Studying apoptosis in DT40 cells
|
|
|
- Allan Johnson
- 6 years ago
- Views:
Transcription
1 Studying apoptosis in DT40 cells Sandrine Ruchaud E12.5! Acridine Orange! Role of apoptosis in sculpting the mouse paw E13.5! E14.5! gift of William Wood & Paul Martin! University College, London!
2 Normal nucleus Apoptotic nucleus Which proteins are involved in apoptotic execution?
3 Key players responsible for nuclear apoptotic execution Initiator Caspases (-8, -10, etc.) PARP P ARP Effector execution phase Caspases (-3, -7-6) CAD/ICAD Caspase-6 I CAD CAD Lamins (Lamin A/C) Active CAD
4 Caspase-6 gene targeting GgPro-caspase 6! Prodomain! N! Large subunit! Small subunit! C! 5ʼ! KpnI! XbaI! XbaI! ApaI! E1! E2! E3! E4! E5! E6! E7! E8! Knockout construct! Start! BamHI! resistance! Stop! 3 kb! cassette! 2.1 kb! BamHI! 3ʼ! Wild type allele! BamHI! 7.7 kb! ApaI! BamHI! Probe! Targeted allele (puro)! BamHI! puromycin! 5.3 kb! ApaI! BamHI! Targeted allele (hisd)! hisd! BamHI! ApaI! BamHI! 2.7 kb!
5 Southern blot Northern and western blot wt Casp6 (+/-) puro Casp6 (-/-) puro/hisd wt (+/-) (-/-) Casp-6 mrna Casp-3 mrna Casp-7 mrna 7.7 kb wt allele β-actin mrna 5.3 kb puro allele 2.7 kb hisd allele wt (+/-) (-/-) Pro Casp-6 α-tubulin what is the specific role of caspase-6 during apoptotic execution?
6 Apoptosis in caspase 6 -/- cells proceeds normally wt (-/-) No lamin A/C expression in DT40 cells - Lamin A is the only known substrate cleaved only by caspase 6. - Lymphoid tissues have been shown not to express lamin A Et (h) wt (-/-) M (kb) Lamin A Lamin C Chicken muscle DT40 HeLa Jurkat anti chicken lamin A Used an apoptotic cell free system on isolated Hela nuclei
7 Sequential events happening during in vitro induced apoptosis of isolated Hela nuclei DAPI stained HeLa nuclei
8 Caspase-6 deficient apoptotic extracts block apoptotic chromatin condensation %! 100! 75! 50! Control! Apoptotic! stages! I! II! 25! 0! Genotype! VEID! Control extracts! wt! (-/-)! -! -! Apoptotic extracts! wt! (+/-)! (-/-)! (-/-)! wt! -! -! -! +! +! III! IV! DAPI! Lamin A! Lamin C! MW! (kda)! 62! 62.5! 47.5! α tubulin! Caspase-6 is required for completion of chromatin condensation and formation of apoptotic bodies in nuclei containing lamin A
9 Is Lamin-A cleavage critical for nuclear apoptotic execution? Control extracts Apoptotic extracts wt (-/-) wt (-/-) Lamin A expression HeLa nuclei No lamin A expression Jurkat nuclei DAPI Jurkat GFP-lamin A nuclei Lamin A is the critical substrate that, when present, must be cleaved by caspase-6 in order for nuclear apoptosis to go to completion * GFP Merged
10 Caspase-7 gene targeting GgPro-caspase-7! Prodomain! N! Large subunit! Small subunit! C! 5ʼ! Start! Knockout construct! EcoRI! 5ʼ arm! Ev! Ew!Ex! Ey! Ez! Stop! resistance! 3ʼ arm! 3 kb! cassette! 2 kb! EcoRI! 3ʼ! probe! Wild type allele! EcoRI! EcoRI! 11 kb! 11 kb! Targeted allele! (HisD or BsR)! EcoRI! EcoRI! 4.3 kb! 4.3 kb! what is the role of caspase-7 in apoptosis? Korfali N.
11 Caspase-7 / cells show an increased resistance to apoptosis Cell viability (% of control)! 100! 80! 60! 40! 20! 0!.1! casp 7 +/- a! casp 7 +/- b! casp 7 --/- a! casp 7 -/- b! 1! 10! 100! Etoposide concentration (µm)! Cell viability (% of control)! 100! 80! 60! 40! 20! 0!.1! casp 7 --/-! casp 7 -/- :casp-7:egfp! 1! 10! 100! Etoposide concentration (µm)! Korfali N.
12 Caspase-7 deficient cells show a delay in DNA fragmentation A! bp 12.0! 5.0! 3.0! 2.0! 1.6! 1.0! 0.5! MW! 0 h! 2 h! 3 h! -/-! -/-! -/-! -/-! -/-! -/-! B! Tunel positive cells (% of total)! 100! 90! 80! 70! 60! 50! 40! 30! 20! 10! 0! casp7 -/-! casp7 --/- :casp-7:egfp! Time (hours)! Korfali N.
13 Caspase-7-deficient cells show delayed loss of plasma membrane asymmetry during apoptotic execution An emerging view of the role of Caspase-7 in apoptosis. Caspase-7 may function closer to the apex of the Caspase cascade. Korfali N. A! B! Annexin V positive cells (% of total)! Annexin V positive cells (% of total)! 80! 70! 60! 50! 40! 30! 20! 10! 0! 35! 30! 25! 20! 15! 10! 5! 0! casp 7 -/-! casp 7 -/- :casp-7:egfp! etoposide! 0! 1! 2! 3! 4! 5! 6! Time (hours)! casp 7 -/-! casp 7 -/- :casp-7:egfp! staurosporine! 0! 1! 2! 3! 4! 5! 6! 7! 8! 9! Time (hours)!
14 CAD knockout strategy Samejima K
15 Inter-nucleosomal DNA cleavage is absent in CAD -/- cells and chromatin condensation is blocked at an early stage Samejima K
16 ICAD and CAD/ICAD double knockout strategy Ageichik A.
17 Inter-nucleosomal DNA cleavage is absent and chromatin condensation is blocked at early stages in both ICAD and CAD/ICAD double knockouts Ageichik A.
18 Nadia Korfali Alexander Ageichik Kumiko Samejima Bill Earnshaw
19 Caspase Activation Is Delayed in Caspase-7 / Cells A! B! LEHD-AFC cleavage! (pmol/min/mg prtotein) DEVD-AFC cleavage! (pmol/min/mg prtotein)! VEID-AFC cleavage! (pmol/min/mg prtotein)! 0 h! 3 h! Time (h) 0 6 h! 0 h! casp-7 -/-! 3 h! 6 h! WT Caspase-7-/- zek(bio)d-aomk! labeling! Biotenylated proteins loading control! C! D! LEHD-AFC cleavage! (pmol/min/mg prtotein! DEVD-AFC cleavage)! (pmol/min/mg prtotein! VEID-AFC cleavage! (pmol/min/mg prtotein! 0 h! Time (h) 0.5 h! 1 h! 0 h! casp-7 -/-! 0.5 h! 1 h! WT Caspase-7-/- zek(bio)d-aomk! labeling! Biotenylated proteins loading control!
The Biochemistry of apoptosis
The Biochemistry of apoptosis 1 1 The apoptosis is composed of multiple biochemical events 2 2 Biochemical, cellular, and molecular events in Apoptosis 1. Membrane blebbing; phosphatidyl serine exposure
NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
Prolonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
Page 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Supplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.
Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. (a) Western blotting analysis showing degradation of
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype
Supplementary Table 1. Location of lens opacification in Aldh1a1(-/-), Aldh3a1(-/-) single and Aldh1a1(-/-)/Aldh3a1(-/-) double knockout mice (DKO) at different ages. A. One to three months of age Genotype
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
Apoptosis Chapter 9. Neelu Yadav PhD
Apoptosis Chapter 9 Neelu Yadav PhD Neelu.Yadav@Roswellpark.org 1 Apoptosis: Lecture outline Apoptosis a programmed cell death pathway in normal homeostasis Core Apoptosis cascade is conserved Compare
#19 Apoptosis Chapter 9. Neelu Yadav PhD
#19 Apoptosis Chapter 9 Neelu Yadav PhD Neelu.Yadav@Roswellpark.org Why cells decide to die? - Stress, harmful, not needed - Completed its life span Death stimulation or Stress Cell Survival Death Functions
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Receptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury
Receptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury Haruo Kanno, M.D., Ph.D., Hiroshi Ozawa, M.D., Ph.D., Satoshi Tateda, M.D., Kenichiro Yahata, M.D.,
WDR62 is associated with the spindle pole and mutated in human microcephaly
WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
Apoptosis Oncogenes. Srbová Martina
Apoptosis Oncogenes Srbová Martina Cell Cycle Control point Cyclin B Cdk1 Cyclin D Cdk4 Cdk6 Cyclin A Cdk2 Cyclin E Cdk2 Cyclin-dependent kinase (Cdk) have to bind a cyclin to become active Regulation
Apoptotic Pathways in Mammals Dr. Douglas R. Green
Apoptotic Pathways in Mammals Douglas R. Green 1 Apoptosis A form of cell death that is defined morphologically, and features a number of biochemical events Programmed cell death Cell death that occurs
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Under the Radar Screen: How Bugs Trick Our Immune Defenses
Under the Radar Screen: How Bugs Trick Our Immune Defenses Session 8: Apoptosis Marie-Eve Paquet and Gijsbert Grotenbreg Whitehead Institute for Biomedical Research Myxoma virus Poxvirus Infects rabbits
SD-1 SD-1: Cathepsin B levels in TNF treated hch
SD-1 SD-1: Cathepsin B levels in TNF treated hch. A. RNA and B. protein extracts from TNF treated and untreated human chondrocytes (hch) were analyzed via qpcr (left) and immunoblot analyses (right) for
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
Caractérisation et méthodes d études de la mort cellulaire par cytométrie en flux
Caractérisation et méthodes d études de la mort cellulaire par cytométrie en flux Université de Bourgogne Gérard LIZARD - Inserm EA7270 - Equipe Biochimie du Peroxysome, inflammation et Métabolisme Lipidique
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis
Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis induction in bladder transitional-cell papilloma RT4 cells: Evidence for a regulatory loop between
Supplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
Supplementary Information File
Supplementary Information File Supplementary Table 1. List of synthesized sirna sequences for target genes sirna Species Sequence Ctrl sirna mouse sense 5 -UUCUCCGAACGUGUCACGUTT-3 Antisense 5 -ACGUGACACGUUCGGAGAATT-3
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
PK15 48 (1) :58 63, (intermediate filament, IF) D ( Traub et al., 1994) IF P K15 D. ( Fuchs et al., 1994), , ( Fuchs et al., 1992) (apoptosis)
48 (1) :58 63, 2002 A cta Zoologica S inica 3 PK15 (, 100871) D P K15 ( Porcrne Kidney215) DNA, DNA ladder ;,,,, P K15 D (intermediate filament, IF) D ( Traub et al., 1994) IF P K15 ( Porcine Kidney215),,
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
34 Apoptosis Programmed cell death is vital to the health and development of multicellular organisms.
Principles of Biology contents 34 Apoptosis Programmed cell death is vital to the health and development of multicellular organisms. Apoptosis is the reason we have separate fingers and toes. During embryonic
Product Datasheet. Caspase-3 Antibody (31A1067) - (Pro and Active) NB Unit Size: 0.1 mg
Product Datasheet Caspase-3 Antibody (31A1067) - (Pro and Active) NB100-56708 Unit Size: 0.1 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 1 Publications:
Problem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
SUPPLEMENTARY MATERIAL
SYPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY MATERIAL Figure S1. Phylogenic studies of the mir-183/96/182 cluster and 3 -UTR of Casp2. (A) Genomic arrangement of the mir-183/96/182 cluster in vertebrates.
Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
#19 Apoptosis Chapter 9. Neelu Yadav PhD
#19 Apoptosis Chapter 9 Neelu Yadav PhD Neelu.Yadav@Roswellpark.org Why cells decide to die? - Stress, harmful, not needed - Completed its life span Death stimulation or Stress Cell Survival Death Functions
Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
supplementary information
DOI: 10.1038/ncb2157 Figure S1 Immobilization of histone pre-mrna to chromatin leads to formation of histone locus body with associated Cajal body. Endogenous histone H2b(e) pre-mrna is processed with
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
Acta Medica Okayama. A comparison of the signal pathways between the TNF alpha- and oridonin-induced murine L929 fibrosarcoma cell death.
Acta Medica Okayama Volume 59, Issue 6 2005 Article 4 DECEMBER 2005 A comparison of the signal pathways between the TNF alpha- and oridonin-induced murine L929 fibrosarcoma cell death. Jian Huang Lijun
Cell Cycle, Mitosis, and Microtubules. LS1A Final Exam Review Friday 1/12/07. Processes occurring during cell cycle
Cell Cycle, Mitosis, and Microtubules LS1A Final Exam Review Friday 1/12/07 Processes occurring during cell cycle Replicate chromosomes Segregate chromosomes Cell divides Cell grows Cell Growth 1 The standard
Multi-Parameter Apoptosis Assay Kit
Multi-Parameter Apoptosis Assay Kit Catalog Number KA1335 5 x 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
A Yersinia-Secreted Effector Protein Promotes Virulence by Preventing Inflammasome Recognition of the Type III Secretion System
Cell Host & Microbe, Volume 7 Supplemental Information A Yersinia-Secreted Effector Protein Promotes Virulence by Preventing Inflammasome Recognition of the Type III Secretion System Igor E. Brodsky, Noah
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/339/339ra69/dc1 Supplementary Materials for The caspase-8 inhibitor emricasan combines with the SMAC mimetic birinapant to induce necroptosis and
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
JCB. Supplemental material. Gu et al.,
Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an
Balancing intestinal and systemic inflammation through cell type-specific expression of
Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia
C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is
' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
Fluorescence Microscopy
Fluorescence Microscopy Imaging Organelles Mitochondria Lysosomes Nuclei Endoplasmic Reticulum Plasma Membrane F-Actin AAT Bioquest Introduction: Organelle-Selective Stains Organelles are tiny, specialized
SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila
SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila Ayako Kohyama-Koganeya, 1,2 Takuji Nabetani, 1 Masayuki Miura, 2,3 Yoshio Hirabayashi
Small-molecule activation of procaspase-3 to caspase-3 as a personalized anticancer strategy
Small-molecule activation of procaspase-3 to caspase-3 as a personalized anticancer strategy Paul J. Hergenrother and Co-workers Department of Chemistry Department of Biochemistry Univeristy of Illinois-Urbana
Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in
Role of apoptotic and anti-apoptotic mechanisms in erythroblast differentiation
Role of apoptotic and anti-apoptotic mechanisms in erythroblast differentiation Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissentschaftlichen
Muse Assays for Cell Analysis
Muse Assays for Cell Analysis Multiple Assay Outputs for Cell Analysis Cell Health Cell Signalling Immunology Muse Count & Viability Kit Muse Cell Cycle Kit Muse Annexin V & Dead Cell Kit Muse Caspase
Supplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
Mechanical Stress-Dependent Autophagy Components Release via Extracellular
Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,
Kinase Inhibitor p21 WAF1/CIP1 in Apoptosis and Autophagy
Pivotal Role of the Cyclin-dependent Kinase Inhibitor p21 WAF1/CIP1 in Apoptosis and Autophagy Keishi Fujiwara, Shigeru Daido, Akitsugu Yamamoto, Ryuji Kobayash, Tomohisa Yokoyama, Hiroshi Aok, Eiji Iwado,
P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl
P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig. 1. 3 or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
stability and tumor suppression
Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong