PPAR activation attenuates cold-induced upregulation of thyroid status and brown adipose tissue PGC-1 and D2

Transcription

1 Am J Physiol Regul Integr Comp Physiol 33: R77 R85,. First pulished Otoer, ; doi:.5/jpregu.99.. PPAR tivtion ttenutes old-indued upregultion of thyroid sttus nd rown dipose tissue PGC- nd D Willim T. Festui, Pierre-Gilles Blnhrd, Thigo B. Oliveir, Julin Mgdlon, Vivin A. Pshol, Denis Rihrd, nd Yves Deshies Deprtment of Physiology, Institute of Biomedil Sienes, University of São Pulo, São Pulo, Brzil; nd Quee Hert nd Lung Institute Reserh Center, nd Deprtment of Mediine, Fulty of Mediine, Lvl University, Quee, Cnd Sumitted July ; epted in finl form Otoer Festui WT, Blnhrd PG, Oliveir TB, Mgdlon J, Pshol VA, Rihrd D, Deshies Y. PPAR tivtion ttenutes old-indued upregultion of thyroid sttus nd rown dipose tissue PGC- nd D. Am J Physiol Regul Integr Comp Physiol 33: R77 R85,. First pulished Otoer, ; doi:.5/jpregu.99.. Here, we investigted whether phrmologil PPAR tivtion modultes key erly events in rown dipose tissue (BAT) reruitment indued y ute old exposure with the im of unrveling the interreltionships etween symptheti nd PPAR signling. Sprgue-Dwley rts treted or not with the PPAR lignd rosiglitzone (5 mg kg dy, 7 dys) were kept t 3 C or exposed to old (5 C) for h nd evluted for BAT gene expression, symptheti tivity, thyroid sttus, nd drenergi signling. Rosiglitzone did not ffet the redution in ody weight gin nd the inrese in feed effiieny, V O, nd BAT symptheti tivity indued y -h old exposure. Rosiglitzone strongly ttenuted the inrese in serum totl nd free T nd T3 levels nd BAT iodothyronine deiodinse type (D) nd PGC- mrna levels nd potentited the redution in BAT thyroid hormone reeptor (THR) mrna levels indued y old. Administrtion of T3 to rosiglitzone-treted rts exerted the old-indued inrese in energy expenditure ut did not restore proper tivtion of D nd PGC-, nor further inresed unoupling protein expression. Regrding drenergi signling, rosiglitzone did not ffet the hnges in BAT AMP ontent nd PKA tivity indued y old. Rosiglitzone lone or in omintion with old inresed CREB inding to DNA, ut it mrkedly redued the expression of one of its mjor otivtors, CREB inding protein. In onlusion, phrmologil PPAR tivtion impirs short-term old eliittion of BAT drenergi nd thyroid signling, whih my result in norml tissue reruitment nd thermogeni tivity. rown dipose tissue reruitment; symptheti tivity; thyroid sttus; drenergi signling; thizolidinediones Address for reprint requests nd other orrespondene: Y. Deshies, Quee Hert & Lung Institute Reserh Center, Pv. d Youville Y-3, Quee, QC, Cnd (e-mil: yves.deshies@phs.ulvl.). A POSSIBLE UTILIZATION OF rown dipose tissue (BAT) nonshivering thermogenesis s n lterntive to tret oesity hs gined renewed interest with the reent onfirmtion tht sustntil numer of dult humns possesses tive BAT (6,, 3, 3, 37). Although urrent knowledge out the impt of BAT on humn energy lne is still sre, it is plusile to envisge tht the effiy of BAT-trgeted therpies will depend upon the reruitment (inrese in tissue mss nd thermogeni pity) of BAT in humns nd the development of strtegies to sfely swith thermogenesis on nd off. In ddition to hroni nonil symptheti tivtion (5), BAT reruitment n e indued in rodents y dministrtion of syntheti, speifi lignds of peroxisome prolifertor-tivted reeptor (PPAR ). This nuler reeptor is highly expressed in BAT, where it ts s mster trnsriptionl regultor of rown dipoyte differentition required for tissue development, funtion, nd survivl (, 8, 5 7, ). Similrly to hroni symptheti tivtion, tretment of rodents with the PPAR lignd rosiglitzone is ssoited with mrked inrese in BAT mss, ontent of the thermogeni unoupling protein (UCP), nd key enzymes involved in ftty id oxidtion nd lipolysis (3, 9, 35). In stndrd therml environment, PPAR -indued upregultion of BAT lipolyti, oxidtive, nd thermogeni mhineries does not, however, trnslte into higher thermogenesis nd energy expenditure in vivo due to rosiglitzone-indued down-regultion of BAT symptheti tivity nd thyroid sttus, the mjor neurohormonl regultors of BAT funtion (). Further evlution of BAT reruitment indites tht despite similr inrese in tissue mss nd ontent of some thermogeni proteins, hroni symptheti nd PPAR tivtions indue somewht divergent morphologil nd metoli phenotypes in BAT. Indeed, wheres symptheti stimultion results in n inrese in the numer of multiloulr rown dipoytes with enhned rtes of gluose uptke nd ftty id oxidtion, PPAR tivtion is ssoited with n inrese in uniloulr rown dipoytes with redued gluose uptke nd unltered oxidtive rtes (). It hs een previously shown tht, even in the fe of redued thyroid sttus, the high thermogeni, oxidtive, nd lipolyti potentil indued y PPAR tivtion (i.e., mrna nd protein ontent nd onomitnt inrese in relted proesses when ssessed in vitro) is tuted t the funtionl level in vivo y phrmologil 3-drenergi stimultion (, 6, 3). Beuse thyroid sttus ws not evluted in these studies, it ws not possile to estlish whether this tution of BAT funtion indued y 3-drenergi tivtion in PPAR lignd-treted nimls ws ssoited with reestlishment of norml thyroid funtion. One interesting spet of drenergi eliittion of BAT thermogeni potentil in PPAR -treted nimls ws the sene of effet of the 3-drenergi CL36,3 gonist on the expression of the drenergilly regulted genes UCP, lipoprotein lipse (LPL), nd PPAR otivtor (PGC- ) (6), whih otherwise re diret trgets of 3 stimultion. Supporting these findings, h of old exposure did not dditively inrese BAT UCP expression further thn tht indued y rosiglitzone lone in rts (). The sene of dditive effets of simultneous PPAR nd drenergi tivtion on BAT gene expression ws quite unexpeted in the fe of oth the redued symptheti drive to BAT found upon PPAR lignd tretment of rts living in stndrd therml / Copyright the Amerin Physiologil Soiety R77

2 R78 environment (), s well s our reent findings inditing tht the optiml upregultion of UCP y PPAR tivtion depends upon the presene of intt BAT symptheti innervtion nd mintenne of miniml sl symptheti tone (). Thus, in the present study, in n ttempt to further hrterize the inter-reltionships etween symptheti nd PPAR signling in the regultion of key erly events in BAT reruitment eliited y old exposure, ontrol, nd rosiglitzonetreted rts mintined t 3 C or exposed to old (5 C) for h were evluted for determinnts of energy lne, serum metolites, lipids nd hormone levels, thyroid sttus, symptheti tivity, BAT gene expression profile of thermogeni proteins, nd BAT intrellulr drenergi signling. Our min findings indite mjor filure of old, in the presene of phrmologil PPAR tivtion, to upregulte the thyroid sttus nd expression of some speifi drenergi genes in BAT, whih, in turn, might ffet tissue reruitment nd thermogeni funtion. MATERIALS AND METHODS Animls nd tretment. Animl re nd hndling were performed in ordne with the Cndin nd Brzilin Guides for the Cre nd Use of Lortory Animls. All experimentl proedures reeived prior pprovl of the Institute of Biomedil Sienes nd Lvl University niml re ommittees. Mle Sprgue-Dwley rts (Chrles River Lortories, St. Constnt, Cnd or Institute of Biomedil Sienes Animl Fility) were individully housed in stinless-steel ges in room kept t 3 C with light-drk yle of :-h (lights on t 8). After -dy dpttion period, rts were mthed y weight nd divided into ontrol nd rosiglitzone-treted groups tht were fed nonpurified powdered rodent diet (Chrles River Rodent Diet no. 575; digestile energy ontent:.9 kj/g) lone (ontrol), or supplemented with the PPAR gonist rosiglitzone (Avndi) t dose of 5 mg kg dy for 7 dys. This dose ws hosen on the sis of preliminry studies tht showed its effetiveness to inrese BAT thermogeni proteins in short period of tretment (e.g., 7 dys). Ground rosiglitzone ws mixed with the powdered how diet, nd the desired dose ws hieved y djusting the mount of drug to the verge food onsumption nd ody weight of rts every other dy. At the seventh dy of tretment, hlf of ontrol nd rosiglitzone-treted rts were trnsferred to old room (5 C) for h with similr light-drk yle nd free ess to wter nd food ontining or not ontining rosiglitzone. At the end of the -h old exposure, rts were killed y depittion, nd trunk lood nd tissues were olleted. A similr protool ws performed in whih n extr group of rts treted with rosiglitzone reeived n intrperitonel injetion of triiodothyronine (T3) t dose of g/ g ody wt efore exposure to old. This dose of T3 ws previously shown to indue mximl sturtion of thyroid hormone reeptors in BAT (). Energy expenditure. O onsumption ws determined in n open iruit system with n O nlyzer (Applied Eletrohemistry, S-3A). Energy expenditure mesurements were rried out during h fter -h dpttion period to the new ges. Dt re presented s milliliters per oxygen per minute. Norepineprine turnover. Norepinephrine turnover rte (NETO), relile index of symptheti tivity in given tissue, ws estimted from the deline in tissue NE ontent fter inhiition of teholmine synthesis with DL- -methyl-tyrosine ester ( -MT; Sigm, St. Louis, MO), s previously desried (). Rts kept t 3 C or exposed to old (5 C) for h were killed y nestheti (ketmine/xylzine) overdose efore or h fter intrperitonel injetion of -MT (35 mg/kg ody weight). Interspulr BAT ws rpidly removed, weighed, frozen in liquid nitrogen, nd stored t 8 C for lter determintion of NE ontent. Rtes of NETO were lulted s the produt of the frtionl turnover rte (k) nd the endogenous NE ontent t time, s previously desried (3). Frtionl turnover rte, k, ws lulted y the formul: k (log [NE] log [NE] )/(.3 ), where [NE] nd [NE] re the NE ontent t times nd h, respetively. Tissue NE ontent. Tissue NE ontent ws mesured s previously desried (). Briefly, tissues were homogenized in. N perhlori id, mm of EDTA, nd % sodium metisulfite ontining dihydroxyenzylmide s n internl stndrd, nd then entrifuged. The superntnt destined for teholmine quntifition ws extrted with lumin. Cteholmines nd dihydroxyenzylmide (internl stndrd) were eluted from lumin with the ove homogeniztion solution nd ssyed y HPLC. In situ hyridiztion for oine- nd mphetmine-relted trnsript. Hypothlmi mrna levels of oine- nd mphetmine-relted trnsript (CART) were mesured y in situ hyridiztion, essentilly s previously desried (). Briefly, hypothlmi setions were mounted onto poly-l-lysine-oted slides, dehydrted in ethnol, fixed in prformldehyde, digested with proteinse K ( g/ml), etylted with.5% eti nhydride, nd dehydrted in ethnol grdient. Setions were inuted overnight with ntisense 35 S-leled RNA proe ( 7 pm/ml) for CART t 6 C. Slides were rinsed with SSC, digested with RNAse-A, wshed in desending onentrtions of SSC, nd dehydrted in ethnol grdient. Slides were deftted in toluene, dipped in NTB nuler emulsion (Estmn Kodk), nd exposed for 7 dys efore eing developed. Slides were exmined y drkfield mirosopy using n Olympus BX5 mirosope (Olympus Ameri, Melville, NY). Imges were quired with n Evolution QEi mer nd nlyzed with ImgePro plus v5... (Medi Cyernetis, Silver Spring, MD). The system ws lirted for eh set of nlyses to prevent sturtion of the integrted signl. Men pixel densities were otined y tking mesurements from oth hemispheres of one to four rin setions nd sutrting kground redings tken from res immeditely surrounding the region nlyzed. RNA isoltion nd quntifition. RNA ws isolted from BAT nd hypothlmus using QIAzol nd the RNesy lipid tissue kit (Qigen). For DNA synthesis, expnd reverse trnsriptse (Invitrogen) ws used following mnufturer s instrutions, nd DNA ws diluted in DNse-free wter (:5) efore quntifition y rel-time PCR. mrna trnsript levels were mesured in duplite smples using Rotor Gene 3 system (Montrel Bioteh, Montrel, QC, Cnd). The primers used for the PCR retions re presented in Tle. Chemil detetion of the PCR produts ws hieved with SYBR Green I (Moleulr Proes). At the end of eh run, melt urve nlyses were performed, nd few smples representtive of eh experimentl group were run on grose gel to ensure the speifiity of the mplifition. Results re expressed s the rtio etween the expression of the trget gene nd the housekeeping gene ARBP/36B (NM_), whih ws seleted euse no signifint vrition in its expression ws oserved etween tretments. Western lot nlyses. BAT ws homogenized in lysis uffer (5 mm HEPES, ph 7., mm NCl, mm EDTA, mm -glyerophosphte, mm N P O 7, % Triton, % sodium deoxyholte 5 mm NF,.5 mm N 3VO,.% SDS, nd oktil of protese inhiitors), sujeted to SDS-PAGE, trnsferred to nitroellulose memrnes, loked for h nd inuted overnight t C with primry ntiodies (Cell Signling Tehnologies). After wshing, memrnes were inuted with immunogloulin G onjugted to horserdish peroxidse nd wshed gin. The immunoretive nds were deteted y the enhned hemiluminesene method. Densitometri nlysis ws performed with ImgeQunt TL softwre (GE Helthre). CREB inding. Nuler extrts of BAT of rts treted or not with rosiglitzone mintined either t 3 C or exposed to old for h were nlyzed for CREB inding with CREB (Phospho-Ser33) AJP-Regul Integr Comp Physiol doi:.5/jpregu.99.

3 Tle. Pirs of primers used for PCR R79 Gene Aession # 5= Primer (5=-3=) 3= Primer (5=-3=) 36B NM_ TAAAGACTGGAGACAAGGTG GTGTAGTCAGTCTCCACAGA CBP NM_3338 CTGCTGGAAGAGGAAGGGGA GGCACAGTGGTGACTGAAGTATTC CIDEA XM_55 ACACCCTGCTCGTCCTTTCC GGTGGCTTTGACATTGAGACAG D NM_37 ATGGGACTCCTCAGCGTAGA GCACAGGCAAAGTCAAGAAG GyK NM_38 CCTGTCCATTGAAATGTGTCATCC GCCATGAAGCCATGACAATTAGTG PGC- NM_337 TCCTGTTACTATTATGAATCAAGCC AAACCATAGCTGTCTCCATCATCC PRDM6 NM_75 GCAGACCCTGTGGGAGTCCTGAAA GCTCCCCTGTGTGTGTCCTCAGAT SHP NM_5733 CCTCTCTTCCTGCTTGGGTT ACACAATGCCCAGTGAGCCT THR NM_796 AAGTGGCTCTGCTGCAGGCT TTGTCCCTTCTCTCCAAGCTG THR NM_67 GAATGGGAGCTCATCAAGACAGTCA GGACATGATCTCCATGCAGCA TRH NM_36 GGTCAGGAGACCCTGGTGAA TCTTGGCCAGTGCTGAAGGG UCP NM_68 TGGTGAGTTCGACAACTTCC GTGGGCTGCCCAATGAATAC UCP3 NM_367 GAAGCACTTTCGACAAGGCC TGCAGGTGAAGCTGGTCAGG trnsription ftor ssy (Cymn Chemils). Briefly, 5 g of protein from whole BAT homogentes prepred for Western lot nlysis were used for the CREB DNA inding tivity ssy, ording to the mnufturer s instrutions (CREB, Phospho- Ser 33 ). The speifiity of the method ws verified y the use of wild-type onsensus oligonuleotide s ompetitor for CREB inding, whih deresed the signl drmtilly, nd dt were expressed s perentge of positive ontrol. Serum determintions. Plsm gluose onentrtion ws mesured y the gluose oxidse method with the YSI 3 STAT plus gluose nlyzer. Plsm insulin, leptin, diponetin (Lino Reserh, St. Chrles, MO), totl nd free T3 nd T (Cot-A-Count, DPC), nd thyroid-stimulting hormone (TSH) (Biotrk rt TSH; Amershm Biosienes) were determined y rdioimmunossy. Plsm triylglyerol nd nonesterified ftty id levels were mesured y enzymti methods (Rohe Dignostis nd Wko Chemils, respetively). Sttistil nlysis. Results re expressed s mens SE. Multiftoril ANOVA followed y the Newmn-Keuls proedure were used to ompre the effets of old exposure nd thyroid hormone tretment in ontrol nd rosiglitzone-treted rts. P.5 ws tken s the threshold of signifine. RESULTS As shown in Tle, rosiglitzone did not ffet the redutions in ody weight gin nd feed effiieny or the inreses in food intke nd V O indued y h of old exposure. Rosiglitzone signifintly inresed BAT nd inguinl dipose tissue msses, n effet tht ws ttenuted y old exposure in the former ut not the ltter. Retroperitonel white tissue mss ws not ffeted y ny of the tretments. Regrding serum prmeters, rosiglitzone potentited the redution in insulin nd triylglyerol levels nd ttenuted the inreses in nonesterified ftty id indued y old exposure. Furthermore, rosiglitzone lone signifintly redued glyemi nd inresed serum diponetin levels, suh effets eing ompletely loked nd ttenuted y old exposure, respetively. Finlly, rosiglitzone, in omintion with old, signifintly redued serum leptin levels in omprison to other tretments. As depited in Fig., A nd B, phrmologil PPAR tivtion did not ffet the old-indued inrese in BAT glyerokinse (GyK), n enzyme tht synthesizes glyerol 3-phosphte for triylglyerol synthesis, nd UCP mrna levels. In ontrst to those genes, rosiglitzone mrkedly ttenuted the inrese in iodothyronine deiodinse type (D), whih onverts T into iologilly tive T3, tht of PGC-, n importnt regultor of BAT unoupling protein (UCP) trnsription, nd the redution in ell deth-induing DFF5- like effetor A (CIDEA, n ttenutor of UCP tivity) mrna levels indued y old exposure (Fig., C E). Finlly, rosiglitzone redued mrna levels of the positive regultory domin ontining 6 (PRDM6), zin-finger protein involved in rown dipogenesis tht inds PPAR nd inreses Tle. Effet of -h old exposure on ody weight gin, food intke, feed effiieny, mss of white nd rown dipose tissues, nd serum onentrtions of insulin, metolites, diponetin, nd leptin in rts treted or not with rosiglitzone Control, 3 C Control, 5 C RSG, 3 C RSG, 5 C Body weight gin, g Food intke, g Feed effiieny, % e V O, ml min kg ody wt BAT, mg Inguinl WAT, g Retroperitonel WAT, g Insulin, pm Gluose, mm NEFA, Eq/l TAG, mm d Adiponetin, g/ml Leptin, ng/ml Dt re expressed s mens SE of 6- rts. WAT, white dipose tissue; BAT, rown dipose tissue; NEFA, nonesterified ftty id; TAG, triylglyerol; RSG, rosiglitzone.,,,d Mens not shring ommon supersript letter re signifintly different from eh other, P.5. eclulted s grm ody wt gin/ g food ingested. AJP-Regul Integr Comp Physiol doi:.5/jpregu.99.

4 R8 A GyK/36B mrna o C 5 o C B UCP/36B mrna 3 Fig.. Brown dipose tissue (BAT) gene expression profile in rts treted or not with rosiglitzone (RSG) nd exposed or not to old for h.,,,d Mens not shring ommon supersript letter re signifintly different from eh other, P.5; n. C PGC-α/36B mrna E CIDEA/36B mrna 6 3 D 5 5 d D/36B mrna F PRDM6/36B mrna its trnsriptionl tivity (5), n effet tht ws potentited y old exposure (Fig. F). The inility of old exposure to mximlly tivte BAT expression of the drenergilly regulted genes PGC- nd D ssoited with PPAR tivtion prompted us to investigte possile effet of rosiglitzone modulting old tivtion of BAT symptheti tivity. There were no hnges in BAT norepinephrine (NE) ontent, n index of the degree of symptheti innervtion rther thn tivity, y ny of the tretments (Fig. A). As depited in Fig., B nd C, rosiglitzone did not ffet the inrese in BAT NETO or BAT k (Fig., B nd C) nd rute nuleus CART mrna levels (Fig., D nd E), neuropeptide tht hs een previously demonstrted to e ntomilly linked to nd modulte BAT symptheti nerves (9, 8). Beuse thyroid hormones exert n importnt role in the mplifition of intrellulr drenergi signling in BAT, we next investigted whether rosiglitzone ffets the tivtion of the hypothlmi-pituitry-thyroid xis ssoited with old exposure. As depited in Fig. 3A, neither intervention ltered hypothlmi mrna levels of thyrotropin-relesing hormone (TRH). Serum TSH levels were not signifintly hnged y rosiglitzone, ut the omintion of oth old nd rosiglitzone indued signifint inrese in TSH levels in omprison to ontrol rts mintined t 3 C (Fig. 3B). On the other hnd, rosiglitzone ompletely loked the inreses in serum totl nd free T nd T3 nd potentited the derese in THR mrna levels indued y old exposure (Fig. 3, C F, nd H). Finlly, rosiglitzone signifintly redued BAT THR mrna levels, n effet tht ws not modulted y old exposure (Fig. 3G). The mrked ttenution of thyroid xis tivtion y old exposure indued y rosiglitzone prompted us to investigte more speifilly whether their reltive hypothyroid stte ws involved in the inility of old to stimulte the expression of BAT PGC- nd D (D-generted T3 potentites drenergi signling towrd D expression in feed-forwrd fshion). To this end, rts treted with rosiglitzone reeived, prior to old exposure, n intrperitonel injetion of T3. As depited in Fig., T3 dministrtion mrkedly inresed serum levels of free T3 (Fig. A), exerted the weight loss (Fig. B) nd the redution in feed effiieny (Fig. C), while it mplified the AJP-Regul Integr Comp Physiol doi:.5/jpregu.99.

5 A BAT NE Content (ng/ tissue) C BAT Frtionl NE rtes (%/ h) E 8 3 o C o 5 C B BAT NETO (ng NE/ tissue h) D ARC CART mrna Control, ºC RSG, 3ºC Control, ºC RSG, ºC 5 neither old exposure lone nor in omintion with T3, further inresed UCP in rosiglitzone-treted rts (Fig. F). In n ttempt to eluidte the mehnisms underlying the filure of the symptheti nervous system to inrese the expression of the drenergilly regulted genes PGC- nd D in BAT of rosiglitzone-treted rts, we investigted the sttus of key steps of the intrellulr drenergi signling pthwy in this tissue, inluding AMP ontent, PKA, CREB DNA inding, nd the expression nd ontent of some oregu- A C E TRH/GAPDH mrna Totl T (nm) o C 5 o C Serum TSH (µg/ ml) Free T (pm) F 8 B D 9.6,, R8 Totl T3 (nm) Free T3 (pm),.3 Fig.. BAT norepinephrine (NE) ontent (A), NE turnover rtes (NETO; B), NE frtionl turnover rte (C), nd rute hypothlmi nuleus mrna levels of CART (D nd E) in rts treted or not with RSG nd exposed or not to old for h. Optil density of CART mrna hyridiztion signl is presented together with representtive pitures of the in situ hyridiztion.,, Mens not shring ommon supersript letter re signifintly different from eh other, P.5; n 6. old-indued inrese in the mrna levels of the T3 trget genes smll heterodimer protein [SHP, negtive regultor of PGC- expression nd energy expenditure in rown dipoytes (33)] nd UCP3 in rts treted with rosiglitzone (Fig., G nd H). Despite these effets, hormone therpy ws not le to restore in rosiglitzone-treted rts the ility of old exposure to inrese BAT PGC- nd D mrna levels (Fig., D nd E). Surprisingly, the strong inrese in UCP mrna levels rought y rosiglitzone lone ws mximl nd suggestive of eiling effet ssoited with PPAR gonism, s G BAT THRα/ 36B mrna H BAT THRβ/ 36B mrna Fig. 3. Hypothlmi TRH mrna levels (A), serum thyroid-stimulting hormone (TSH; B), totl (C) nd free (D) T, totl (E) nd free (F) T3, nd rown dipose tissue mrna levels of THR nd THR (G nd H) in rts treted or not with RSG nd exposed or not to old for h.,,,d Mens not shring ommon supersript letter re signifintly different from eh other, P.5; n. d AJP-Regul Integr Comp Physiol doi:.5/jpregu.99.

6 R8 Fig.. Serum free T3 levels (A), ody weight gin (B), feed effiieny (C), nd BAT gene expression (D H) in ontrol nd rosiglitzone-treted rts exposed or not to old for h in ssoition or not with n intrperitonel injetion of T3 ( g/ g ody weight).,, Mens not shring ommon supersript letter re signifintly different from eh other, P.5; n. A B C Free T3 Levels (pmol/ L) Control RSG RSG Control RSG RSG Control RSG RSG D E F G PGC-α/36B mrna D/36B mrna UCP/36B mrna Control RSG RSG Control RSG RSG Control RSG RSG 8 SHP/36B mrna Control RSG RSG Control RSG RSG 6-6 H UCP3/36B mrna - 3 o C 5 o C o 5 C + T3 ltors of its trnsriptionl tivity. As depited in Fig. 5A, rosiglitzone did not ffet the inrese in BAT AMP ontent indued y old exposure. Rosiglitzone lone signifintly inresed BAT PKA tivity nd CREB inding tivity to its onsensus DNA inding sequene nd redued CREB otivtor histone etyltrnsferse CREB inding protein (CBP) mrna levels (Fig. 5, B D). Among these effets, only the inrese in PKA tivity ws ttenuted y old exposure. Finlly, neither rosiglitzone nor old nor their omintion ffeted BAT protein ontent of the CREB-regulted trnsription otivtors (CRTC) nd (Fig. 5E) nd mrna levels of other otivtors involved in the regultion of PGC- trnsription (SIRT3, CHOP, nd ATF; dt not shown). DISCUSSION Our min findings indite tht despite hving higher BAT mss nd UCP ontent, rosiglitzone-treted rts displyed upon n ute old exposure similr ody weight gin, feed effiieny, V O, nd BAT symptheti tivity thn ontrol, untreted rts. Despite those similrities, rosiglitzone mrkedly impired old s ility to stimulte the thyroid xis nd to properly inrese BAT levels of the thermogeni genes D nd PGC-, n effet ssoited with mrked redution in the mrna levels of THR nd the CREB otivtor CBP. Rosiglitzone-treted rts were hllenged here with short period of old exposure ( h) nd evluted for very erly events involved in BAT reruitment iming to unveil the intertions etween PPAR nd drenergi signling nd possile potentition of this proess through tissue priming y PPAR tivtion. The mrkedly inresed BAT mss (, ) nd UCP ontent indued y rosiglitzone did not led to higher energy expenditure upon old exposure, s estimted y ody weight gin, feed effiieny, nd V O. These findings re in ontrst with the dditive inrese in energy expenditure found upon onomitnt tretment of mie with PPAR lignd nd the 3 drenergi reeptor gonist CL-363 (6). Suh disrepny etween phrmologil vs. physiologil eliittion of thermogenesis ould e due to the durtion of drenergi tivtion ( h of old vs. wk of CL-363), speies differenes (rts vs. mie), nd the preferentil reruitment of different thermogeni proesses ssoited with phrmologil 3-drenergi tivtion (nonshivering thermogenesis only) nd ute old exposure (shivering thermogenesis minly) (5). In ontrst to energy expenditure, however, rosiglitzone mrkedly redued old ility to properly upregulte BAT mrna levels of the drenergilly regulted genes PGC- (3) nd D (8) in BAT. Interestingly, this effet seems to e speifi to some, ut not ll drenergilly regulted genes, s the expression of GyK, gene positively regulted y the symptheti nervous system nd PPAR in BAT (, ), ws, s expeted, upregulted y old in rosiglitzone-treted rts. AJP-Regul Integr Comp Physiol doi:.5/jpregu.99.

7 Fig. 5. AMP ontent (A), PKA tivity (B), yli AMP-responsive element inding protein (CREB) inding (C), CREB inding protein mrna levels (D), nd CREB-regulted trnsription otivtor nd protein ontent in BAT of ontrol nd rosiglitzone-treted rts exposed or not to old for h (E)., Mens not shring ommon supersript letter re signifintly different from eh other, P.5; n. On the sis of our previous findings of redued BAT symptheti tone nd rute nuleus CART levels in rosiglitzone-treted rts (), we tested the hypothesis tht the impirment in old-indued upregultion of D nd PGC- y rosiglitzone ws due to n impirment in the old-indued tivtion of BAT symptheti outflow due to entrl tion of rosiglitzone on rute CART levels. This hypothesis proved flse, s rosiglitzone did not impir old tivtion of BAT symptheti drive nd upregultion of rute CART levels. Of note, the lose ssoition etween rute CART levels nd BAT symptheti tivity upon rosiglitzone nd old strongly supports mjor involvement of CART in BAT regultion. Aordingly, rute CART-expressing neurons re ntomilly linked to BAT symptheti nerves (9), nd their positive modultion inreses BAT symptheti tone (8). R83 The sene of impt of rosiglitzone on old-medited indution of BAT symptheti tone led us to test whether the filure of old to indue D nd PGC- ws due to defet in intrellulr drenergi signling. Beuse drenergi signling in rown dipoytes is strongly modulted y T3 (7, 7), n extensive nlysis of thyroid sttus ws performed. Cold exposure not only filed to inrese serum totl nd free T nd T3, ut further redued the lredy low BAT mrna levels of THR in rosiglitzone-treted rts. The mehnisms y whih rosiglitzone olishes the upregultion of serum thyroid hormone y old re unknown, ut the sene of hnge in TRH nd TSH indites n tion of the lignd on thyroid funtion. Furthermore, rosiglitzone impired oldindued upregultion of oth BAT D, lol genertor of T3 from T needed for the mplifition of BAT drenergi signling (7), nd PGC-, n importnt otivtor of THR tivtion of UCP trnsription (3). These findings suggest n involvement of the thyroid sttus in the filure of old to properly tivte the expression of PGC- nd D in rosiglitzone-treted rts. To test the ove hypothesis, we utely dministered T3 to rosiglitzone-treted rts prior to old exposure t dose shown to indue mximl sturtion of thyroid hormone reeptors in BAT () in n ttempt to ypss the inility of old to stimulte BAT D nd thus lol prodution of T3. In spite of the mrked inrese in energy expenditure (ody weight loss nd redued feed effiieny) nd the expeted inrese in the expression of T3 trget genes (UCP3 nd SHP) upon old exposure, T3 did not restore the ility of old to inrese BAT D nd PGC-, whih my e due to defet in T3 tivtion of BAT THR. Aordingly, expression of THR, whih is involved not only in T3 regultion of UCP nd UCP3 () ut lso in the drenergi tivtion of D expression (9), ws mrkedly redued in rosiglitzone-treted rts exposed to old. A similr modultion my lso pply to PGC-, whose expression in the liver is upregulted y T3 (3); however, whether suh regultion ours in BAT nd involves THR remins to e estlished. To gin further insight into the mehnisms underlying the inility of old to inrese BAT D nd PGC- in rosiglitzone-treted rts, we evluted severl spets of BAT drenergi intrellulr signling. The sene of effet of rosiglitzone on the inrese in BAT AMP indued y old nd the sene of mjor negtive hnges in mximl PKA tivity exlude their involvement in the filure of old to properly stimulte BAT D nd PGC- under PPAR tivtion. Rtes of CREB DNA inding, on the other hnd, were signifintly inresed y rosiglitzone in rts t 3 C or 5 C, inditing n exertion of CREB phosphoryltion, trnslotion to the nuleus, nd intertion with its onsensus DNAinding sequene. Although suh n inrese in CREB inding seems ounterintuitive to the filure of old to upregulte BAT D nd PGC- in rosiglitzone-treted rts, it does, in ft, indite tht PPAR tivtion is perhps ffeting steps downstrem of CREB inding to DNA. The inding of trnsription ftors, suh s CREB onto promoter region, n result in stimultion or inhiition of gene trnsription, depending on the reruitment nd intertion with otivtors or orepressors, respetively. Evlution of BAT ontent of severl CREB otivtors, inluding CBP, CRTC-, nd CRTC-, reveled mjor effet of rosiglitzone deresing AJP-Regul Integr Comp Physiol doi:.5/jpregu.99.

8 R8 mrna levels of CBP, protein lysine etyltrnsferse tht inds to phosphorylted CREB nd etyltes histones, loosening up hromtin struture for trnsription initition. Suh redution in CBP is omptile with redued CREB effiieny; however, further experiments re required to estlish whether redued CBP is involved in the filure of old to stimulte D nd PGC- in BAT of rosiglitzone-treted rts. In onlusion, phrmologil PPAR tivtion is ssoited with n norml response of BAT thyroid nd drenergi signling despite norml symptheti tivtion indued y old exposure nd/or orretion of reltive hypothyroidism y T3 tretment. Beuse of the importne of thyroid nd drenergi signling for the proper tivtion of BAT thermogenesis, it is very likely tht the old indution of funtionl BAT thermogeni response my e prtilly impired y rosiglitzone, possiility tht remins to e experimentlly tested through the mesurement of BAT temperture. Identifition of the mehnisms underlying BAT norml response in rosiglitzone-treted rts to old ould help define etter strtegies to reruit BAT without ffeting its thermogeni effiieny. Perspetives nd Signifine The identifition of BAT in dult humns hs opened up the opportunity to develop strtegies tht tke dvntge of its unique thermogeni ility to tret oesity. For this, strtegies not only to sfely reruit BAT (i.e., inrese funtionl mss nd thermogeni pity) in humns ut lso to turn thermogenesis on nd off, will hve to e developed. PPAR tivtion hs reently een reognized s phrmologil lterntive to drenergi stimultion for BAT reruitment (). Here, however, we report strong evidene inditing tht BAT reruited y phrmologil PPAR tivtion hs n impired thermogeni response upon n ute old hllenge. Whether suh redued BAT thermogeni ility persists following long-term old exposure nd whether it is dependent upon sustined ontinution of rosiglitzone dministrtion need to e investigted. Phrmologil PPAR tivtion inreses BAT mss y stimulting hyperplsi nd lipidssoited hypertrophy. The ft tht BAT reruitment is ssoited with redution in importnt mrkers of rown dipoytes, suh s PRDM6 nd D, long with n inrese in the numer of uniloulr dipoytes, despite inresed UCP levels, rises the possiility tht PPAR my e either induing white dipoyte fetures in rown dipoytes or ting on the reently hrterized rite/eige dipoytes (36). Chrteriztion of the mehnisms underlying these phenotypes nd the development of novel seletive PPAR modultors my help optimize PPAR -medited BAT reruitment t the funtionl level. ACKNOWLEDGMENTS The uthors re very grteful for the invlule professionl ssistne of Yves Gélins. GRANTS This work ws supported y grnts from the Cndin Institutes of Helth Reserh (CIHR) nd the Nturl Sienes nd Engineering Reserh Counil of Cnd (NSERC) to Y. Deshies. W. T. Festui is reipient of Young Sientist Fellowship nd Grnt from the São Pulo Reserh Foundtion (FAPESP 9/535-7 nd /99-8). P.-G. Blnhrd ws the reipient of Frederik Bnting nd Chrles Best Cnd Grdute Sholrship- Dotorl Awrd from CIHR. DISCLOSURES No onflits of interest, finnil or otherwise, re delred y the uthors. AUTHOR CONTRIBUTIONS Author ontriutions: W.T.F., D.R., nd Y.D. oneption nd design of reserh; W.T.F., P.-G.B., T.B.O., J.M., nd V.A.P. performed experiments; W.T.F., P.-G.B., T.B.O., J.M., nd V.A.P. nlyzed dt; W.T.F., D.R., nd Y.D. interpreted results of experiments; W.T.F. prepred figures; W.T.F. drfted mnusript; W.T.F., P.-G.B., T.B.O., J.M., V.A.P., D.R., nd Y.D. edited nd revised mnusript; W.T.F., P.-G.B., T.B.O., J.M., V.A.P., D.R., nd Y.D. pproved finl version of mnusript. REFERENCES. Brk Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozno P, Chien KR, Koder A, Evns RM. PPAR gmm is required for plentl, rdi, nd dipose tissue development. Mol Cell : , Bino AC, Silv JE. Intrellulr onversion of thyroxine to triiodothyronine is required for the optiml thermogeni funtion of rown dipose tissue. J Clin Invest 79: 95 3, Brodie BB, Cost E, Dl A, Neff NH, Smookler HH. Applition of stedy stte kinetis to the estimtion of synthesis rte nd turnover time of tissue teholmines. J Phrmol Exp Ther 5: 93 98, Burkey BF, Dong M, Ggen K, Ekhrdt M, Drgons N, Chen W, Grosenstein P, Argentieri G, de Souz CJ. Effets of pioglitzone on promoting energy storge, not expenditure, in rown dipose tissue of oese f/f Zuker rts: omprison to CL 36,3. Metolism 9: 3 38,. 5. Cnnon B, Nedergrd J. Brown dipose tissue: funtion nd physiologil signifine. Physiol Rev 8: ,. 6. Celi FS. Brown dipose tissue when it pys to e ineffiient. N Engl J Med 36: , de Jesus LA, Crvlho SD, Rieiro MO, Shneider M, Kim SW, Hrney JW, Lrsen PR, Bino AC. The type iodothyronine deiodinse is essentil for dptive thermogenesis in rown dipose tissue. J Clin Invest 8: ,. 8. Dun SZ, Ivshhenko CY, Whitesll SE, D Aley LG, Duquine DC, Brosius FC 3rd, Gonzlez FJ, Vinson C, Pierre MA, Milstone DS, Mortensen RM. Hypotension, lipodystrophy, nd insulin resistne in generlized PPAR -defiient mie resued from emryoni lethlity. J Clin Invest 7: 8 8, Elis CF, Lee C, Kelly J, Ashkensi C, Ahim RS, Coueyro PR, Kuhr MJ, Sper CB, Elmquist JK. Leptin tivtes hypothlmi CART neurons projeting to the spinl ord. Neuron : , Festui WT, Blnhrd PG, Rihrd D, Deshies Y. Bsl drenergi tone is required for mximl stimultion of rt rown dipose tissue UCP expression y hroni PPAR- tivtion. Am J Physiol Regul Integr Comp Physiol 99: R59 R67,.. Festui WT, Blnhrd PG, Turotte V, Lplnte M, Srihmetoglu M, Brindley DN, Rihrd D, Deshies Y. The PPAR gonist rosiglitzone enhnes rt rown dipose tissue lipogenesis from gluose without ltering gluose uptke. Am J Physiol Regul Integr Comp Physiol 96: R37 R335, 9.. Festui WT, Guerr-S R, Kwshit NH, Groflo MA, Evngelist EA, Rodrigues V, Kettelhut IC, Migliorini RH. Expression of glyerokinse in rown dipose tissue is stimulted y the symptheti nervous system. Am J Physiol Regul Integr Comp Physiol 8: R536 R5, Festui WT, Lplnte M, Berthiume M, Gelins Y, Deshies Y. PPAR gonism inreses rt dipose tissue lipolysis, expression of glyeride lipses, nd the response of lipolysis to hormonl ontrol. Dietologi 9: 7 36, 6.. Festui WT, Oztezn S, Lplnte M, Berthiume M, Mihel C, Dohgu S, Denis RG, Brito MN, Brito NA, Miller DS, Bnks WA, Brtness TJ, Rihrd D, Deshies Y. Peroxisome prolifertor-tivted reeptor- -medited positive energy lne in the t is ssoited with redued symptheti drive to dipose tissues nd thyroid sttus. Endorinology 9: 3, 8. AJP-Regul Integr Comp Physiol doi:.5/jpregu.99.

9 R85 5. Gry SL, Dll Nor E, Bklund EC, Mnieri M, Virtue S, Nolnd RC, O Rhilly S, Cortright RN, Cinti S, Cnnon B, Vidl-Puig A. Deresed rown dipoyte reruitment nd thermogeni pity in mie with impired peroxisome prolifertor-tivted reeptor (P65L PPAR ) funtion. Endorinology 7: , He W, Brk Y, Hevener A, Olson P, Lio D, Le J, Nelson M, Ong E, Olefsky JM, Evns RM. Adipose-speifi peroxisome prolifertor-tivted reeptor knokout uses insulin resistne in ft nd liver ut not in musle. Pro Ntl Ad Si USA : , Imi T, Tkkuw R, Mrhnd S, Dentz E, Bornert JM, Messddeq N, Wendling O, Mrk M, Desvergne B, Whli W, Chmon P, Metzger D. Peroxisome prolifertor-tivted reeptor is required in mture white nd rown dipoytes for their survivl in the mouse. Pro Ntl Ad Si USA : 53 57,. 8. Kong WM, Stnley S, Grdiner J, Aott C, Murphy K, Seth A, Connoley I, Ghtei M, Stephens D, Bloom S. A role for rute oine nd mphetmine-regulted trnsript in hyperphgi, thermogenesis, nd old dpttion. FASEB J 7: , Mrtinez-deMen R, Hernndez A, Oregon MJ. Triiodothyronine is required for the stimultion of type II 5 -deiodinse mrna in rt rown dipoytes. Am J Physiol Endorinol Met 8: E9 E7,.. Migliorini RH, Groflo MA, Kettelhut IC. Inresed symptheti tivity in rt white dipose tissue during prolonged fsting. Am J Physiol Regul Integr Comp Physiol 7: R656 R66, Nedergrd J, Bengtsson T, Cnnon B. Unexpeted evidene for tive rown dipose tissue in dult humns. Am J Physiol Endorinol Met 93: E E5, 7.. Petrovi N, Shlin IG, Timmons JA, Cnnon B, Nedergrd J. Thermogenilly ompetent nondrenergi reruitment in rown predipoytes y PPAR gonist. Am J Physiol Endorinol Met 95: E87 E96, Puigserver P, Wu Z, Prk CW, Grves R, Wright M, Spiegelmn BM. A old-induile otivtor of nuler reeptors linked to dptive thermogenesis. Cell 9: , Rieiro MO, Bino SD, Kneshige M, Shultz JJ, Cheng SY, Bino AC, Brent GA. Expression of unoupling protein in mouse rown dipose tissue is thyroid hormone reeptor-et isoform speifi nd required for dptive thermogenesis. Endorinology 5: 3,. 5. Sele P, Bjork B, Yng W, Kjimur S, Chin S, Kung S, Sime A, Devrkond S, Conroe HM, Erdjument-Bromge H, Tempst P, Rudniki MA, Beier DR, Spiegelmn BM. PRDM6 ontrols rown ft/skeletl musle swith. Nture 5: , Sell H, Berger JP, Smson P, Cstriot G, Llonde J, Deshies Y, Rihrd D. Peroxisome prolifertor-tivted reeptor gonism inreses the pity for sympthetilly medited thermogenesis in len nd o/o mie. Endorinology 5: ,. 7. Silv JE. Thermogeni mehnisms nd their hormonl regultion. Physiol Rev 86: 35 6, Silv JE, Lrsen PR. Adrenergi tivtion of triiodothyronine prodution in rown dipose tissue. Nture 35: 7 73, Teruel T, Hernndez R, Ril E, Mrtin-Hidlgo A, Lorenzo M. Rosiglitzone up-regultes lipoprotein lipse, hormone-sensitive lipse nd unoupling protein-, nd down-regultes insulin-indued ftty id synthse gene expression in rown dipoytes of Wistr rts. Dietologi 8: 8 88, Thurly PL, Wilson S, Arh JR. Ciglitzone is not itself thermogeni ut inreses the potentil for thermogenesis in len mie. Biosi Rep 7: , vn Mrken Lihtenelt WD, Vnhommerig JW, Smulders NM, Drosserts JM, Kemerink GJ, Bouvy ND, Shruwen P, Teule GJ. Cold-tivted rown dipose tissue in helthy men. N Engl J Med 36: 5 58, Virtnen KA, Lidell ME, Orv J, Heglind M, Westergren R, Niemi T, Tittonen M, Line J, Svisto NJ, Enerk S, Nuutil P. Funtionl rown dipose tissue in helthy dults. N Engl J Med 36: 58 55, Wng L, Liu J, Sh P, Hung J, Chn L, Spiegelmn B, Moore DD. The orphn nuler reeptor SHP regultes PGC- expression nd energy prodution in rown dipoytes. Cell Met : 7 38, Weitzel JM, Rdtke C, Seitz HJ. Two thyroid hormone-medited gene expression ptterns in vivo identified y DNA expression rrys in rt. Nulei Aids Res 9: ,. 35. Wilson-Frith L, Nioloro S, Chouinrd M, Lzr MA, Chui PC, Leszyk J, Struhr J, Czeh MP, Corver S. Mitohondril remodeling in dipose tissue ssoited with oesity nd tretment with rosiglitzone. J Clin Invest : 8 89,. 36. Wu J, Bostrom P, Sprks LM, Ye L, Choi JH, Ging AH, Khndekr M, Virtnen KA, Nuutil P, Shrt G, Hung K, Tu H, vn Mrken Lihtenelt WD, Hoeks J, Enerk S, Shruwen P, Spiegelmn BM. Beige dipoytes re distint type of thermogeni ft ell in mouse nd humn. Cell 5: ,. 37. Zingretti MC, Crost F, Vitli A, Guerrieri M, Frontini A, Cnnon B, Nedergrd J, Cinti S. The presene of UCP demonstrtes tht metolilly tive dipose tissue in the nek of dult humns truly represents rown dipose tissue. FASEB J 3: 33 3, 9. AJP-Regul Integr Comp Physiol doi:.5/jpregu.99.