Increasing evidence shows that angiotensin II (Ang II) is a

Transcription

1 Angiotensin II Induces Connective Tissue Growth Factor and Collagen I Expression via Transforming Growth Factor Dependent and Independent Smad Pathways The Role of Smad3 Fuye Yang, Arthur C.K. Chung, Xiao Ru Huang, Hui Yao Lan Downloaded from by guest on April 27, 2018 Abstract Connective tissue growth factor (CTGF) plays a critical role in angiotensin II (Ang II) mediated hypertensive nephropathy. The present study investigated the mechanisms and specific roles of individual Smads in Ang II induced CTGF and collagen I expression in tubular epithelial cells with deletion of transforming growth factor (TGF)- 1, overexpression of Smad7, or knockdown of Smad2 or Smad3. We found that Ang II induced tubular CTGF and collagen I mrna and protein expressions were regulated positively by phosphorylated Smad2/3 but negatively by Smad7 because overexpression of Smad7-abolished Ang II induced Smad2/3 phosphorylation and upregulation of CTGF and collagen I in vitro and in a rat model of remnant kidney disease. Additional studies revealed that, in addition to a late (24-hour) TGF- dependent Smad2/3 activation, Ang II also induced a rapid activation of Smad2/3 at 15 minutes and expression of CTGF and collagen I in tubular epithelial cells lacking the TGF- gene, which was blocked by the addition of an Ang II type 1 receptor antagonist (losartan) and inhibitors to extracellular signal regulated kinase 1/2 (PD98059) and p38 (SB203580) but not by inhibitors to Ang II type 2 receptor (PD123319) or c-jun N-terminal kinase (SP600125), demonstrating a TGF- independent, Ang II type 1 receptor mediated extracellular signal regulated kinase/p38 mitogen-activated protein kinase cross-talk pathway in Ang II mediated CTGF and collagen I expression. Importantly, the ability of knockdown of Smad3, but not Smad2, to inhibit Ang II induced CTGF and collagen I expression further revealed an essential role for Smad3 in Ang II mediated renal fibrosis. In conclusion, Ang II induces tubular CTGF expression and renal fibrosis via the TGF- dependent and independent Smad3 signaling pathways, suggesting that targeting Smad3 may have therapeutic potential for hypertensive nephropathy. (Hypertension. 2009;54: ) Key Words: angiotensin II CTGF TGF- Smads MAP kinases renal fibrosis Increasing evidence shows that angiotensin II (Ang II) is a key mediator of chronic renal diseases, in particular, of hypertensive and diabetic nephropathy. 1 This is demonstrated by the findings that blockade of Ang II with Ang IIconverting enzyme inhibitor and/or Ang II type 1 (AT1) receptor antagonist slows the progression of renal diseases in both experimental and human kidney diseases. 2 It is now understood that Ang II mediates renal fibrosis by stimulating endogenous synthesis of transforming growth factor- (TGF- ) and connective tissue growth factor (CTGF). 3,4 However, the signaling mechanisms by which Ang II induces these fibrogenetic factors in the kidney remain largely unclear. CTGF, a member of the CCN family, is a downstream mediator of TGF- 1 and plays a critical role in renal fibrosis. This is supported by the findings that blockade of CTGF by an antisense strategy is able to attenuate renal fibrosis in obstructive nephropathy, 5 remnant kidney disease induced in TGF- 1 transgenic mice, 6 and tubular epithelialmyofibroblast transition in response to TGF- and advanced glycation end products. 7,8 Direct evidence for a role of CTGF in kidney disease comes from a recent study in the type 1 diabetic mouse model that cell-specific overexpression of CTGF in podocytes of CTGF transgenic mice is able to intensify proteinuria and mesangial expansion. 9 CTGF is also upregulated in the kidney and cardiovascular tissues after Ang II stimulation, which is blocked by the AT1 antagonist in vivo and in vitro, 10,11 demonstrating a causal role for Ang II in CTGF expression. It is generally accepted that Ang II induced CTGF expression is mediated via the TGF- 1 dependent pathway. 3,4 The Smad proteins, including Smad2, Smad3, and Smad7, are essential components of downstream TGF- signaling, which either positively (via activation of Smad2/3) or negatively (through the negative feedback mechanism of Smad7) regu- Received May 21, 2009; first decision June 6, 2009; revision accepted July 10, From the Department of Medicine (F.Y., H.Y.L.), University of Hong Kong, Hong Kong, China; Department of Medicine and Therapeutic and Li Ka Shing Institute of Health Sciences (A.C.K.C., X.R.H., H.Y.L.), Chinese University of Hong Kong, Shatin, NT, Hong Kong, China. Correspondence to Hui Yao Lan, Department of Medicine and Therapeutic, and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, NT, Hong Kong, China. hylan@cuhku.edu.hk 2009 American Heart Association, Inc. Hypertension is available at DOI: /HYPERTENSIONAHA

2 878 Hypertension October 2009 lates biological activities of TGF We and other investigators have shown recently that Ang II activates the Smad signaling pathway in vascular smooth muscle cells via both TGF- dependent and independent mechanisms. 13,14 These observations suggest that additional signaling mechanisms independent of TGF- may be required for Ang II induced CTGF expression. It is now clear that CTGF is a target gene of TGF- /Smad signaling 15,16 and that Ang II is able to activate TGF- /Smad signaling to mediate vascular fibrosis independent of TGF- through the AT1-extracellular signal regulated kinase (ERK)/p38 mitogen-activated protein kinase (MAPK) signaling mechanism 13,14 and also to mediate renal fibrosis in a TGF- independent process. 17 We, thus, hypothesized that, in addition to the TGF- dependent mechanism, Ang II may also stimulate CTGF expression to induce renal fibrosis in tubular epithelial cells (TECs) via the TGF- independent ERK/p38 MAPK-Smad signaling pathway. Materials and Methods Cell Culture Models A normal rat kidney tubular epithelial cell line (NRK52E) was stimulated with Ang II to detect the activation of the Smad2/3 and MAPK pathways, as well as expression of CTGF, TGF- 1, and Figure 1. Ang II induces CTGF and collagen I expressions and Smad2/3 phosphorylation in TGF- 1 WT and KO mouse TECs. Ang II (1 mol/l) induces CTGF and collagen I (A) mrna (6-hour) and (B) protein (24-hour) expressions in TGF- 1 WT and KO TECs. C, Ang II (1 mol/l) induces phosphorylation of Smad2/3 in TGF- 1 WT and KO TECs. Experiments were repeated 4 times, and data are expressed as the mean SEM. *P 0.05, **P 0.01, and ***P vs untreated control or as indicated. collagen I. The effects of endogenous TGF- 1 on Ang II induced Smad2/3 phosphorylation and CTGF and collagen I expressions were examined in NRK52E cells pretreated with or without an anti TGF- 1 neutralizing antibody or in TECs obtained from the kidneys of TGF- 1 wild-type (WT) and knockout (KO) mice (generously provided by Prof. J. B. Kopp, National Institutes of Health, Bethesda, MD). To evaluate the importance of the Smad signaling pathway in Ang II induced CTGF and collagen I expressions, a doxycycline-regulated Flagged M2-Smad7 expressing NRK52E cell line was used. 18 To delineate the differential roles of Smad2 and Smad3 in regulating Ang II induced CTGF and collagen I expressions, cell lines with stable knockdown of Smad2 or Smad3 were established by expressing either Smad2 or Smad3 smallinterfering RNA (sirna). The details of cell culture conditions and the sirna constructs were presented in the online Supplemental Data (please see Animal Model of Remnant Kidney Disease Treated With Smad7 Gene Transfer Male Sprague-Dawley rats at 6 weeks of age, weighing 220 to 250 g, were obtained from Harlan (Indianapolis, IN). A progressive renal disease model with hypertension was induced by 5/6 subtotal nephrectomy, and groups of 6 animals received gene therapy with doxycycline-inducible Smad7 or empty vectors mediated by an ultrasound-microbubble technique, as described previously. 19 All of the procedures were performed in accordance with institutional guidelines for animal care.

3 Yang et al Smad3 in Ang II-Induced CTGF and Col I Expression 879 Figure 2. Ang II activates Smad2/3 via both TGF- 1 dependent and independent pathways. A, ELISA analysis shows that Ang II (1 mol/l) significantly induces endogenous tubular TGF- 1 production at 24 hours. B, Western blot analysis detects that the addition of an anti TGF- 1 neutralizing antibody (10 g/ml), not a control antibody (10 g/ml), blocks Ang II induced Smad2/3 phosphorylation at 24 hours but not at 15 minutes. Experiments were repeated 4 times, and data are expressed as the mean SEM. *P 0.05 and ***P vs untreated NRK52E cells; #P 0.05 vs Ang II-treated NRK52E cells. Real-Time RT-PCR and Western Blot Analyses Real-time PCR and Western blotting were performed following the protocol as described previously. 14 The materials and methods were detailed in the online Data Supplement. Statistical Analysis Data are expressed as mean SEM. Statistical analysis was performed by 1-way ANOVA followed by a Tukey comparison program (a t test between groups) from GraphPad Prism 3.0 (GraphPad Software). P 0.05 indicates a statistically significant difference. Results Ang II Induces Tubular CTGF Expression via the TGF- Dependent and Independent Smad Signaling Pathways Consistent with the previous findings, 10 Ang II induced CTGF and collagen I mrna and protein expression by TECs (NRK52E) in a time- and dose-dependent manner (please see the online Data Supplement). We next investigated whether Figure 3. Ang II activates Smad2/3 via the AT1/ERK1/2/p38 signaling pathway. A, Ang II (1 mol/l) induces phosphorylation of ERK1/2, p38, and JNK MAPKs at 5 minutes, peaking at 15 minutes. B, Effect of the addition of antagonists to AT1 (losartan; 1 mol/l) and AT2 receptors (PD123319; 1 mol/l), inhibitors to ERK1/2 (PD98059; 20 mol/l), p38 (SB203580; 10 mol/l), and JNK (SP600125; 20 mol/l) on Ang II (1 mol/l) induced Smad2/3 phosphorylation at 15 minutes. Each bar represents the mean SEM for 4 independent experiments. *P 0.05, **P 0.01, and ***P vs untreated NRK52E cells; #P 0.05 vs Ang II-treated NRK52E cells. Ang II stimulates tubular CTGF expression via a TGF- 1 dependent or independent mechanism in TGF- 1 WTand KO mouse TECs. As shown in Figure 1, real-time PCR and Western blot analyses showed that Ang II induced CTGF mrna expression at 6 hours (Figure 1A) and protein expression at 24 hours (Figure 1B) in TGF- 1 WT TECs. Surprisingly, Ang II also caused equal levels of CTGF mrna and protein expression in TGF- 1 KO TECs (Figure 1A and 1B). This was associated with a rapid phosphorylation of Smad2/3 at 15 to 30 minutes in both TGF- 1 WT and KO TECs (Figure 1C). Interestingly, Ang II induced a second peak of Smad2/3 phosphorylation at 24 hours in TGF- 1WT but not in KO TECs (Figure 1C), suggesting that Ang II caused a rapid Smad2/3 activation (15 to 30 minutes) via the

4 880 Hypertension October 2009 Figure 4. Effects of blocking Ang II receptors and MAPKs on Ang II induced CTGF and collagen I mrna expressions in NRK52E cells. Real-time PCR analysis shows that Ang II (1 mol/l) induced tubular CTGF and collagen I mrna expressions at 6 hours are blocked by losartan (1 mol/l), PD58059 (20 mol/l), and SB (10 mol/l) but not by PD (1 mol/l) and SP (20 mol/l). Each bar represents the mean SEM for 6 independent experiments. *P 0.05, **P 0.01, and ***P vs untreated NRK52E cells; #P 0.05 and ##P 0.01 vs Ang II-treated NRK52E cells. TGF- independent pathway, whereas Ang II activated Smad2/3 at 24 hours through the TGF- dependent mechanism. This was confirmed by the finding that Ang II was able to induce endogenous TGF- 1 expression at 24 hours as measured by ELISA (Figure 2A), and the use of a neutralizing TGF- antibody was able to block Ang II induced Smad2/3 phosphorylation at 24 hours but not at 15 minutes (Figure 2B). Ang II Induces CTGF Expression via the AT1-ERK/p38-Smad Cross-Talk Pathway We next explored the signaling mechanism by which Ang II induces the early, TGF-independent Smad signaling pathway by testing the hypothesis that Ang II may act by stimulating the MAPK to cause Smad2/3 phosphorylation and CTGF expression. As shown in Figure 3A, Ang II was able to activate 3 members of MAPKs, including ERK1/2, p38, and c-jun N-terminal kinase (JNK), being significant at 5 minutes and peaking at 15 minutes. This preceded or paralleled the early phosphorylation of Smad2/3 at 15 minutes, as shown in Figure 1C. To investigate the relationship between the phosphorylation of ERK/p38/JNK MAPKs and activation of Figure 5. Effects of blocking Ang II receptors and MAPKs on Ang II induced CTGF and collagen I protein expressions in NRK52E cells. Western blot analysis shows that Ang II (1 mol/ L) induced tubular CTGF and collagen I expressions at 24 hours are blocked by losartan (1 mol/l), PD58059 (20 mol/l), and SB (10 mol/l) but not by PD (1 mol/l) and SP (20 mol/l). Each bar represents the mean SEM for 6 independent experiments. *P 0.05 and **P 0.01 vs untreated NRK52E cells; #P 0.05, ##P 0.01, and ###P vs Ang II treated NRK52E cells. Smad2/3, we examined whether Ang II binds AT1 or Ang II type 2 (AT2) receptors to activate the early, TGF- 1 independent Smad signaling directly via the MAPK-Smad cross-talk pathway. As shown in Figure 3B, Western blot analysis showed that Ang II signaled through AT1, not AT2, to induce a rapid phosphorylation of Smad 2/3 at 15 minutes because this was blocked by the AT1 receptor antagonist (losartan; 1 mol/l), not by the AT2 inhibitor PD (1 mol/l). We also found that blockade of ERK1/2 and p38 but not JNK was able to inhibit Ang II induced Smad2/3 phosphorylation. The functional role of the AT1-ERK/p38-Smad cross-talk pathway in Ang II induced CTGF and collagen I expression in TECs is shown in Figures 4 and 5. Real-time PCR and Western blot analyses revealed that Ang II induced tubular CTGF and collagen I mrna (at 6 hours) and protein (24 hours) expressions were blocked by an AT1 receptor antagonist, pharmacological inhibitors to MAPK/ERK kinase (MEK) 1, the

5 Yang et al Smad3 in Ang II-Induced CTGF and Col I Expression 881 Figure 6. Overexpression of Smad7 inhibits Ang II induced Smad2/3 phosphorylation and CTGF and collagen I mrna and protein expressions. A, Western blot analysis demonstrates that the addition of doxycycline (Dox; 2 g/ml) for 24 hours induces Flagged M2-Smad7 expression, which inhibits Ang II (1 mol/l) induced Smad2/3 phosphorylation. B, Real-time PCR and (C) Western blot show that Dox-induced overexpression of Smad7 abolishes Ang II (1 mol/l) induced CTGF and collagen I mrna (6-hour) and protein (24-hour) expressions. Each bar represents the mean SEM for 6 independent experiments. *P 0.05 vs untreated NRK52E cells; ##P 0.01 and ###P vs Ang II treated NRK52E cells. D, Overexpression of Smad7 inhibits CTGF expression in a rat model of remnant kidney disease, as shown by real-time PCR and immunohistochemistry. Each bar represents the mean SEM for 6 rats in each group. ***P vs normal rats; #P 0.05 and ##P 0.01 vs the remnant kidney disease rats. upstream ERK1/2 kinase, and p38 but not by the AT2 receptor blocker and JNK inhibitor, demonstrating a critical role for the AT1-ERK/p38 MAPK-Smad cross-talk pathway in Ang II induced tubular CTGF and collagen matrix expression. Smad7 Negatively Regulates Ang II Induced Smad2/3 Activation and CTGF and Collagen Matrix Expressions In Vitro and In Vivo We next tested a critical role of the Smad signaling pathway and the specific role for Smad7 in Ang II induced tubular CTGF and collagen I expression in vitro in a stable, doxycycline-regulated Flagged M2-Smad7 expressing NRK52E TEC line. As shown in Figure 6A, an addition of doxycycline (2 g/ml) induced Flagged M2-Smad7 transgene expression as identified with the anti Flag-M2 antibody. Overexpression of Smad7 completely inhibited both the early (5- to 30-minute) and late (24-hour) phosphorylation of Smad2/3 and the abrogation of CTGF and collagen I mrna and protein expressions induced by Ang II (Figure 6B and 6C).

6 882 Hypertension October 2009 The critical role of Smad signaling and the negative regulating role of Smad7 in CTGF and collagen matrix expressions were further examined in a rat model of remnant kidney disease in which Smad7 was overexpressed by ultrasound-microbubble mediated gene transfer of the inducible Smad7, as described previously. 19 We have shown previously that overexpression of Smad7 is capable of inhibiting the activation of Smad2/3 and collagen matrix expression in the disease model. 19 In the present study, we also found that inhibition of renal fibrosis in this disease model was associated with blockade of CTGF expression in both mrna and protein levels (Figure 6D). Smad3, Not Smad2, Is the Key Mediator of TGF- /Smad Signaling for Ang II Induced Tubular CTGF and Collagen I Expression To further dissect the differential roles of Smad2 and Smad3 in Ang II induced CTGF and collagen I expressions, we established Smad2 or Smad3 knockdown cell lines in NRK52E cells by stably expressing Smad2 or Smad3 sirna. Figure 7. Smad3, but not Smad2, is essential for Ang II induced CTGF and collagen I expressions. NRK52E cells stably transfected with p-super constructs containing cdna sequences corresponding with control-sirna, Smad2-siRNA or Smad3-siRNA were treated with or without Ang II (1 mol/l). A, Real-time PCR and (B) Western blot show that overexpression of Smad2 or Smad3 sirna significantly and selectively inhibits Smad2 or Smad 3 expression at mrna and protein levels individually. C, Real-time PCR and (D) Western blot demonstrate that knockdown of Smad3, but not Smad2, inhibits Ang II induced CTGF and collagen I mrna (6-hour) and protein (24- hour) expressions, respectively. Experiments were repeated 4 times, and data are expressed as the mean SEM. *P 0.05 and **P 0.01 vs within the group, as indicated. As shown in Figure 7A and 7B, real-time PCR and Western blot showed that TECs stably expressing Smad2 sirna or Smad3 sirna resulted in a selective inhibition of Smad2 or Smad3 expression at mrna and protein levels. Interestingly, Ang II-induced CTGF and collagen I mrna upregulations were prevented in Smad3, not Smad2, knockdown TECs (Figure 7C). Similarly, Western blot analysis also showed that knockdown of Smad3, not Smad2, abolished Ang II induced tubular CTGF and collagen I protein expressions at 24 hours (Figure 7D). Discussion It is now well accepted that Ang II is a key mediator in hypertensive and diabetic nephropathy. 1 4 Generally, CTGF is considered a downstream mediator of TGF- 1. 3,4 It is well accepted that TGF- 1 signals through a heteromeric receptor complex of the type I and type II receptors to activate the downstream intracellular mediators Smad2 and Smad3 to exert its biological effects. 12 Because CTGF is one of the responsive genes of TGF- /Smad signaling, 15,16 activation of

7 Yang et al Smad3 in Ang II-Induced CTGF and Col I Expression 883 TGF- /Smad signaling results in upregulation of CTGF. Because Ang II is able to induce TGF- 1 expression, 3,4 therefore, it is generally believed that Ang II induces CTGF expression via TGF- dependent Smad signaling. 3,4 A significant finding in the present study was that Ang II could directly induce CTGF, as well as collagen I, expression through a TGF- independent Smad signaling pathway via the AT1-ERK/p38 MAPK cross-talk pathway. This was supported by the findings that Ang II was able to activate the early (15-minute), but not the late (24-hour), Smad2/3 phosphorylation in TECs lacking the TGF- 1 gene and that blockade of the AT1 receptor, ERK1/2, and p38, but not the AT2 receptor and JNK MAPK was capable of inhibiting Ang II induced activation of Smad2/3 and CTGF, as well as collagen I expression. This notion is further supported by evidence of direct interactions between ERK/p38 MAPKs and Smads Thus, additional phosphorylation of Smads by ERK/p38 signals is necessary for full activity of Smad signaling in response to Ang II. The ability of overexpression of Smad7 to inhibit Smad2/3 phosphorylation and tubular CTGF and collagen I expressions in response to Ang II in vitro and in a rat remnant kidney disease further demonstrated a critical role of Smad signaling in Ang II mediated renal fibrosis. This was consistent with the previous report in vascular smooth muscle cells and TECs in which expression of Smad7 inhibits Ang II or TGF- induced CTGF expression in vitro and in vivo. 13,18,19 Thus, it appears that a Smad-dependent Ang II signaling pathway is required for CTGF and collagen matrix expressions, whereas Smad7 may play a negative regulating role in Ang II induced tubular CTGF expression and renal fibrosis. Another important finding in this study was that Smad3, but not Smad2, was essential for Ang II-induced CTGF and collagen I expressions in tubular epithelial cells. Although Smad2 and Smad3 share 90% homology in their amino acid sequences and both are downstream mediators for TGF- 1 signaling, Smad2 and Smad3 have differential roles because of 2 major differences in their structures. It is shown that the additional 30 amino acids in the MH1 domain of Smad2 prevent Smad2 from direct binding to DNA, whereas the transactivation domain in the linker region of Smad3 allows Smad3 to directly bind to DNA and regulate the target genes. 23,24 Because the TGF- regulatory element and Smad binding element are found in the CTGF promoters, 15,16,25 many fibrogenic genes, including most collagen genes, have been shown to be Smad3 dependent. 26,27 Thus, Smad3 may directly mediate the transcription of CTGF and collagen genes. A critical role for Smad3 in TGF- 1 induced CTGF expression has been reported by the findings that TGF- 1 induced CTGF mrna expression is significantly reduced in the fibroblast derived from Smad3 KO mice. 16,28 The present study added new evidence that Smad3, not Smad2, played an essential role in Ang II induced tubular CTGF and collagen I expressions. Perspectives Results obtained from this study demonstrate that, after binding to the AT1 receptor, Ang II mediates CTGF and collagen matrix expression via a rapid activation of Smad2/3 through the ERK1/2 and p38 MAPK cross-talk pathway within 30 minutes, in addition to the TGF- dependent Smad signaling pathway at 24 hours. Overexpression of Smad7 is capable of blocking Ang II induced activation of Smad2/3, thereby inhibiting CTGF and collagen matrix expressions. The ability of blocking Smad3, but not Smad2, to inhibit Ang II mediated CTGF and fibrosis responses indicates that targeting Smad3 by overexpressing Smad7 or by specific sirna to Smad3 may be a novel therapeutic strategy for hypertensive complications. Sources of Funding This work has been supported by grants from the Research Grant Council of Hong Kong (RGC GRF and ) and Baxter Renal Discovery Programs. None. Disclosures References 1. Mezzano SA, Ruiz-Ortega M, Egido J. Angiotensin II and renal fibrosis. Hypertension. 2001;38: Wolf G, Ritz E. Combination therapy with ACE inhibitors and angiotensin II receptor blockers to halt progression of chronic renal disease: pathophysiology and indications. Kidney Int. 2005;67: Border WA, Noble NA. Interactions of transforming growth factor-beta and angiotensin II in renal fibrosis. Hypertension. 1998;31: Wolf G. Renal injury due to renin-angiotensin-aldosterone system activation of the transforming growth factor-beta pathway. Kidney Int. 2006; 70: Yokoi H, Mukoyama M, Nagae T, Mori K, Suganami T, Sawai K, Yoshioka T, Koshikawa M, Nishida T, Takigawa M, Sugawara A, Nakao K. Reduction in connective tissue growth factor by antisense treatment ameliorates renal tubulointerstitial fibrosis. J Am Soc Nephrol. 2004;15: Okada H, Kikuta T, Kobayashi T, Inoue T, Kanno Y, Takigawa M, Sugaya T, Kopp JB, Suzuki H. Connective tissue growth factor expressed in tubular epithelium plays a pivotal role in renal fibrogenesis. JAmSoc Nephrol. 2005;16: Zhang C, Meng X, Zhu Z, Yang X, Deng A. Role of connective tissue growth factor in renal tubular epithelial-myofibroblast transdifferentiation and extracellular matrix accumulation in vitro. Life Sci. 2004;75: Burns WC, Twigg SM, Forbes JM, Pete J, Tikellis C, Thallas-Bonke V, Thomas MC, Cooper ME, Kantharidis P. Connective tissue growth factor plays an important role in advanced glycation end product-induced tubular epithelial-to-mesenchymal transition: implications for diabetic renal disease. J Am Soc Nephrol. 2006;17: Yokoi H, Mukoyama M, Mori K, Kasahara M, Suganami T, Sawai K, Yoshioka T, Saito Y, Ogawa Y, Kuwabara T, Sugawara A, Nakao K. Overexpression of connective tissue growth factor in podocytes worsens diabetic nephropathy in mice. Kidney Int. 2008;73: Ruperez M, Lorenzo O, Blanco-Colio LM, Esteban V, Egido J, Ruiz- Ortega M. Connective tissue growth factor is a mediator of angiotensin II-induced fibrosis. Circulation. 2003;108: Andersen S, van Nieuwenhoven FA, Tarnow L, Rossing P, Rossing K, Wieten L, Goldschmeding R, Parving HH. Reduction of urinary connective tissue growth factor by Losartan in type 1 patients with diabetic nephropathy. Kidney Int. 2005;67: Kretzschmar M, Massague J. Smads: mediators and regulators of TGF- signaling. Curr Opin Genet Dev. 1998;8: Rodriguez-Vita J, Sabchez-Lopez E, Esteban V, Ruperez M, Egido J, Ruiz-Ortega M. Angiotensin II activates the smad pathway in vascular smooth muscle cells by a transforming growth factor-beta-independent mechanism. Circulation. 2005;111: Wang W, Huang XR, Canlas E, Oka K, Truong LD, Deng C, Bhowmick NA, Ju W, Bottinger EP, Lan HY. Essential role of Smad3 in angiotensin II-induced vascular fibrosis. Circ Res. 2006;98: Leivonen SK, Hakkinen L, Liu D, Kahari VM. Smad3 and extracellular signal-regulated kinase 1/2 coordinately mediate transforming growth factor-beta-induced expression of connective tissue growth factor in human fibroblasts. J Invest Dermatol. 2005;124:

8 884 Hypertension October Holmes A, Abraham DJ, Sa S, Shiwen X, Black CM, Leask A. CTGF and SMADs, maintenance of scleroderma phenotype is independent of SMAD signaling. J Biol Chem. 2001;276: Carvajal G, Rodriguez-Vita J, Rodrigues-Diez R, Sanchez-Lopez E, Ruperez M, Cartier C, Esteban V, Ortiz A, Egido J, Mezzano SA, Ruiz-Ortega M. Angiotensin II activates the Smad pathway during epithelial mesenchymal transdifferentiation. Kidney Int. 2008;74: Li JH, Zhu HJ, Huang XR, Lai KN, Johnson RJ, Lan HY. Smad7 inhibits fibrotic effect of TGF-Beta on renal tubular epithelial cells by blocking Smad2 activation. J Am Soc Nephrol. 2002;13: Hou CC, Wang W, Huang XR, Fu P, Chen TH, Sheikh-Hamad D, Lan HY. Ultrasound-microbubble-mediated gene transfer of inducible Smad7 blocks transforming growth factor-beta signaling and fibrosis in rat remnant kidney. Am J Pathol. 2005;166: Funaba M, Zimmerman CM, Mathews LS. Modulalation of Smad2- mediated signaling by extracellular signal-regulated kinase. J Biol Chem. 2002;277: Furukawa F, Matsuzaki K, Mori S, Tahashi Y, Yoshida K, Sugano Y, Yamagata H, Matsushita M, Seki T, Inagaki Y, Nishizawa M, Fujisawa J, Inoue K. p38 MAPK mediates fibrogenic signal through Smad3 phosphorylation in rat myofibroblasts. Hepatology. 2003;38: Phanish MK, Wahab NA, Hendry BM, Dockrell ME. TGF-beta1-induced connective tissue growth factor (CCN2) expression in human renal proximal tubule epithelial cells requires Ras/MEK/ERK and Smad signaling. Nephron Exp Nephrol. 2005;100:e156 e Dennler S, Huet S, Gauthier JM. A short amino-acid sequence in MH1 domain is responsible for functional differences between Smad2 and Smad3. Oncogene. 1999;18: Shi Y, Wang YF, Jayaraman L, Yang H, Massague J, Pavletich NP. Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-beta signaling. Cell. 1998;94: Grotendorst GR, Okochi H, Hayashi N. A novel transforming growth factor beta response element controls the expression of the connective tissue growth factor gene. Cell Growth Differ. 1996;7: Lakos G, Takagawa S, Chen SJ, Ferreira AM, Han G, Masuda K, Wang XJ, DiPietro LA, Varga J. Targeted disruption of TGF-beta/Smad3 signaling modulates skin fibrosis in a mouse model of scleroderma. Am J Pathol. 2004;165: Phanish MK, Wahab NA, Colville-Nash P, Hendry BM, Dockrell ME. The differential role of Smad2 and Smad3 in the regulation of pro-fibrotic TGFbeta1 responses in human proximal-tubule epithelial cells. Biochem J. 2006;393: Verrecchia F, Chu ML, Mauviel A. Identification of novel TGFbeta/Smad gene targets in dermal fibroblasts using a combined cdna microarray/promoter transactivation approach. J Biol Chem. 2001;276:

9 Angiotensin II Induces Connective Tissue Growth Factor and Collagen I Expression via Transforming Growth Factor β Dependent and Independent Smad Pathways: The Role of Smad3 Fuye Yang, Arthur C.K. Chung, Xiao Ru Huang and Hui Yao Lan Hypertension. 2009;54: ; originally published online August 10, 2009; doi: /HYPERTENSIONAHA Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX Copyright 2009 American Heart Association, Inc. All rights reserved. Print ISSN: X. Online ISSN: The online version of this article, along with updated information and services, is located on the World Wide Web at: Data Supplement (unedited) at: Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: Subscriptions: Information about subscribing to Hypertension is online at:

10 ONLINE SUPPLEMENT Angiotensin II Induces CTGF and Collagen I Expression via TGF-β-dependent and independent Smad Pathways: Role of Smad3 Fuye Yang 1, Arthur CK Chung 2, Xiao Ru Huang 2, Hui Yao Lan 1,2 1 Department of Medicine, The University of Hong Kong, and Department of Medicine & Therapeutic, Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong, Shatin, NT, Hong Kong SAR, China The running title: Smad3 in Ang II-induced CTGF and Col I expression Correspondence: Professor Hui Y Lan Department of Medicine & Therapeutic The Chinese University of Hong Kong Rm 601, LiHS, Shatin, NT Hong Kong Phone: Fax : hylan@cuhku.edu.hk 1

11 Materials and Methods Cell Culture Models A normal rat kidney tubular epithelial cell line (NRK52E) was purchased from the American Type Culture Collection (ATCC, Manassas, VA) and maintained in Dulbecco s modified Eagle s medium -low glucose medium (Hyclone Laboratories, Logan, UT) supplemented with 5% fetal bovine serum (Hyclone Laboratories, Logan, UT). Cells were cultured in six-well plates and synchronized in serum-free medium for 16 hours, followed by treatment with Ang II at concentrations of 0.01, 0.1, 0.5, 1, and 2 µm for periods of 5, 15, 30, and 60 minutes and 2, 3, 6, 12, and 24 hours for detection of phosphorylated Smad2/3, ERK1/2, p38, JNK, and expression of CTGF, TGF-β1, and collagen I. To study the signaling mechanism involving the MAPK pathway, NRK52E TECs were pretreated with specific antagonists to AT1 receptor (losartan, 1 µm) and AT2 receptor (PD123319, 1 μm), specific inhibitors to MEK1 (the upstream ERK1/2 kinase) (PD98059, 20 μm ), p38 (SB203580, 10 μm ) and JNK (SP600125, 20 μm) 1 hour before Ang II stimulation. All inhibitors were purchased from Calbiochem (La Jolla, CA). The secretion of TGF-β1 by NRK52E cells was measured using the TGF-β1 ELISA kit. (R&D System, Minneapolis, MN). To examine the effects of endogenous TGF-β1 on phosphorylation of Smad2/3 induced by Ang II, NRK52E cells were pre-treated with or without an anti-tgf-β1 neutralizing antibody at 10μg/ml (R&D System) 1 hour before stimulation with Ang II (1µM). TGF-β1 (2ng/μl, R&D System) was used as a positive control. An isotype normal rabbit IgG at 10µg/ml (R&D System) was served as the negative control. To further determine the endogenous TGF-β1 in the late phosphorylation of Smad2/3, as well as in Ang II-induced CTGF and collagen I expression, TECs obtained from the kidneys of TGF-β1 wild-type (WT) and knockout (KO) mice (generously provided by Prof. JB Kopp, NIH, Bethesda, MD) were employed and stimulated with Ang II for periods of 5, 15, 30, and 60 minutes and 2, 3, 6, 12, and 24 hours. To evaluate the importance of the Smad signaling pathway in Ang II-induced CTGF and collagen I expression, a Dox-regulated Flagged M2-Smad7 expressing NRK52E cell line was used [18]. Cells were pre-treated with Dox at the optimal dose (2μg/ml) for 24 hours followed by Ang II stimulation as described above. To delineate the differential role of Smad2 and Smad3 in regulating Ang II-induced CTGF and collagen I expression, stable cell lines with specific Smad2 or Smad3 gene knockdown were established by expressing either Smad2 or Smad3 sirna. Briefly, the gene-specific insert sequences for Smad2 (sense: 5 -ATTCTTACCCTTGGTAAGA-3 ; anti-sense: 5 - TCTTACCAAGGGTAAGAAT-3 ) and Smad3 (sense: 5 -GCACCCTCCAATGTGATAA-3 ; antisense: 5 - TTATCACATTGGAGGGTGC-3 ) were separated by a nine-nucleotide noncomplementary spacer (TCTCTTGAA) from the reverse complement of the sequences and synthesized and then subsequently subcloned into the BglII and HindIII sites of the psuper-gfp/neo (OligoEngine, Seattle, WA) vector to generate psuper-epac RNA interference constructs. The vector allows direct synthesis of small hairpin RNA (shrna) transcripts using the polymerase H1-RNA gene promoter and co-expresses green fluorescent protein (GFP) to allow detection of transfected cells. A sirna with no predicted target site in the rat genome was inserted into psuper-gfp/neo and served as a negative control. The p-super constructs were then introduced into NRK52E TEC by using Lipofactamine 2000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer s instructions and then subjected to G418 selection (500μg/ml). The expression of Smad2 and Smad3 2

12 was monitored by real-time RT-PCR and Western blot analysis and stable cell lines with more than 90% deletion of either Smad2 or Smad3 were used for the study. At least four independent experiments were performed throughout of the study. Western Blot Analysis Western blotting was analysed following the protocol as previously described [14]. After blocking with 5% non-fat milk, the membranes were incubated overnight at 4 o C with primary antibodies against phospho-smad2/3, ERK1/2 (Cell Signaling Technology Inc. Danvers, MA), Smad3 (Millipor Inc., Billerica, MA), CTGF, phospho-erk1/2, phospho--p38, p38, phospho--jnk, JNK (Santa Cruz Biotechnology, Santa Cruz, CA), Flag-M2 (Sigma-Aldrich Corp. St Louis, MO), collagen I (SouthernBiotech Company, Birmingham, Alabama), and GAPDH (Chemicon Inc., Temecula, CA). After washing, the membranes were incubated with IRDyeTM800 conjugated secondary antibodies (Rockland Immunochemical Inc., Gilbertsville, PA) in dark for 1 hour at room temperature, and signals were scanned and visualized by Odyssey Infrared Imaging System (LiCor Inc., Lincoln, NE). The ratio of the protein interested was subjected to GAPDH and was densitometrically analyzed by Image J software (NIH, Bethsda, MD. Real-Time RT-PCR Total RNA was isolated using the RNeasy mini-prep kit according to the manufacturer s instructions (Qiagen, Valencia, CA). The cdna was synthesized and real-time polymerase chain reaction (PCR) was performed using Bio-Rad iq SYBR Green supermix with the Opticon2 real-time PCR machine (Bio-Rad, Herculus, CA, USA) as described previously [14]. The specificity of real-time PCR was confirmed via routine agarose gel electrophoresis and melting curve analysis. Housekeeping gene GAPDH was served as an internal control. The primers used in this study are: CTGF (rat): forward 5 - GAGGAAAACATTAAGAAGGGCAAA-3, reverse 5 - CGGCACAGGTCTTGATGA-3 ; CTGF (mouse): forward 5 - CTTCTGCGATTTCGGCTCC-3, reverse 5 - TACACCGACCCACCGAAGA-3 ; TGF-β1 (rat): forward 5 - GAGGTGACCTGGGCACCAT-3, reverse 5 - GGCCATGAGGAGCAGGAATCCTGCTGG -3 ; collagen I (rat): forward 5 -GAGGGCGAGTGCTGTCCTT-3, reverse 5 - GGTCCCTCGACTCCTATGACTTC-3 ; Smad2 (rat): forward 5 - TGCCGCCTCTGGATGACT A-3, reverse 5 - GAAATTTGTGTT-3 ; Smad3 (rat): forward 5 - GCCTGCTGTCCAATGTTAACC-3, reverse 5 - CGCACACCCCTCCCAAT-3 ; GAPDH (rat): forward 5 - GACATGCCGCCTGGAGAAAC-3, reverse 5- AGCCCAGGATGCCCTTTAGT-3 ; GAPDH (mouse): forward 5 - TGCAGTGGCAAAGTGGAGATT -3, reverse 5 - TTGAATTTGCCGTGAGTGGA-3. Results Ang II induces CTGF and collagen matrix expression in cultured rat tubular epithelial cells We examined CTGF and collagen I mrna and protein expression by TECs in response to Ang II. As shown in supplement Figures (S1 and S2), real-time PCR and Western blot analysis demonstrated that Ang II induced CTGF and collagen I mrna (6 hours) and protein (24 hours) expression by TECs (NRK52E) in a time-dependent and dose-dependent manner. 3

13 Supplement Figures and Figure legends S1. Real-time PCR reveals that Ang II induces CTGF and collagen I mrna expression in NRK52E cells in a time and dose-dependent manner. (A) Ang II (1µM) induces CTGF and collagen I mrna expression in a time-dependent manner. (B) Ang II (1µM) induces CTGF and collagen I mrna expression in a dose-dependent manner (6 hours). Each bar represents the means ± SEM for 6 independent experiments. *p< 0.05, ***p<0.001 as compared with untreated cells (0). 4

14 S2. Western blot analysis shows that Ang II induces CTGF and collagen I protein expression in NRK52E cells in a time and dose-dependent manner. (A) Ang II (1µM) induces CTGF and collagen I protein expression in a time-dependent manner. (B) Ang II induces CTGF and collagen I protein expression in a dose-dependent manner (24 hours). Each bar represents the means ± SEM for 6 independent experiments. *p< 0.05, **p< 0.01, ***p<0.001 as compared with untreated cells (0). 5