World Journal of Gastroenterology

Transcription

1 ISSN (print) ISSN (online) Worl Journl of Gstroenterology Worl J Gstroenterol 218 Ferury 21; 24(7): Pulishe y Bishieng Pulishing Group In

2 S Contents Weekly Volume 24 Numer 7 Ferury 21, 218 MINIREVIEWS 767 Epiemiology, eterminnts, n mngement of AIDS holngiopthy: A review Nseer M, Diley FE, Juoori AA, Smiullh S, Thn V ORIGINAL ARTICLE Bsi Stuy 775 Gluose trnsporter expression in the humn olon Merigo F, Brnolese A, Fhin S, Missggi S, Bernri P, Boshi F, D Inà R, Svrino EV, Srti A, Sturniolo GC 794 Trnsltionl pnreti ner reserh: A omprtive stuy on ptient-erive xenogrft moels Ruio-Mnznres Doro M, Mrín Gómez LM, Apriio Sánhez D, Pereir Arens S, Pren-Fernánez JM, Borrero Mrtín JJ, Frfán López F, Gómez Brvo MÁ, Muntné Relt J, Pillo Ruiz J 81 Cryopreservtion for elye irulting tumor ell isoltion is vli strtegy for prognosti ssoition of irulting tumor ells in gstroesophgel ner Brungs D, Lynh D, Luk AW, Minei E, Rnson M, Aghmesheh M, Vine KL, Croln M, Jer M, e Souz P, Beker TM 819 Metformin ttenutes motility, ontrtion, n firogeni response of hepti stellte ells in vivo n in vitro y tivting AMP-tivte protein kinse Li Z, Ding Q, Ling LP, Wu Y, Meng DX, Li X, Zhng CQ 833 Fish oil llevites liver injury inue y intestinl ishemi/reperfusion vi AMPK/SIRT-1/utophgy pthwy Jing HR, Luo FW, Liu XM, Tin XF, Zhou Y Retrospetive Cohort Stuy 844 Elerly ptients h more severe postopertive omplitions fter pnreti resetion: A retrospetive nlysis of 727 ptients Chen YT, M FH, Wng CF, Zho DB, Zhng YW, Tin YT Retrospetive Stuy 852 Preitors of funtionl enefit of heptitis C therpy in rel-life ohort Steinerunner N, Stein K, Snig C, Brukner T, Stremmel W, Pthil A 862 Preitors of post-tretment stenosis in ervil esophgel ner unergoing high-ose riotherpy Kim JW, Kim TH, Kim JH, Lee IJ WJG Ferury 21, 218 Volume 24 Issue 7

3 Contents Worl Journl of Gstroenterology Volume 24 Numer 7 Ferury 21, 218 CASE REPORT 87 Esophgel metstsis of stem ell-sutype heptoholngiorinom: Rre presenttion of rre tumor Slimon M, Chpelle N, Mtysik-Bunik T, Mosnier JF, Frmps E, Touhefeu Y CORRECTION 876 Corretion for "Evlution of multiplex PCR ssy for etetion of ytomeglovirus in stool smples from ptients with ulertive olitis" (Worl J Gstroenterol 215; 21: ) Hokm A WJG II Ferury 21, 218 Volume 24 Issue 7

4 Contents Worl Journl of Gstroenterology Volume 24 Numer 7 Ferury 21, 218 ABOUT COVER Eitoril or memer of Worl Journl of Gstroenterology, Serr Toploglu, MD, Assoite Professor, Deprtment of Surgery, Shool of Meiine, Kreniz Tehnil University, Trzon 618, Turkey AIMS AND SCOPE INDEXING/ABSTRACTING Worl Journl of Gstroenterology (Worl J Gstroenterol, WJG, print ISSN , online ISSN , DOI: ) is peer-reviewe open ess journl. WJG ws estlishe on Otoer 1, It is pulishe weekly on the 7 th, 14 th, 21 st, n 28 th eh month. The WJG Eitoril Bor onsists of 642 experts in gstroenterology n heptology from 59 ountries. The primry tsk of WJG is to rpily pulish high-qulity originl rtiles, reviews, n ommentries in the fiels of gstroenterology, heptology, gstrointestinl enosopy, gstrointestinl surgery, heptoiliry surgery, gstrointestinl onology, gstrointestinl rition onology, gstrointestinl imging, gstrointestinl interventionl therpy, gstrointestinl infetious iseses, gstrointestinl phrmology, gstrointestinl pthophysiology, gstrointestinl pthology, eviene-se meiine in gstroenterology, pnretology, gstrointestinl lortory meiine, gstrointestinl moleulr iology, gstrointestinl immunology, gstrointestinl miroiology, gstrointestinl genetis, gstrointestinl trnsltionl meiine, gstrointestinl ignostis, n gstrointestinl therpeutis. WJG is eite to eome n influentil n prestigious journl in gstroenterology n heptology, to promote the evelopment of ove isiplines, n to improve the ignosti n therpeuti skill n expertise of liniins. Worl Journl of Gstroenterology (WJG) is now inexe in Current Contents /Clinil Meiine, Siene Cittion Inex Expne (lso known s SiSerh ), Journl Cittion Reports, Inex Meius, MEDLINE, PuMe, PuMe Centrl n Diretory of Open Aess Journls. The 217 eition of Journl Cittion Reports ites the 216 impt ftor for WJG s (5-yer impt ftor: 3.176), rnking WJG s 29 th mong 79 journls in gstroenterology n heptology (qurtile in tegory Q2). EDITORS FOR THIS ISSUE Responsile Assistnt Eitor: Xing Li Responsile Eletroni Eitor: Yn Hung Proofing Eitor-in-Chief: Lin-Sheng M Responsile Siene Eitor: Ze-Mo Gong Proofing Eitoril Offie Diretor: Jin-Lei Wng NAME OF JOURNAL Worl Journl of Gstroenterology ISSN ISSN (print) ISSN (online) LAUNCH DATE Otoer 1, 1995 FREQUENCY Weekly EDITORS-IN-CHIEF Dmin Gri-Olmo, MD, PhD, Dotor, Professor, Surgeon, Deprtment of Surgery, Universi Autonom e Mri; Deprtment of Generl Surgery, Funion Jimenez Diz University Hospitl, Mri 284, Spin Stephen C Strom, PhD, Professor, Deprtment of Lortory Meiine, Division of Pthology, Krolinsk Institutet, Stokholm , Sween Anrzej S Trnwski, MD, PhD, DS (Me), Professor of Meiine, Chief Gstroenterology, VA Long Beh Helth Cre System, University of Cliforni, Irvine, CA, 591 E. Seventh Str., Long Beh, CA 9822, Unite Sttes EDITORIAL BOARD MEMBERS All eitoril or memers resoures online t EDITORIAL OFFICE Ze-Mo Gong, Diretor Worl Journl of Gstroenterology Bishieng Pulishing Group In 791 Stonerige Drive, Suite 51, Plesnton, CA 94588, USA Telephone: Fx: E-mil: eitoriloffie@wjgnet.om Help Desk: PUBLISHER Bishieng Pulishing Group In 791 Stonerige Drive, Suite 51, Plesnton, CA 94588, USA Telephone: Fx: E-mil: pgoffie@wjgnet.om Help Desk: PUBLICATION DATE Ferury 21, 218 COPYRIGHT 218 Bishieng Pulishing Group In. Artiles pulishe y this Open-Aess journl re istriute uner the terms of the Cretive Commons Attriution Nonommeril Liense, whih permits use, istriution, n reproution in ny meium, provie the originl work is properly ite, the use is non ommeril n is otherwise in ompline with the liense. SPECIAL STATEMENT All rtiles pulishe in journls owne y the Bishieng Pulishing Group (BPG) represent the views n opinions of their uthors, n not the views, opinions or poliies of the BPG, exept where otherwise expliitly inite. INSTRUCTIONS TO AUTHORS Full instrutions re ville online t wjgnet.om/pg/gerinfo/24 ONLINE SUBMISSION WJG III Ferury 21, 218 Volume 24 Issue 7

5 Sumit Mnusript: DOI: /wjg.v24.i7.819 Worl J Gstroenterol 218 Ferury 21; 24(7): ISSN (print) ISSN (online) Bsi Stuy ORIGINAL ARTICLE Metformin ttenutes motility, ontrtion, n firogeni response of hepti stellte ells in vivo n in vitro y tivting AMP-tivte protein kinse Zhen Li, Qin Ding, Li-Ping Ling, Ying Wu, Dong-Xio Meng, Xio Li, Chun-Qing Zhng Zhen Li, Qin Ding, Li-Ping Ling, Ying Wu, Dong-Xio Meng, Xio Li, Chun-Qing Zhng, Deprtment of Gstroenterology, Shnong Provinil Hospitl Affilite to Shnong University, Jinn 2521, Shnong Provine, Chin Zhen Li, Li-Ping Ling, Ying Wu, Dong-Xio Meng, Xio Li, Shnong Provinil engineering n tehnologil reserh enter for liver isese prevention n ontrol, Jinn 2521, Shnong Provine, Chin ORCID numer: Zhen Li ( ); Qin Ding ( ); Li-Ping Ling ( X); Ying Wu ( ); Dong-Xio Meng ( ); Xio Li ( ); Chun- Qing Zhng ( ). Author ontriutions: Li Z, Ding Q, Ling LP, Wu Y n Meng DX performe the stuy; Li Z, Ding Q n Li X ollete n nlyze the t n eite the mnusript; Li Z n Zhng CQ esigne the stuy n wrote the mnusript. Supporte y Ntionl Nturl Siene Fountion of Chin, No Institutionl review or sttement: The stuy ws reviewe n pprove y the Institutionl Review Bor of Shnong Provinil Hospitl Affilite to Shnong University. Institutionl niml re n use ommittee sttement: The onsent proeure n stuy protool were pprove y the Animl Meil Ethis Committee of Shnong Provinil Hospitl Affilite to Shnong University (No ). Conflit-of-interest sttement: The uthors elre no onflit of interest relte to this mnusript. Dt shring sttement: No itionl unpulishe t re ville. Open-Aess: This rtile is n open-ess rtile whih ws selete y n in-house eitor n fully peer-reviewe y externl reviewers. It is istriute in orne with the Cretive Commons Attriution Non Commeril (CC BY-NC 4.) liense, whih permits others to istriute, remix, pt, uil upon this work non-ommerilly, n liense their erivtive works on ifferent terms, provie the originl work is properly ite n the use is non-ommeril. See: lienses/y-n/4./ Mnusript soure: Unsoliite mnusript Corresponene to: Chun-Qing Zhng, PhD, Chief Dotor, Deprtment of Gstroenterology, Shnong Provinil Hospitl ffilite to Shnong University, 324 Jingwu Weiqi Ro, Jinn 2521, Shnong Provine, Chin. zhnghunqing_su@163.om Telephone: Fx: Reeive: Novemer 21, 217 Peer-review strte: Novemer 21, 217 First eision: Deemer 6, 217 Revise: Deemer 12, 217 Aepte: Deemer 26, 217 Artile in press: Deemer 26, 217 Pulishe online: Ferury 21, 218 Astrt AIM To investigte the effet of metformin on tivte hepti stellte ells (HSCs) n the possile signling pthwys involve. METHODS A firoti mouse moel ws generte y intrperitonel injetion of ron tetrhlorie (CCl4) n susequent tretment with or without metformin. The level of firosis ws etete y hemtoxylin-eosin stining, Sirius Re stining, n immunohistohemistry. The HSC ell line LX-2 ws use for in vitro stuies. The effet of metformin on ell prolifertion (CCK8 ssy), WJG Ferury 21, 218 Volume 24 Issue 7

6 Li Z et l. Effet of metformin on tivte HSCs motility (srth test n Trnswell ssy), ontrtion (ollgen gel ontrtion ssy), extrellulr mtrix (ECM) seretion (Western lot), n ngiogenesis (ELISA n tue formtion ssy) ws investigte. We lso nlyze the possile signling pthwys involve y Western lot nlysis. RESULTS Mie evelope mrke liver firosis fter intrperitonel injetion with CCl4 for 6 wk. Metformin erese the tivtion of HSCs, reue the eposition of ECM, n inhiite ngiogenesis in CCl4-trete mie. Pltelet-erive growth ftor (PDGF) promote the firogeni response of HSCs in vitro, while metformin inhiite the tivtion, prolifertion, migrtion, n ontrtion of HSCs, n reue the seretion of ECM. Metformin erese the expression of vsulr enothelil growth ftor (VEGF) in HSCs through inhiition of hypoxi inuile ftor (HIF)-1α in oth tretment n hypoxi onitions, n it own-regulte VEGF seretion y HSCs n inhiite HSC-se ngiogenesis in hypoxi onitions in vitro. The inhiitory effets of metformin on tivte HSCs were meite y inhiiting the Akt/mmmlin trget of rpmyin (mtor) n extrellulr signl-regulte kinse (ERK) pthwys vi the tivtion of enosine monophosphte-tivte protein kinse (AMPK). CONCLUSION Metformin ttenutes the firogeni response of HSCs in vivo n in vitro, n my therefore e useful for the tretment of hroni liver iseses. Key wors: hepti stellte ell; intrhepti vsulr resistne; ngiogenesis; ontrtion; liver firosis; enosine monophosphte-tivte protein kinse The Author(s) 218. Pulishe y Bishieng Pulishing Group In. All rights reserve. Core tip: Ativtion of hepti stellte ells (HSCs) ontriutes to liver firosis n portl hypertension. In this stuy, we exmine the effet of metformin on tivte HSCs in vivo n in vitro. Metformin erese the tivtion of HSCs, reue the eposition of extrellulr mtrix (ECM), n inhiite ngiogenesis in CCl4-trete mie. Moreover, metformin inhiite the tivtion, prolifertion, motility, n ontrtion of tivte HSCs, reue the seretion of ECM, n erese HSC-se ngiogenesis, thus proviing new therpeuti pproh to the tretment of liver firosis n portl hypertension. Li Z, Ding Q, Ling LP, Wu Y, Meng DX, Li X, Zhng CQ. Metformin ttenutes motility, ontrtion, n firogeni response of hepti stellte ells in vivo n in vitro y tivting AMP-tivte protein kinse. Worl J Gstroenterol 218; 24(7): Aville from: URL: om/ /full/v24/i7/819.htm DOI: org/1.3748/wjg.v24.i7.819 INTRODUCTION Liver firosis is ommon pthologil onition resulting from hroni liver injury stemming from vriety of etiologil ftors. Hepti stellte ells (HSCs) ply key role in the progression of liver firosis, n re thought to e its primry effetor ells [1]. In hroni liver iseses (CLDs), quiesent HSCs re tivte n hnge to myofirolst-like ells, whih re prolifertive, ontrtile, n serete inrese levels of more extrellulr mtrix (ECM) [2]. Angiogenesis is wiely note in CLDs, n influenes liver firosis n portl hypertension (PHT) [3]. HSCs re liverspeifi periytes tht prtiipte in ngiogenesis n sinusoil remoeling. The primry pthologil feture of sinusoil remoeling is sinusoil pillriztion n overge of the vessels with ontrtile HSCs [4]. HSCs reue the imeter of sinusois fter ontrtion, using funtionl hnge in moulting the hepti tone n inresing intrhepti vsulr resistne (IHVR), ultimtely ontriuting to PHT [5]. HSCs oupy rossro t the intersetion etween inflmmtion, ngiogenesis, n firosis [6], n tivtion of HSCs is key event meiting inrese IHVR [7]. Thus, tivte HSCs re potent therpeuti trget for the tretment of CLDs. Metformin is the first-line rug reommene for the tretment of ietes. Previous stuies hve emonstrte tht metformin hs wie rnge of phrmologil tivities eyon its ntiieti effets. The enefiil effets of metformin in hepti isorers hve een previously onfirme for reuing firosis [8,9], IHVR, n therefore PHT in irrhosis [1], n eresing heptoellulr rinom risk [11]. Metformin is potent therpeuti pproh for CLDs, ut the mehnisms unerlying its effets re still unler, espeilly in the tretment of PHT. Further stuies re neee to investigte the effet of metformin in CLDs. Pltelet-erive growth ftor (PDGF) signling is mong the most well hrterize pthwys of HSC tivtion. It inues tivtion of the extrellulr signl-regulte kinse (ERK) n the Akt/mmmlin trget of rpmyin (mtor) pthwys, whih re ssoite with ellulr prolifertion n migrtion [12]. Stuies hve lso linke ERK n mtor signling to vsulr enothelil gowth ftor (VEGF) expression uring ngiogenesis [13,14]. Ativtion of enosine monophosphte-tivte protein kinse (AMPK) inhiits the prolifertion n migrtion of HSCs inue y PDGF, n this effet is relte to the inhiition of the Akt n ERK pthwys [15]. Metformin is known to tivte AMPK, therefore, we speulte tht metformin my regulte the firogeni response of HSCs n hve n nti-ngiogeni effet. In the present stuy, we investigte the effet of metformin on tivte HSCs. The inhiitory effets of metformin on the tivtion, prolifertion, motility, ontrtion, n ECM seretion of HSCs n HSC-se ngiogenesis were evlute. We lso investigte the WJG 82 Ferury 21, 218 Volume 24 Issue 7

7 Li Z et l. Effet of metformin on tivte HSCs unerlying mehnisms, with fous on AMPK n the ownstrem AKT/mTOR n ERK signling pthwys. MATERIALS AND METHODS Animls Thirty mle C57BL/6 mie weighing 2-22 g were purhse from the Centrl Animl Cre Fility of Shnong University n rnomly ivie into three groups ( ontrol group, CCl4 group, n metformin group, n = 1 in eh group). The nimls were house in n ir onitione room t with light/rk (12 h:12 h) yle for one week prior to the initition of the experiment. All nimls reeive pproprite re uring the stuy, with free ess to how n wter. The liver firosis moel ws inue y intrperitonel injetion of ron tetrhlorie (CCl4, 1 µl/g, Sinophrm, Beijing, Chin) issolve 1:1 (v/v) in olive oil twie per week, while the ontrol mie were injete with olive oil lone. Mie in the metformin group were trete with metformin (Sigm-Alrih, Sint Louis, MO, Unite Sttes) in rinking wter (1 g/l) t the sme time. All mie were srifie t the en of 6 wk. A portion of liver tissue ws fixe in 4% prformlehye n then emee in prffin. The other liver tissues were store t -8. Cell ulture The HSC ell line LX-2 ( kin gift from Professor Wei-fen Xie, Chngzheng Hospitl, the Seon Militry Meil University) n humn umilil vsulr enothelil ells (HUVECs, ATCC, Mnsss, VA, Unite Sttes) were ulture in Duleo's moifie Egle's meium (DMEM; Gio, Grn Isln, NY, Unite Sttes) supplemente with 1% fetl ovine serum (FBS; Gio) in n inutor t 37 with 5% CO2 n 9% humiity. CCK-8 ssy First, LX-2 ells were seee in 96-well pltes n inute overnight, n then the meium ws hnge to fresh meium ontining ifferent onentrtions of metformin. After inution for 24 h, 1 µl of CCK-8 (Dojino, Jpn) ws e to eh well. The optil ensity (OD) vlues were mesure every 3 min with spetrophotometer (Thermo Fisher, Finln) t 45 nm. The OD vlues t 2 h were hosen for nlysis. Migrtion n invsion ssy A srth test ws use for HSC migrtion ssy. Cells (5 1 5 ) were seee in 6-well pltes, inute overnight to over the full plte, n then serumstrve for 8 h. After mking srth wouns, pltes were wshe three times with PBS. Cells were trete with or without 1 ng/ml (PeproTeh, Roky Hill, NJ, Unite Sttes) for 24 h. Different onentrtions of metformin were e to the meium 2 h efore the ition. Imges were quire t n 24 h. The Trnswell (8 µm pore size, Costr) ssy ws use to test the invsive ility of HSCs. HSCs were serum-free for 6 h n then hrveste. Cells (1 1 5 ) in 1 µl serum-free meium were seee in the upper hmers with the Mtrigel (BD Biosiene, Befor, MA, Unite Sttes) memrne n ifferent onentrtions of metformin, n the lower hmers were loe with DMEM with or without 1% FBS. After inution for 24 h, ells tht migrte through the memrne were fixe n stine with hemtoxylin. Cell numers were ounte uner mirosope (Olympus, Jpn). Collgen gel ontrtion ssy Rt til tenon ollgen type Ⅰ ws otine from Syio (Hngzhou, Chin). The ollgen gel ws prepre in 24-well pltes. We use.1 mol/l NOH to just the ph n 1 PBS to just the solution to physiologil strength. The mixe solution (5 µl) ws e to eh plte n inute t 37 for 1 h to llow geltiniztion. LX-2 ells (1 1 5 ) in 1 µl of meium were seee on the gel n inute overnight. Cells were strve for 8 h in DMEM, n then the DMEM ws reple with fresh meium with 1% FBS n ifferent onentrtions of metformin. PDGF- BB (1 ng/ml) ws e to the meium, exept in the ontrol group, 2 h fter metformin ition. The tip of 2 µl pipette ws use to gently eth the gel from the pltes. After inution for 24 h, the res of the gels were mesure. Enzyme-linke immunosorent ssy First, LX-2 ells were seee in 6-well pltes n inute overnight. Cells were strve in DMEM for 8 h. The DMEM ws hnge to 1 ml of fresh meium with 1% FBS n ifferent onentrtions of metformin. Colt (Ⅱ) hlorie hexhyrte (CoCl2 6H2O, 15 µmol/l, Sigm-Alrih, Sint Louis, MO, Unite Sttes) ws e to the meium, exept for the ontrol group, 2 h fter metformin ition. After 12 h of inution, the superntnt ws ollete n entrifuge t 1 rpm for 4 min. VEGF ws mesure with n ELISA kit (Boster, Wuhn, Chin). The ELISA protool ws performe oring to the mnufturer s instrutions. Tue formtion ssy A 96-well plte ws ote with 5 µl of Mtrigel, n then ple in n inutor t 37 for 1 h. Cells were trete in the sme wy s in the ELISA ssy, n the superntnt ws ollete. Conitione meium ws generte from superntnt ilute 4:1 (v/v) in DMEM with 1% FBS. HUVECs were hrveste n suspene in the onitione meium. HUVECs (2 1 4 ) in 1 µl of onitione meium were seee in 96-well pltes n inute t 37. The ells were WJG Ferury 21, 218 Volume 24 Issue 7

8 Li Z et l. Effet of metformin on tivte HSCs Tle 1 The primers use for RT-PCR nlysis Primer (Mouse) Sequene (5-3 ) F R α -SMA F α -SMA R COL1A1 F COL1A1 R AAATGGTGAAGGTCGGTGTGAAC CAACAATCTCCACTTTGCCACTG GACAATGGCTCTGGGCTCTGTA TTTGGCCCATTCCAACCATTA GACATGTTCAGCTTTGTGGACCTC GGGACCCTTAGGCCATTGTGTA α-sma: lph-smooth musle tin; COL1A1: ollgen type 1 lph 1. monitore every 2 h for 12 h uner mirosope. Imges of the tue formtion were quire t 8 h. Western lot nlysis Totl protein ws extrte with RIPA uffer, n the protein onentrtion ws mesure y the iinhonini i metho. Equl mounts of proteins were loe n seprte y SDS-PAGE, n then trnsferre onto PVDF memrne. The memrne ws loke in TBST uffer with 5% non-ft milk for 1 h n inute with ifferent ntioies overnight t 4. Primry ntioies ginst α-sma ( AP), fironetin ( IG), n ollgen type Ⅰ ( AP) were otine from Proteinteh (Wuhn, Chin). Primry ntioies ginst p-erk1/2 (#4376), p-akt (#46), p-ampk (#2535), p-mtor (#5536), ERK1/2 (#4695), Akt (#4691), AMPK (#5832), n mtor (#2983) were otine from CST (Boston, MA, Unite Sttes). Primry ntioy ginst VEGF (46154) ws otine from Am (Cmrige, CA, Unite Sttes). Primry ntioy ginst HIF-1α (NB1-15) ws otine from Novus (Littleton, CO, Unite Sttes). Primry ntioy ginst glyerlehye 3-phosphte ehyrogense () n horserish peroxise (HRP)-onjugte seonry ntioy were otine from Zhongshn Golen Brige (Beijing, Chin). The HRP-onjugte seonry ntioies were got nti-rit or nti-mouse ntioy epening on the primry ntioies. AICAR (n AMPK tivtor) n rpmyin (n mtor inhiitor) were otine from Sellek (Houston, TX, Unite Sttes). PD9859 (n ERK inhiitor) n LY2942 (n AKT inhiitor) were otine from MCE (Monmouth Juntion, NJ, Unite Sttes). Antioy ns were etete y enhne hemiluminesene with Amershm Imger 6 (GE Helthre, Unite Sttes). in the sme memrne ws use s n internl ontrol, n ll ns were normlize to its expression. Reverse trnsription-polymerse hin retion Totl RNA ws extrte with TRIzol regent (Tkr, Jpn) from frozen liver tissues n ws reversetrnsrie to DNA using n RT regent kit (Tkr, Jpn). Amplifitions were etete using the SYBR Premix Ex Tq kit (Tkr, Jpn) on LightCyler 48 Rel-Time PCR system (Rohe Dignostis, Unite Sttes). The primers use in this stuy re presente in Tle 1. Expression of trget genes ws normlize to expression of y the 2 -ΔCT metho. Histopthologil n immunohistohemil nlyses Liver speimens emee in prffin were ut into 4 µm-thik setions. The speimens were stine with hemtoxylin n eosin n Sirius Re. Immunohistohemistry (IHC) ws performe using 2-step plus Poly-HRP Anti-Mouse/Rit IgG Detetion system (Zhongshn Golen Brige, Beijing, Chin), oring to the mnufturer s instrutions. Setions were inute with ntioies ginst α-sma, fironetin, n VEGF, n the lots were evelope with DAB kit (Zhongshn Golen Brige, Beijing, Chin). Sttistil nlysis All t re presente s the men ± SEM from t lest three inepenent experiments. Sttistis were nlyze using GrphP Prism 5. n SPSS19. softwre. Sttistil signifine ws etermine y one-wy nlysis of vrine (ANOVA) followe y Dunnett s test. A p-vlue < 5 ws onsiere sttistilly signifint. RESULTS Metformin ereses the tivtion of HSCs, reues the eposition of ECM, n inhiits ngiogenesis in CCl4-trete mie Liver speimens from mie expose to CCl4 showe heptoellulr egenertion with exessive umultion of onnetive tissue, the formtion of firoti sept, n infiltrtion of inflmmtory ells. Metformin tretment ttenute the firoti level of the firoti tissue, the pperne of egenerte heptoytes, n inflmmtory ell infiltrtion (Figure 1A). Inrese ollgen eposition ws oserve in CCl4-inue firoti mie, whih oul e suppresse y metformin (Figure 1B). A similr effet of metformin on fironetin ws seen in IHC (Figure 1D). As shown in Figure 1E, firoti mie expresse more VEGF, initing more intrhepti ngiogenesis thn the ontrol group. Tretment with metformin signifintly suppresse expression of VEGF. Mie expose to CCl4 inrese α-sma t oth the protein n mrna levels, while o-tretment with metformin reue this effet (Figure 2A n B), whih ws lso onfirme y IHC (Figure 1C). The CCl4-inue inrese in ollgen I mrna expression ws reue y o-tretment with metformin. Tken together, metformin erese the tivtion of HSCs, reue the eposition of ECM, n inhiite ngiogenesis in CCl4-trete mie. Therefore, metformin ttenute CCl4-inue liver firosis in mie. Metformin inhiits the prolifertion of tivte HSCs HSCs were trete with ifferent onentrtions WJG Ferury 21, 218 Volume 24 Issue 7

9 Li Z et l. Effet of metformin on tivte HSCs A Control CCl4 CCl4 + MET 3 H-E stining B S-R stining S-R stining (fol) 2 1 Control CCl4 CCl4 + MET C α-sma α-sma expression (fol) Control CCl4 CCl4 + MET D Fironetin Fironetin expression (fol) Control CCl4 CCl4 + MET E 2. VEGF VEGF expression (fol).5 Control CCl4 CCl4 + MET Figure 1 Effet of metformin in CCl4-inue firoti mie. A firoti mouse moel ws inue y intrperitonel injetion of CCl4 (1 µl/g) issolve in olive oil (CCl4:olive oil = 1:1, v/v) twie per week for 6 weeks. A n B: Histologil hnges were ssesse y hemtoxylin-eosin (H-E) stining n Sirius Re (S-R) stining (1 mgnifition); C-E: Expression levels of α-sma, fironetin, n VEGF in the liver tissues were mesure y immunohistohemistry (1 mgnifition). Sirius Re stining ws nlyze with ImgeJ n immunohistohemil stining ws nlyze with Imge-Pro Plus 6.. (Sle r = 2 µm, n = 5, P < 1 vs the ontrol group, P < 1 vs the CCl4 group). WJG Ferury 21, 218 Volume 24 Issue 7

10 Li Z et l. Effet of metformin on tivte HSCs A 4 α-sma Control CCl4 CCl4 + MET α-sma/ (fol) Control CCl4 CCl4 + MET B 2 4 α-sma mrna (fol) COL1A1 mrna (fol) Control CCl4 CCl4 + MET Control CCl4 CCl4 + MET C MET (mmol/l) α-sma α-sma/ (fol).5 MET (mmol/l) D MET (mmol/l) FN COL1A2 FN COL1A2 Fol hnge.5 MET (mmol/l) E 12 1 Cell prolifertion Cell viility (%) Metformin (mmol/l) Figure 2 Effet of metformin on the tivtion, prolifertion, n extrellulr mtrix seretion of hepti stellte ells. A: Mesurement of α-sma levels in murine liver tissues y Western lot; B: Mesurement of hepti α-sma n ollgen type Ⅰ mrna expression levels y quntittive rel-time PCR (n = 5, P < 1 vs the ontrol group, P < 1 vs the CCl4 group); C n D: HSCs were trete with or without 1 ng/ml for 24 h, n the effet of metformin (1, 2, 5, n 1 mmol/l) on the expression levels of α-sma, ollgen type Ⅰ, n fironetin (FN) were mesure y Western lot ( P < 5 vs the ontrol group, P < 5 n P < 1 vs the only group); E: HSCs were trete with series of onentrtions rnging from 1 mmol/l to 1 mmol/l of metformin for 24 h, n the prolifertion ws mesure y CCK-8 ssys. HSCs: hepti stellte ells. WJG Ferury 21, 218 Volume 24 Issue 7

11 Li Z et l. Effet of metformin on tivte HSCs (1 mmol/l to 1 mmol/l) of metformin for 24 h (Figure 2E). The prolifertion of HSCs ws inhiite y metformin in ose-epenent mnner, n the IC5 ws 51 mmol/l. Metformin suppresses the tivtion of HSCs n ereses the expression of ECM in vitro The protein levels of α-sma, ollgen type Ⅰ, n fironetin were mesure y Western lot (Figure 2C n D). up-regulte the expression of α-sma, while tretment with metformin t 5 mmol/l n 1 mmol/l suppresse this inrese, from 113.5% ± 4.66% to 84.87% ± 6.63% n 58.79% ± 12.64%, respetively (P < 5). Collgen type I n fironetin re the mjor omponents of the ECM, n HSCs expresse inrese levels of these protein fter oinution with. Metformin erese the protein levels t oses of 2, 5, n 1 mmol/l. These results inite tht metformin suppresse the tivtion of HSCs n the seretion of ECM in vitro. Metformin ereses the migrtion n invsion of HSCs The migrtion rte of HSCs ws signifintly inrese y tretment ompre with tht of the ontrol group (26.38% ± 2.98% to 48.5% ± 3.67%, P < 1). Tretment with metformin t 5 mmol/l n 1 mmol/l reue -inue migrtion, from 48.5% ± 3.67% to 21.67% ± 2.73% n 14.99% ±.25% (P < 1), respetively (Figure 3A n C). As shown in Figure 3B, ells tht migrte through the mtrigel memrne erese from 1352% ± 62.87% to 748.% ± 76.18%, 453.% ± 4.58%, n 19% ± 14.73% (P < 1) ompre with the ontrol group when trete with metformin t 1, 5, n 1 mmol/l, respetively (Figure 3D). These finings inite tht metformin erese the motility of HSCs. Metformin inhiits the ontrtion of HSCs We ssesse the inhiitory effet of metformin on the ontrtility of HSCs y ollgen gel ontrtion ssy. use signifint inrese in ell ontrtility, while o-ulture with metformin neutrlize these effets (Figure 4A n C). tretment enhne the ontrtion rte of HSCs from 47.43% ± 2.13% to 7.25% ± 1.35% (P < 1), while tretment with metformin t 1, 5, n 1 mmol/l ttenute the ontrtion rte to 49.7% ± 6.59% (P < 5), 44.73% ± 4.65%, n 42.26% ± 3.28% (P < 1), respetively. Metformin ereses the expression of VEGF in HSCs through inhiition of HIF-1α in oth n hypoxi onitions CoCl2 6H2O (15 µmol/l) ws e to the meium to mimi hypoxi onitions [16,17]. HSCs expresse more VEGF when inute with or CoCl2 ompre with the ontrol group, n this effet ws ssoite with n inrese level of HIF-1α (Figure 5A n B). Metformin erese the level of HIF-1α n further reue the expression of VEGF in HSCs. Tretment with metformin t 5 n 1 mmol/l h n inhiitory effet on VEGF expression in oth n hypoxi onitions. Metformin own-regultes VEGF seretion y HSCs n inhiits ngiogenesis in hypoxi onitions in vitro The VEGF protein level in the superntnt ws inrese from ± 5.62 pg/ml to ± pg/ml (P < 1) when CoCl2 (15 µmol/l) ws e to the meium, ut o-ulture with metformin t 5 mmol/l n 1 mmol/l erese VEGF levels to ± pg/ml n ± 1.62 pg/ml, respetively (P < 1) (Figure 5C). Tue formtion of HUVECs on Mtrigel n e use to nlyze ngiogenesis in vitro. HUVECs were ulture in onitione meium on Mtrigel-ote pltes. The onitione meium from CoCl2-trete HSCs signifintly inrese tue formtion, while onitione meium from HSCs otrete with CoCl2 n metformin erese tue formtion. AICAR mimike the effet of metformin on tue formtion (Figure 5D n E). Metformin inhiits the firogeni response of HSCs through inhiition of the Akt/mTOR n ERK pthwys vi the tivtion of AMPK Metformin inrese the phosphoryltion of AMPK in ose-epenent mnner (Figure 6C). After stimultion with, the levels of p-akt, p-mtor, n p-erk were signifintly inrese ompre with those of the ontrol group, while o-tretment with metformin erese these effets (Figure 6A n E). The Akt/mTOR n ERK pthwys re ssoite with ell prolifertion, migrtion, n phenotypi hnge in HSCs. To further onfirm these effets, we use vrious inite inhiitors to tret HSCs (Figure 7A n C). LY2942 (n Akt inhiitor, 2 µmol/l) n rpmyin (n mtor inhiitor, 1 nmol/l) inhiite the tivtion of HSCs, erese ECM seretion, n reue the expression of HIF-1α n VEGF. Moreover, LY2942 inhiite the ontrtion of HSCs (Figure 4B n D). PD9859 (n ERK inhiitor, 1 µmol/l) h similr effet s LY2942, exept tht it oul not erese the seretion of ollgen type I. Aitionlly, AICAR (5 µmol/l), nother AMPK tivtor, mimike the effet of metformin. In onlusion, inrese the firogeni response of HSCs through tivting the ownstrem Akt/mTOR n ERK pthwys, while metformin inhiite these effets vi tivtion of AMPK. Metformin ereses VEGF expression y tivte HSCs y own-regulting the mtor/hif-1α n ERK/ HIF-1α pthwys uner hypoxi onitions The levels of p-mtor n p-erk were signifintly inrese when ompre with the ontrol group uner hypoxi onitions, while no hnge ws foun in the WJG Ferury 21, 218 Volume 24 Issue 7

12 Li Z et l. Effet of metformin on tivte HSCs A h 24 h MET (mmol/l) B MET (mmol/l) FBS C.6 D 15 Migrtion rte.4.2 Trnswell ssy (fol) 1 5 MET (mmol/l) MET (mmol/l) FBS Figure 3 Effet of metformin on hepti stellte ell migrtion n invsion. Srth tests were use to etermine ell migrtion, n Trnswell ssys were use to evlute ell invsion. A: HSCs were srpe n then inute with or without (1 ng/ml) n metformin (1, 2, 5, n 1 mmol/l). Imges were quire t n 24 h (1 mgnifition); B: HSCs were seee in the upper hmer with Mtrigel memrne, n vrious onentrtions of metformin (, 1, 5, n 1 mmol/l) were e to the meium. The lower hmers were loe with DMEM with or without 1% FBS. Cells tht migrte through the memrne were fixe n stine with hemtoxylin t 24 h; C: The migrtion ility ws quntifie y mesuring the istne of the srth ege; D: Cells tht migrte through the memrne were ounte n quntifie. ( P < 1 vs the ontrol group, P < 5 n P < 1 vs the or FBS only groups). HSCs: hepti stellte ells. phosphoryltion of Akt (Figure 6B n D). Metformin inrese the phosphoryltion of AMPK n inhiite the tivtion of p-mtor n p-erk. PD9859 n rpmyin erese the expression of HIF-1α n VEGF. LY2942 inhiite the tivtion of p-akt n the ownstrem p-mtor, whih therefore erese the expression of HIF-1α n VEGF. AICAR h similr effet s metformin uner these onitions (Figure 7D n F). These results inite tht metformin erese VEGF expression y tivte HSCs y own-regulting the mtor/hif-1α n ERK/ HIF-1α signling pthwys uner hypoxi onitions. DISCUSSION The prime eterminnt of PHT is inrese IHVR, whih is thought to e generte y the following two ftors: struturl (istortion of the liver vsulr rhiteture use y firosis, srring, n noule formtion) n funtionl (hepti sinusoil ellulr ltertions tht promote onstrition of the hepti sinusois) omponents [18]. Reserh hs shown tht tivtion of HSCs is key event meiting ugmente IHVR [7]. We esigne this stuy to investigte the role of metformin in tivte HSCs. We foun tht metformin oul ttenute the firogeni response of HSCs n erese IHVR. Our reserh inite tht metformin tretment my e potent therpeuti pproh to treting liver firosis n PHT. First, we use firoti mouse moel to etermine whether metformin h effets on liver firosis. Mie injete with CCl4 for 6 wk evelope mrke firosis ompre with the ontrol group, while o-tretment with metformin ttenute histopthologi fetures WJG Ferury 21, 218 Volume 24 Issue 7

13 Li Z et l. Effet of metformin on tivte HSCs A MET (mmol/l) B AICAR LY2942 PD9859 C.8 D.8 Contrtion rte Contrtion rte MET (mmol/l) AICAR LY2942 PD9859 Figure 4 Effet of metformin on hepti stellte ell ontrtion. Collgen gels were prepre in 24-well pltes. A: HSCs were seee on the ollgen gel with or without (1 ng/ml) n metformin (1, 5, n 1 mmol/l); B: Metformin ws hnge to AICAR (5 µmol/l), LY2942 (2 µmol/l), n PD9859 (1 µmol/l); C n D: After inution for 24 h, the res of the ollgen gel were mesure for nlysis. ( P < 1 vs the ontrol group, P < 5 n P < 1 vs the only group). HSCs: hepti stellte ells. of firosis. α-sma, mrker of HSC tivtion, ws inhiite y metformin t oth the protein n mrna levels. Sirius Re stining showe tht ollgen eposition ws lso erese, s well s the mrna level of ollgen type Ⅰ. Moreover, VEGF expression ws up-regulte in firoti mie, whih ws erese y metformin tretment. Therefore, metformin oul llevite the progression of liver firosis in firoti mie. A reent stuy lso showe tht metformin mitigte CCl4-inue liver firosis in mie. The nti-firogeni response ws reporte to primrily involve suppression of ECM eposition, n this effet might hve resulte from suppresse TGF-1/Sm3 signling [8] ; this ws supporte y previous in vitro stuy [9]. In our stuy, we foun tht metformin oul lso inhiit the ngiogenesis in liver firosis, initing tht metformin my ttenute liver firosis in other wys. The PDGF signling pthwy is mong the most well hrterize pthwys involve in HSC tivtion; PDGF- BB is the most potent stimultor of HSC growth n intrellulr signling [1], n loking of PDGF signling meliortes experimentl liver firogenesis [19]. As esrie ove, we speulte tht metformin oul regulte the firogeni response of HSCs n hve n nti-ngiogeni effet vi PDGF n its ownstrem pthwys. Therefore, we performe n in vitro stuy to further explin the effet of metformin on tivte HSCs n investigte the possile signling pthwys involve. We use to stimulte HSCs in vitro. up-regulte the expression of α-sma, s well s type Ⅰ ollgen n fironetin, in HSCs, while these protein levels were erese when trete with metformin. These results re in greement with our niml experiments. Cligiuri showe tht tivtion of AMPK moulte the tivte phenotype hnge WJG Ferury 21, 218 Volume 24 Issue 7

14 Li Z et l. Effet of metformin on tivte HSCs A HIF-1α VEGF Fol hnge.5 HF-1 VEGF MET (mmol/l) MET (mmol/l) B HF-1 VEGF HIF-1α VEGF Fol hnge.5 MET (mmol/l) CoCl2 MET (mmol/l) CoCl2 C D VEGF (pg/ml) MET (mmol/l) CoCl2 Tue length (fol).5 CoCl MET 5 mmol/l MET 1 mmol/l AICAR E CoCl MET 5 mmol/l MET 1 mmol/l AICAR Figure 5 Effet of metformin on VEGF expression n seretion of hepti stellte ells n ngiogenesis in vitro. A n B: HSCs were inute with or without (1 ng/ml) for 24 h or CoCl2 (15 µmol/l) for 12 h n metformin (1, 2, 5, n 1 mmol/l). The expression levels of HIF-1α n VEGF were mesure y Western lot nlysis, n the results were quntifie; C: Cells were trete s in pnel B, n the superntnt ws ollete. The protein level of VEGF ws mesure y ELISA ssy; D n E: HSCs were pretrete with metformin (5 n 1 mmol/l) or AICAR (5 µmol/l) for 2 h, n then inute with or without CoCl2 (15 µmol/l) for 12 h. The superntnt ws ollete n ilute 4:1 (v/v) in DMEM with 1% FBS to form onitione meium. HUVECs were hrveste n suspene in the onitione meium, n then seee on Mtrigel. Imges were quire t 8 h (1 mgnifition), n tue lengths were lulte with ImgeJ n quntifie. P < 5 n P < 1 vs the ontrol group, P < 5 n P < 1 vs the or CoCl2 only groups. HSCs: hepti stellte ells. of HSCs use y [15]. In this stuy, PDGF inue tivtion of the ownstrem moleules ERK n Akt/mTOR in tivte HSCs, whih re ssoite with ellulr prolifertion, migrtion, n phenotype hnges. Metformin inhiite the tivtion of ERK n Akt/mTOR y tivting AMPK. To further nlyze the role of the signling pthwys, we use vrious inite inhiitors to etermine whether the signling pthwys oul ffet tivte HSCs. LY2942 n rpmyin inhiite the expression of α-sma, WJG Ferury 21, 218 Volume 24 Issue 7

15 Li Z et l. Effet of metformin on tivte HSCs A P-AMPK B P-AMPK AMPK AMPK P-Akt P-Akt Akt Akt P-mTOR P-mTOR mtor mtor P-ERK P-ERK ERK MET (mmol/l) ERK MET (mmol/l) CoCl2 C p-ampk/ampk (fol) MET (mmol/l) D p-ampk/ampk (fol) MET (mmol/l) CoCl2 E Fol hnge 2..5 p-akt/akt p-mtor/mtor p-erk/erk F Fol hnge p-akt/akt p-mtor/mtor p-erk/erk MET (mmol/l) MET (mmol/l) CoCl2 Figure 6 Effet of metformin on AMPK, Akt/mTOR, n ERK signling in hepti stellte ells. A n B: HSCs were pretrete with metformin (1, 2, 5 n 1 mmol/l) for 2 h n then inute with (1 ng/ml) for 24 h or CoCl2 (15 µmol/l) for 12 h. AMPK, Akt/mTOR, n ERK signling pthwys were ssesse y Western lot nlysis; C n D: The results were quntifie. P < 5 vs the ontrol group, P < 5 n P < 1 vs the or CoCl2 only groups. HSCs: hepti stellte ells. ollgen Ⅰ, n fironetin. PD9859 h similr effet, exept for the expression of ollgen type Ⅰ. Furthermore, AICAR, nother AMPK tivtor, oul imitte the effet of metformin on tivte HSCs. Metformin inhiite tivtion n ECM seretion of HSCs. This effet ws meite y the tivtion of AMPK, therey inhiiting the tivtion of ERK n Akt/mTOR y. In liver irrhosis, n imlne etween vsoonstritors n vsoiltors mkes HSCs more ontrtile, whih inreses IHVR n ggrvtes PHT. Metformin hs een reporte to ttenute ontrtile responses in rt orts [2], n to reue pulmonry rtery ontrtion in pulmonry rteril hypertension [21]. Therefore, we use ollgen gel ontrtion ssy to evlute the effet of metformin on the ontrtion of HSCs. Our results showe tht metformin inhiite the ontrtion of HSCs use y. The RhoA/Rok pthwy is the ontrtile pthwy in vsulr smooth musle tht is lso expresse in HSCs [22]. Sorfeni n ownregulte Rho kinse y inhiiting the ERK pthwy in seonry iliry irrhoti rts n further reue portl WJG Ferury 21, 218 Volume 24 Issue 7

16 Li Z et l. Effet of metformin on tivte HSCs A FN COL1A2 α-sma AICAR LY2942 PD9859 Rpmyin B Fol hnge.5 FN COL1A2 α-sma AICAR LY2942 PD9859 Rpmyin C HIF-1α VEGF D HIF-1α VEGF AICAR LY2942 PD9859 Rpmyin AICAR LY2942 PD9859 Rpmyin CoCl2 E Fol hnge 2..5 HF-1 VEGF F Fol hnge.5 HF-1 VEGF AICAR LY2942 PD9859 Rpmyin CoCl AICAR LY2942 PD9859 Rpmyin Figure 7 The inhiitory effets of metformin on tivte hepti stellte ells were ssoite with tivtion of AMPK n susequent own-regultion of the Akt/mTOR n ERK signling pthwys. A n B: HSCs were pretrete with AICAR (5 µmol/l), LY2942 (2 µmol/l), PD9859 (1 µmol/l), or rpmyin (1 nmol/l) for 2 h n then inute with (1 ng/ml) for 24 h. Expression levels of fironetin (FN), ollgen type Ⅰ (COL1A2), n α-sma were mesure y Western lot nlysis n the results were quntifie; C n D: HSCs were pretrete with AICAR (5 µmol/l), LY2942 (2 µmol/l), PD9859 (1 µmol/l), or rpmyin (1 nmol/l) for 2 h n then inute with or without CoCl2 (15 µmol/l) for 12 h. Expression levels of HIF-1α n VEGF were mesure y Western lot nlysis; E n F: The results were quntifie. ( P < 5 n P < 1 vs the ontrol group, P < 5 n P < 1 vs the or CoCl2 only groups). HSCs: hepti stellte ells. pressure [23]. Metformin n erese the tivtion of ERK use y ; therefore, we speulte tht the inhiitory effet of metformin on the ontrtion of HSCs were ue in prt to the inhiition of the ERK pthwy. To onfirm this effet, we use PD9859 to tret HSCs stimulte with. PD9859 inhiite the ontrtion of HSCs, s expete. There hve lso een stuies tht linke the inhiition of the Akt pthwy to ttenution of ontrtion [24,25], n this effet my e ssoite with the Akt/L-type lium hnnel n the Akt/RhoA/Rho kinse pthwys [26,27]. In our reserh, LY2942 oul lso inhiit the ontrtion of HSCs, initing tht the Akt pthwy ws lso involve in moulting the ontrtion of HSCs. In ition, AICAR h similr effet to metformin on the ontrtion of HSCs. Thus, metformin inhiits the ontrtion of tivte HSCs, whih n erese IHVR n lower portl pressure. PDGF n promote HSCs to evelop n ngiogeni phenotype vi moulting HSC-se vsulr tue formtion n inresing overge of sinusois, with resulting effets on vsulr permeility, vessel muttion, n portl pressure regultion [6,28]. Ativte HSC reruitment to liver sinusoil epithelil ells is n importnt step in sinusoil remoeling, n PDGF my e the most importnt growth ftor in this proess [29]. In our stuy, metformin erese the motility of HSCs. Moreover, metformin erese the level of VEGF WJG 83 Ferury 21, 218 Volume 24 Issue 7

17 Li Z et l. Effet of metformin on tivte HSCs serete y HSCs, n inhiite ngiogenesis in vitro. Tken together, we showe tht metformin oul inhiit the ngiogeni properties of HSCs. VEGF plys preominnt role in the initil stges of ngiogenesis [3]. Reports hve shown tht PDGF n inrese the HIF-1α n VEGF protein levels in tivte HSCs [3]. PDGF n lso stimulte VEGF expression n HSC-riven vsulriztion through signls meite y ERK n mtor [31]. In our stuy, the AKT/mTOR n ERK pthwys were up-regulte y PDGF n use inrese levels of HIF-1α n VEGF in HSCs. The tivtion of AMPK y metformin erese the up-regultion of VEGF y PDGF. This result ws prtly in greement with the reserh y Zhng et l [32], who foun tht urumin interrupte the PDGF-βR/ERK n mtor pthwys, leing to reutions in VEGF expression in HSCs. As hypoxi is the most potent stimulus for VEGF expression, we further use CoCl2 to mimi hypoxi environment. Hypoxi stilize HIF- 1α n up-regulte the expression of VEGF in our stuy. The protein level of VEGF in the HSCs n the meium ws signifintly higher thn tht in the ontrol group, n the phosphoryltion of ERK n mtor ws lso inrese. Co-tretment with the AMPK tivtor metformin inhiite the inrese of HIF-1α, VEGF, n the tivtion of ERK n mtor. In ition, AICAR, LY2942, PD9859, n rpmyin oul lso inhiit the expression of HIF-1α n VEGF. These results inite tht metformin oul erese the VEGF levels serete y HSCs, n this effet ws prtly meite y the ERK/HIF-1α n mtor/hif-1α pthwys. Finlly, we use tue formtion ssys to nlyze ngiogenesis in vitro. When HUVECs were ulture with onitione meium from HSCs trete with metformin uner hypoxi onitions, tue formtion ws less thn tht in meium without metformin. AICAR h similr effet to metformin. Therefore, metformin oul inhiit PDGF n hypoxi-inue VEGF expression in HSCs, thus eresing HSC-se ngiogenesis. These effets were meite through the inhiition of the ERK/HIF-1α n mtor/hif-1α pthwys y tivtion of AMPK. In onlusion, metformin n inhiit the tivtion, prolifertion, motility, n ontrtion of HSCs, reue the seretion of ECM, ttenute HSC ngiogeni properties, n erese HSC-se ngiogenesis. Metformin hs effets on oth struturl n funtionl omponents of IHVR, suggesting novel therpeuti pproh for the tretment of liver firosis n PHT. ARTICLE HIGHLIGHTS Reserh kgroun Ativtion of hepti stellte ells (HSCs) ontriutes to liver firosis n portl hypertension, n it is therpeuti trget for the tretment of hroni liver iseses (CLDs). Previous stuies hve emonstrte tht metformin hs wie rnge of phrmologil tivities eyon its ntiieti effets. It my therefore represent potent therpeuti pproh to CLDs, ut the mehnisms unerlying its effets re still unler. Reserh motivtion This stuy ws performe to investigte the effet of metformin on tivte HSCs n lrify its moleulr mehnisms. Reserh ojetives The inhiitory effets of metformin on the tivtion, prolifertion, motility, ontrtion, extrellulr mtrix (ECM) seretion of HSCs n HSCse ngiogenesis were evlute. We lso hrterize its unerlying mehnisms with fous on AMPK n ownstrem AKT/mTOR n ERK signling pthwys. Reserh methos The effet of metformin on tivte HSCs were investigte in vivo n in vitro. A firoti mouse moel ws trete with or without metformin, n the effet of metformin on liver firosis ws evlute. The HSC ell line LX-2 ws use for in vitro stuies. The effet of metformin on ell prolifertion ws etete y CCK8 ssy. Cell motility ws mesure y srth tests n Trnswell ssys. Collgen gel ontrtion ssys were performe to ssess the effet of metformin on ell ontrtion. Expression of α-sma, ollgen type Ⅰ, n fironetin ws etermine y Western lot nlysis. We lso nlyze the effet of metformin on HSC-se ngiogenesis in oth PDGF n hypoxi onitions. The phosphoryltion levels of AMPK, AKT, mtor, n ERK were mesure y Western lot nlysis. We lso use the inite phrmologi inhiitors n gonists to onfirm our finings. Reserh results Metformin erese the tivtion of HSCs, reue the eposition of ECM, n inhiite ngiogenesis in firoti mie. promote the firogeni response of HSCs, while metformin inhiite the tivtion, prolifertion, migrtion, n ontrtion of HSCs, reue their seretion of ECM, n erese HSC-se ngiogenesis. These inhiitory effets were meite y inhiition of the Akt/mTOR n ERK pthwys vi the tivtion of AMPK. Reserh onlusions Metformin ttenutes the firogeni response of HSCs in vivo n in vitro, n my therefore e useful for the tretment of hroni liver iseses. Reserh perspetive This stuy investigte the inhiitory effet of metformin on tivte HSCs n the possile signling pthwys involve. The results strongly onfirme the potentil use of metformin for the tretment of CLDs. In future stuies, we will provie more eviene for the use of metformin, espeilly in the tretment of portl hypertension. The effet of metformin on liver sinusoil enothelil ells will lso e nlyze. ACKNOWLEDGMENTS We grtefully thnk Dr. Ewr C Mignot, Shnong University, for linguisti vie. REFERENCES 1 Lee UE, Friemn SL. Mehnisms of hepti firogenesis. Best Prt Res Clin Gstroenterol 211; 25: [PMID: DOI: 1.116/j.pg.212.5] 2 Elpek GÖ. Cellulr n moleulr mehnisms in the pthogenesis of liver firosis: An upte. Worl J Gstroenterol 214; 2: [PMID: DOI: /wjg.v2.i23.726] 3 Fernánez M, Semel D, Bruix J, Colle I, Pinzni M, Bosh J. Angiogenesis in liver isese. J Heptol 29; 5: [PMID: DOI: 1.116/j.jhep ] 4 Thut D, Shh V. Intrhepti ngiogenesis n sinusoil remoeling in hroni liver isese: new trgets for the tretment of portl hypertension? J Heptol 21; 53: [PMID: DOI: 1.116/j.jhep.217.4] WJG Ferury 21, 218 Volume 24 Issue 7

18 Li Z et l. Effet of metformin on tivte HSCs 5 Gri-Snho J, Meso-Díz R, Fernánez-Iglesis A, Nvrro- Zornoz M, Bosh J. New ellulr n moleulr trgets for the tretment of portl hypertension. Heptol Int 215; 9: [PMID: DOI: 1.17/s ] 6 Bo C, Novo E, Migliett A, Prol M. Angiogenesis n Firogenesis in Chroni Liver Diseses. Cell Mol Gstroenterol Heptol 215; 1: [PMID: DOI: 1.116/ j.jmgh ] 7 Fernnez M. Moleulr pthophysiology of portl hypertension. Heptology 215; 61: [PMID: DOI: 1.12/ hep.27343] 8 Fn K, Wu K, Lin L, Ge P, Di J, He X, Hu K, Zhng L. Metformin mitigtes ron tetrhlorie-inue TGF-β1/Sm3 signling n liver firosis in mie. Biome Phrmother 217; 9: [PMID: DOI: 1.116/j.ioph ] 9 Lim JY, Oh MA, Kim WH, Sohn HY, Prk SI. AMP-tivte protein kinse inhiits TGF-β-inue firogeni responses of hepti stellte ells y trgeting trnsriptionl otivtor p3. J Cell Physiol 212; 227: [PMID: DOI: 1.12/jp.22824] 1 Tripthi DM, Erie E, Lfoz E, Grí-Cleró H, Srin SK, Bosh J, Gri-Snho J, Grí-Pgán JC. Metformin reues hepti resistne n portl pressure in irrhoti rts. Am J Physiol Gstrointest Liver Physiol 215; 39: G31-G39 [PMID: DOI: /jpgi.1.215] 11 Chen HP, Shieh JJ, Chng CC, Chen TT, Lin JT, Wu MS, Lin JH, Wu CY. Metformin ereses heptoellulr rinom risk in ose-epenent mnner: popultion-se n in vitro stuies. Gut 213; 62: [PMID: DOI: / gutjnl ] 12 Pinzni M. PDGF n signl trnsution in hepti stellte ells. Front Biosi 22; 7: [PMID: ] 13 Berr E, Pgès G, Pouysségur J. MAP kinses n hypoxi in the ontrol of VEGF expression. Cner Metstsis Rev 2; 19: [PMID: ] 14 Krr J, Mity A. PI3K/AKT/mTOR Pthwy in Angiogenesis. Front Mol Neurosi 211; 4: 51 [PMID: DOI: / fnmol.2151] 15 Cligiuri A, Bertolni C, Guerr CT, Aleffi S, Glstri S, Trppoliere M, Vizzutti F, Gelmini S, Lffi G, Pinzni M, Mrr F. Aenosine monophosphte-tivte protein kinse moultes the tivte phenotype of hepti stellte ells. Heptology 28; 47: [PMID: DOI: 1.12/hep.21995] 16 Tkw M, Tke T, Li B, Tsuiji K, Yegshi N. The ntiieti rug metformin inhiits vsulr enothelil growth ftor expression vi the mmmlin trget of rpmyin omplex 1/ hypoxi-inuile ftor-1α signling pthwy in ELT-3 ells. Mol Cell Enorinol 215; 399: 1-8 [PMID: DOI: 1.116/ j.me ] 17 Al Qhtni A, Holly J, Perks C. Hypoxi negtes hyperglyemiinue hemo-resistne in rest ner ells: the role of insulin-like growth ftor ining protein 2. Onotrget 217; 8: [PMID: DOI: /onotrget.2287] 18 Gri-Tso G, Arles JG, Berzigotti A, Bosh J. Portl hypertensive leeing in irrhosis: Risk strtifition, ignosis, n mngement: 216 prtie guine y the Amerin Assoition for the stuy of liver iseses. Heptology 217; 65: [PMID: DOI: 1.12/hep.2896] 19 Borkhm-Kmphorst E, Weiskirhen R. The PDGF system n its ntgonists in liver firosis. Cytokine Growth Ftor Rev 216; 28: [PMID: DOI: 1.116/j.ytogfr ] 2 Pyl R, Osmn I, Pihvrm P, Hnsen P, Segr L. Metformin exggertes phenylephrine-inue AMPK phosphoryltion inepenent of CMKKβ n ttenutes ontrtile response in enothelium-enue rt ort. Biohem Phrmol 214; 92: [PMID: DOI: 1.116/j.p ] 21 Agr C, Rolli-Derkineren M, Dums-e-L-Roque E, Rio M, Sgn C, Svineu JP, Loirn G, Pu P. Protetive role of the ntiieti rug metformin ginst hroni experimentl pulmonry hypertension. Br J Phrmol 29; 158: [PMID: DOI: /j x] 22 Treik J, Hennenerg M, Llemn W, Shelest N, Bieker E, Shepke M, Nevens F, Suerruh T, Heller J. Atorvsttin lowers portl pressure in irrhoti rts y inhiition of RhoA/Rho-kinse n tivtion of enothelil nitri oxie synthse. Heptology 27; 46: [PMID: DOI: 1.12/hep.21673] 23 Hennenerg M, Treik J, Strk C, Kohistni AZ, Heller J, Suerruh T. Sorfeni trgets ysregulte Rho kinse expression n portl hypertension in rts with seonry iliry irrhosis. Br J Phrmol 29; 157: [PMID: DOI: /j x] 24 Liu H, Chen Z, Liu J, Liu L, Go Y, Dou D. Enotheliuminepenent hypoxi ontrtion of porine oronry rteries my e meite y tivtion of phosphoinositie 3-kinse/Akt pthwy. Vsul Phrmol 214; 61: [PMID: DOI: 1.116/j.vph ] 25 Liegl R, Wertheimer C, Kernt M, Dohev D, Kmpik A, Eil- Linner KH. Attenution of humn lens epithelil ell spreing, migrtion n ontrtion vi ownregultion of the PI3K/Akt pthwy. Grefes Arh Clin Exp Ophthlmol 214; 252: [PMID: DOI: 1.17/s z] 26 Crnevle D, Vehione C, Msio G, Esposito G, Cifelli G, Mrtinello K, Lnolfi A, Selvetell G, Grieo P, Dmto A, Frno E, Hse H, Mffei A, Cirolo E, Fuile S, Frti G, Mzzoni O, Hirsh E, Lemo G. PI3Kγ inhiition reues loo pressure y vsorelxnt Akt/L-type lium hnnel mehnism. Criovs Res 212; 93: 2-29 [PMID: DOI: 1.193/vr/vr288] 27 Mio L, Di Y, Zhng J. Mehnism of RhoA/Rho kinse tivtion in enothelin-1- inue ontrtion in rit silr rtery. Am J Physiol Hert Cir Physiol 22; 283: H983-H989 [PMID: DOI: /jphert ] 28 Coulon S, Heinrykx F, Geerts A, Vn Steenkiste C, Colle I, Vn Vliererghe H. Angiogenesis in hroni liver isese n its omplitions. Liver Int 211; 31: [PMID: DOI: /j x] 29 Lee JS, Semel D, Irele J, Shh VH. Sinusoil remoeling n ngiogenesis: new funtion for the liver-speifi periyte? Heptology 27; 45: [PMID: DOI: 1.12/ hep.21564] 3 Aleffi S, Nvri N, Delogu W, Glstri S, Novo E, Romouts K, Pinzni M, Prol M, Mrr F. Mmmlin trget of rpmyin meites the ngiogeni effets of leptin in humn hepti stellte ells. Am J Physiol Gstrointest Liver Physiol 211; 31: G21-G219 [PMID: DOI: /jpgi.47.21] 31 Zhng F, Kong D, Chen L, Zhng X, Lin N, Zhu X, Lu Y, Zheng S. Peroxisome prolifertor-tivte reeptor-γ interrupts ngiogeni signl trnsution y trnsrepression of plteleterive growth ftor-β reeptor in hepti stellte ells. J Cell Si 214; 127: [PMID: DOI: /js.12836] 32 Zhng F, Zhng Z, Chen L, Kong D, Zhng X, Lu C, Lu Y, Zheng S. Curumin ttenutes ngiogenesis in liver firosis n inhiits ngiogeni properties of hepti stellte ells. J Cell Mol Me 214; 18: [PMID: DOI: / jmm.12286] P- Reviewer: Shin T, Siiqui I S- Eitor: Gong ZM L- Eitor: Wng TQ E- Eitor: Li D WJG Ferury 21, 218 Volume 24 Issue 7

19 Pulishe y Bishieng Pulishing Group In 791 Stonerige Drive, Suite 51, Plesnton, CA 94588, USA Telephone: Fx: E-mil: pgoffie@wjgnet.om Help Desk: I S S N Bishieng Pulishing Group In. All rights reserve.