intensity of sm7 protein mir-ontrol plsmi WT- luiferse- Sm7-3 UTR mir-21 overexpression erese trget sm7 expression mirontrol pre-mir- 21 MT- luiferse- Sm7-3 UTR mir-21 inhiitor 21 n tissue lol mir-21 were losely ssoite with CFs formtion of DN, espeilly for ol-iv rther thn ol-i. In summry, our stuy suggeste tht serum mir-21 my e s potentil ignosti iomrker for DN, oth irulting serum n tissue lol mir-21 ttenute renl funtion n struture y inhiiting trget sm7. Although our results suggeste serum mir-21 my e new possile mrker for the etetion of DN, up to now, the mesure of urinry lumin exretion rte is the most relile initor. Aknowlegments This stuy ws supporte y Grnts from the Ntionl Nturl Siene Fountion of Chin (No n ), Sientifi reserh projets of Helth re inustry in Gnsu provine in 214 (GWGL n ), n the Mjor Ntionl Bsi Reserh Progrm of Chin (973 Progrm, No. 212CB51862). Disloures: No onflits of interest, finnil or otherwise, re elre y the uthors. Affilitions 1 Deprtment of Enorinology, Gnsu Provinil People s Hospitl, Donggng West Ro, Lnzhou, PR Chin 2 Deprtment of Gyneology n Ostetris, Gnsu Provinil People s Hospitl, Donggng West Ro, Lnzhou, PR Chin

7 423 3 Clinil College of Ophthlmology, Tinjin Meil University, Tinjin Eye Hospitl, Tinjin, Chin 4 Metoli Disese Center, Shool of Tritionl Chinese meil, Cpitl Meil University, Beijing, Chin 5 Deprtment of Enorinology, Beijing Tongren Hospitl, Cpitl Meil University, Beijing, Chin Referenes 1 Nishi S, Ueno M, Hiski S et l. Ultrstruturl hrteristis of ieti nephropthy. Me Eletron Miros 2; 33: oi:1.17/ s Zhong H, Liu F, Fu P et l. A omprison of linil hrteristis n survivl etween ieti nephropthy ptients n non-ieti nephropthy ptients unergoing peritonel ilysis. Sihun D Xue Xue Bo Yi Xue Bn 212; 43: Ryhlik I, Miltenerger-Miltenyi G, Ritz E. The rm of the ontinuous inrese in en-stge renl filure in ptients with type II ietes mellitus. Nephrol Dil Trnsplnt 1998; 13 (Suppl 8): Ito T, Tnimoto M, Ym K et l. Glomerulr hnges in the KK-Ay/ T mouse: possile moel for humn type 2 ieti nephropthy. Nephrology 26; 11: oi:1.1111/j x 5 Perron MP, Provost P. Protein intertions n omplexes in humn mirorna iogenesis n funtion. Frontiers in iosiene: journl n virtul lirry 28; 13: Shntikumr S, Cporli A, Emnueli C. Role of mirornas in ietes n its riovsulr omplitions. Criovs Res 212; 93: oi:vr3 [pii]1.193/vr/vr3 7 He A, Zhu L, Gupt N et l. Overexpression of miro rionulei i 29, highly up-regulte in ieti rts, les to insulin resistne in 3T3-L1 ipoytes. Mol Enorinol 27; 21: oi:me [pii]1.121/me Qin W, Chung AC, Hung XR et l. TGF-et/Sm3 signling promotes renl firosis y inhiiting mir-29. J Am So Nephrol 211; 22: oi:asn [pii]1.1681/asn Wng Q, Wng Y, Minto AW et l. MiroRNA-377 is up-regulte n n le to inrese fironetin proution in ieti nephropthy. FASEB J 28; 22: oi:fj [pii]1.196/ fj Zhng Z, Luo X, Ding S et l. MiroRNA-451 regultes p38 MAPK signling y trgeting of Ywhz n suppresses the mesngil hypertrophy in erly ieti nephropthy. FEBS Lett 212; 586: 2 26 oi:s (11)571- [pii]1.116/j.feslet Cporli A, Meloni M, Vollenkle C et l. Deregultion of mirorna-53 ontriutes to ietes mellitus-inue impirment of enothelil funtion n reprtive ngiogenesis fter lim ishemi. Cirultion 211; 123: oi:circulationaha [pii]1.1161/ CIRCULATIONAHA Chung AC, Hung XR, Meng X et l. mir-192 meites TGF-et/Sm3- riven renl firosis. Journl of the Amerin Soiety of Nephrology: JASN 21; 21: oi:1.1681/asn Krihevsky AM, Griely G. mir-21: smll multi-fete RNA. Journl of ellulr n moleulr meiine 29; 13: oi:1.1111/ j x 14 Zrjou A, Yng S, Arhm E et l. Ientifition of mirorna signture in renl firosis: role of mir-21. Amerin journl of physiology Renl physiology 211; 31: F793 F81 oi:1.1152/jprenl Fiorentino L, Cvler M, Mvilio M et l. Regultion of TIMP3 in ieti nephropthy: role for mirornas. At ietologi 213; 5: oi:1.17/s Li JY, Luo J, O Connor C et l. MiroRNA-21 in glomerulr injury. Journl of the Amerin Soiety of Nephrology: JASN 215; 26: oi:1.1681/asn Dey N, Ds F, Mrippn MM et l. MiroRNA-21 orhestrtes high gluose-inue signls to TOR omplex 1, resulting in renl ell pthology in ietes. The Journl of iologil hemistry 211; 286: oi:1.174/j.m Chu BN, Xin C, Hrtner J et l. MiroRNA-21 promotes firosis of the kiney y silening metoli pthwys. Siene trnsltionl meiine 212; 4: 121r118 oi:1.1126/sitrnslme Zhng Z, Peng H, Chen J et l. MiroRNA-21 protets from mesngil ell prolifertion inue y ieti nephropthy in / mie. FEBS letters 29; 583: oi:1.116/j.feslet Zhong X, Chung AC, Chen HY et l. mir-21 is key therpeuti trget for renl injury in mouse moel of type 2 ietes. Dietologi 213; 56: oi:1.17/s x 21 Glowki F, Svry G, Gnemmi V et l. Inrese irulting mir-21 levels re ssoite with kiney firosis. PLoS One 213; 8: e5814 oi:1.1371/journl.pone.5814pone-d [pii] 22 Wng J, Go Y, M M et l. Effet of mir-21 on Renl Firosis y Regulting MMP-9 n TIMP1 in kk-y Dieti Nephropthy Mie. Cell Biohem Biophys 213; oi:1.17/s Wng JY, Go YB, Zhng N et l. mir-21 overexpression enhnes TGF-et1-inue epithelil-to-mesenhyml trnsition y trget sm7 n ggrvtes renl mge in ieti nephropthy. Moleulr n ellulr enorinology 214; 392: oi:1.116/j. me Krutzfelt J, Kuwjim S, Brih R et l. Speifiity, uplex egrtion n suellulr loliztion of ntgomirs. Nulei Ais Res 27; 35: oi:gkm24 [pii]1.193/nr/gkm24 25 Yokozw T, Nkgw T, Wkki K et l. Animl moel of ieti nephropthy. Exp Toxiol Pthol 21; 53: Mson RM, Wh NA. Extrellulr mtrix metolism in ieti nephropthy. J Am So Nephrol 23; 14: K SM, Yeh YC, Hung XR et l. Kiney-trgeting Sm7 gene trnsfer inhiits renl TGF-et/MAD homologue (SMAD) n nuler ftor kppb (NF-kppB) signlling pthwys, n improves ieti nephropthy in mie. Dietologi 212; 55: oi:1.17/ s Chung AC, Dong Y, Yng W et l. Sm7 suppresses renl firosis vi ltering expression of TGF-et/Sm3-regulte mirornas. Moleulr therpy: the journl of the Amerin Soiety of Gene Therpy 213; 21: oi:1.138/mt Meister G. mirnas get n erly strt on trnsltionl silening. Cell 27; 131: oi:s (7)129-3 [pii]1.116/j. ell El-Hefnwy T, Rj S, Kelly L et l. Chrteriztion of mplifile, irulting RNA in plsm n its potentil s tool for ner ignostis. Clin Chem 24; 5: oi:1.1373/linhem linhem [pii] 31 Wng HJ, Zhng PJ, Chen WJ et l. Chrteriztion n Ientifition of novel serum mirornas in sepsis ptients with ifferent outomes. Shok 213; 39: oi:1.197/shk.13e Chen X, B Y, M L et l. Chrteriztion of mirornas in serum: novel lss of iomrkers for ignosis of ner n other iseses. Cell Res 28; 18: oi:r28282 [pii]1.138/r Siso KL. Is RNA in serum oun to nuleoprotein omplexes? Clin Chem 21; 47: Tsui NB, Ng EK, Lo YM. Stility of enogenous n e RNA in loo speimens, serum, n plsm. Clin Chem 22; 48: Vierti G, Wheelon NM. Miroluminuri reution with vlsrtn in ptients with type 2 ietes mellitus: loo pressure-inepenent effet. Cirultion 22; 16: Goh SY, Cooper ME. Clinil review: The role of vne glytion en prouts in progression n omplitions of ietes. J Clin Enorinol Met 28; 93: oi:j [pii]1.121/ j Ostery R. Morphometri stuies of the peripherl glomerulr sement memrne. II. Topogrphy of the initil lesions. Dietologi 1973; 9: Liu G, Friggeri A, Yng Y et l. mir-21 meites firogeni tivtion of pulmonry firolsts n lung firosis. J Exp Me 21; 27: oi:jem.2135 [pii]1.184/jem Thum T, Gross C, Fieler J et l. MiroRNA-21 ontriutes to myoril isese y stimulting MAP kinse signlling in firolsts. Nture 28; 456: oi:nture7511 [pii]1.138/nture7511