Garcinia cambogia Extract Ameliorates Visceral Adiposity in C57BL/6J Mice Fed on a High-Fat Diet

Transcription

1 Biosi. Biotehnol. Biohem., 72 (7), , 2008 Grini mogi Extrt Ameliortes Viserl Adiposity in C57BL/6J Mie Fed on High-Ft Diet Keun-Young KIM, Hye Nm LEE, Yun Jung KIM, nd Tesun PARK y Deprtment of Food nd Nutrition, Brin Kore 21 Projet, Yonsei University, Seoul , Kore Reeived Ferury 1, 2008; Aepted Mrh 10, 2008; Online Pulition, July 7, 2008 [doi: /.80072] The im of present study is to evlute the effets of Grini mogi on the mrna levels of the vrious genes involved in dipogenesis, s well s on ody weight gin, viserl ft umultion, nd other iohemil mrkers of oesity in oesity-prone C57BL/6J mie. Consumption of the Grini mogi extrt effetively lowered the ody weight gin, viserl ft umultion, lood nd hepti lipid onentrtions, nd plsm insulin nd leptin levels in high-ft diet (HFD)-indued oesity mouse model. The Grini mogi extrt reversed the HFD-indued hnges in the expression pttern of suh epididyml dipose tissue genes s dipoyte protein P2 (P2), sterol regultory element-inding ftor 1 (SREBP1), peroxisome prolifertor-tivted reeptor 2 (PPAR2), nd CCAT/enhner-inding protein (C/EBP). These findings suggest tht the Grini mogi extrt meliorted HFD-indued oesity, proly y modulting multiple genes ssoited with dipogenesis, suh s P2, SREBP1, PPAR2, nd C/EBP in the viserl ft tissue of mie. Key words: dipogenesis; Grini mogi; gene expression; high-ft diet; mie Oesity, prtiulrly tht used y viserl ft umultion, is serious risk ftor for so-lled lifestyle-relted diseses suh s dietes, oronry hert diseses, hyperlipidemi, hypertension, nd ner. 1) Insulin resistne is onsidered the most ommon underlying normlity in humn oesity nd is influened y geneti nd environmentl ftors, nd prtiulrly y hnges in diet nd physil tivity. 2) High-ft-fed rodents pper to e the est model for the viserl oesity syndrome 3) euse of the similr pthogenesis of oesity to tht found in humns. 4) The reent nd rpid inrese in oesity in developed ountries points to the importnt intertion etween the series of genes tht predispose to oesity nd n environment tht filittes the expression of the oese phenotype, nother trit shred with high-ft-diet (HFD)-indued rodent oesity models. 5) Preventive or therpeuti strtegies to ontrol most of humn oesity should trget these normlities. 6) Due to the dverse side effets ssoited with mny of the nti-oesity drugs, more reent drug trils hve foused on sreening the herl mediines tht hve een reported to tret oesity nd tht generlly hve miniml side effets. 7) Anti-oesity foods nd food ingredients my vert the ondition, possily leding to the prevention of lifestyle-relted diseses, if they re effetive in reduing the viserl ft mss. 8) Trditionl herl mediines suh s Pnx ginseng erry extrt, 9) Zingier offiinle Rosoe, 10) nd Pltyodi rdix 11) hve een reported to e effetive in mnging oesity in HFD-fed mie nd rts, while suh nturl produts s Ephedr sini, Trxum offiinle (dndelion), nd Rhmnus purshin (sr) hve een speifilly studied for weight loss in humns. 12) Grini mogi, n edile fruit ntive to Southestern Asi, exhiits distintive sweet nd sour tste, nd hs een used for enturies in Asin ountries for prepring ulinry dishes. 13,14) A Grini mogi extrt hs een ville s n nti-oesity herl supplement round the world for dedes, lthough some mild dverse events suh s hedhe, nd upper respirtory trt nd gstrointestinl symptoms hve een reported in overweight sujets. 15) Hydroxy itri id (HCA), the prinipl id in the fruits of Grini mogi, is ompetitive inhiitor of ATP-itrte lyse (EC ), the enzyme responsile for ftty id, holesterol, nd triglyeride iosynthesis. 16,17) The inhiitory tion of HCA redues the etyl-coa pool, thus limiting the vilility of the two ron units required for the initil steps of ftty id nd holesterol iosynthesis. 13,16) Although the weight loss effets of Grini mogi hve een doumented, 14,15,18) omprehensive study exmining its ility to omt y To whom orrespondene should e ddressed. Tel: ; Fx: ; E-mil: tsprk@yonsei..kr Arevitions: P2, dipoyte P2; C/EBP, CCAAT/enhner-inding protein ; GLUT4, gluose trnsporter 4; HCA, hydroxyl itri id; HFD, high-ft diet; HFD+G, Grini mogi extrt-supplemented diet; ND, norml diet; PPAR2, peroxisome prolifertors-tivted reeptor 2; SREBP1, sterol regultory element-inding protein 1; TNF, tumor nerosis ftor

2 viserl diposity in n HFD-indued oesity model is lking. Espeilly, the intertion etween oesityrelted genes nd onsumption of the Grini mogi extrt needs to e onfirmed in niml models of diet-indued oesity. The present work ws therefore undertken to study the effets of Grini mogi on the expression of multiple genes ssoited with dipogenesis s well s other viserl oesity-relted iomrkers in n HFDindued oesity mouse model. The fous of this study is on the moleulr effets of Grini mogi on the mrna expression of dipoyte protein P2 (P2), sterol regultory element-inding ftor 1 (SREBP1), peroxisome prolifertor-tivted reeptor 2 (PPAR2), nd CCAT/enhner-inding protein (C/EBP) in the epididyml dipose tissue of diet-indued oesity mouse model. Mterils nd Methods Animls nd diets. Thirty-six 7-wk-old mle C57BL/ 6J mie (Jung-Ang L Animl, Seoul, Kore) were individully housed in stndrd ges nd pled in room where the temperture ws kept t 21 2:0 C, the reltive humidity t 50 5%, nd the light on 12-h light/drk yle. All the mie onsumed ommeril diet nd tp wter d liitum for 1 wk prior to their division into three weight-mthed groups: the norml diet (ND) group, HFD group, nd Grini mogi extrt-supplemented diet (HFD+G) group. ND ws purified diet sed on the AIN-76 rodent diet omposition. HFD ws identil to ND exept tht 200 g of ft/ kg (170 g of lrd plus 30 g of orn oil) nd 1% (w/w) holesterol were dded. HFD ws formulted to provide 39% of the totl energy generted y the diet from ft y repling rohydrte energy with lrd nd orn oil, nd hd the sme mount of vitmins nd minerls per kilojoule s ND did. HFD+G ws identil to HFD nd ontined 1 % Grini mogi extrt omposed of the nturl nd highly wter-solule potssium nd lium slt of 60% hydroxyitri id (Super Citrimx Ò, HCA-600-SXS, Lot no supplied y InterHelth Nutreutils, Benii, CA, USA.) (Tle 1). The diets were given in the form of pellets for 12 wk. The mie s food intke ws reorded dily, nd their ody weights were monitored every three dys, from 10:00.m. to 11:00.m., during the feeding period. At the end of the experimentl period, the nimls were nesthetized with ether, following 12-h period of fsting. Blood ws drwn from the inferior ven v into heprin-oted tue, nd the plsm ws otined y entrifuging the lood t 1;000 g for 15 min t 4 C. The livers nd viserl ft pds were removed, rinsed with phosphte-uffered sline, nd then weighed. The plsm, liver nd viserl ft pd smples were stored t 70 C until they were nlyzed. This study dhered to the Guide for the Cre nd Use of Lortory Anti-Oesity Effet of Grini mogi Extrt 1773 Tle 1. Composition of the Experimentl Diets Ingredient (g/kg diet) Csein DL-Methionine Corn strh Surose Cellulose Corn oil Lrd Vitmin mix 1Þ Minerl mix 2Þ Choline itrtrte Cholesterol tert-butylhydroquinone 3Þ Grini mogi extrt 4Þ 10 Totl (g) 1,000 1,000 1,000 Ft (% Clorie) Totl energy, kj/kg of diet 16,439 19,315 19,315 1Þ AIN-76 vitmin mixture (g/kg of mix): thimin. HCl, 0.6; rioflvin, 0.6; niotinmide, 25; pyridoxine. HCl, 0.7; niotini id, 3; D-lium pntothente, 1.6; foli id, 0.2; D-iotin, 0.02; ynoolmin (vitmin B 12 ), 0.001; retinyl plmitte (250,000 IU/gm), 1.6; DL--toopherol ette (250 IU/gm), 20; holeliferol (Vitmin D 3 ), 0.25; menquinone (Vitmin K 2 ), 0.05; finely powdered surose, Þ AIN-76 minerl mixture (g/kg of mix): CHPO 4, 500; NCl, 74; K 2 H 6 O 7 H 2 O, 220; K 2 SO 4, 52; MgO, 24; MnCO 3, 3.57; Fe (C 6 H 5 O 7 ). 6H 2 O, 6; ZnCO 3, 1.6; CuCO 3, 0.3; KIO 3, 0.01; N 2 SeO 3. 5H2 O, 0.01; CrK (SO 4 ) 2, 0.55; finely powdered surose, Þ Antioxidtive gent, 0.01 g/ 50 g of lipids. 4Þ Grini mogi extrt ontined 60% hydroxyl itri id. Animls developed y the Institute of Lortory Animl Resoures of the Ntionl Reserh Counil, nd pproved y the Institutionl Animl Cre nd Use Committee of Yonsei University in Seoul, South Kore. Histology nd men dipoyte surfe re. Tissue smples of the epididyml ft pds were fixed with 4% uffered formlin nd emedded in prffin. Stndrd setions of 5 mm were ut nd stined with hemtoxylin nd eosin, viewed with n optil mirosope (Vnox-S, Olympus Optil, Tokyo, Jpn), nd photogrphed t finl mgnifition of 200. The verge size of dipoytes ws mesured y using imge nlysis softwre (Imge-Pro Plus 4.5, Medi Cyernetis, Silver Spring, MD, USA). Biohemil nlysis. The plsm onentrtions of totl holesterol nd triglyeride were determined enzymtilly y using ommeril kits (BioClinil System, Gyeonggi-do, Kore). Hepti lipids were extrted s desried, 19) nd the dried lipid residues were dissolved in 1 ml of ethnol. The onentrtions of holesterol nd triglyeride in the hepti lipid extrts were determined y using n utomti nlyzer (Express Plus, Chiron Dignostis, Est Wlpole, MA, USA) with regents (Byer, Trrytown, NY, USA). The plsm insulin, leptin, nd diponetin levels were mesured y rdioimmunossy (Lino Reserh,

3 1774 K.-Y. KIM et l. Aession No. Tle 2. Primer Sequenes nd PCR Conditions Gene desription Primer Sequene (5 0!3 0 ) PCR produt (p) Anneling temperture ( C) NM Adipoyte protein P2 F CACCATCCGGTCAGAGAGTA (P2) R TGATGCTCTTCACCTTCCTG NM Sterol regultory F TTGTGGAGCTCAAAGACCTG element-inding ftor R TGCAAGAAGCGGATGTAGTC 1 (SREBP1) NM Peroxisome prolifertor- F ACCACAGTTGATTTCTCCAG tivted reeptor R TGTTGTAGAGCTGGGTCTTT gmm (PPAR2) NM CCAAT/enhner- F GAGGGACTGGAGTTATGACA inding protein, lph R GTGAAGAGTCTCAGTTTGGC (C/EBP) NM Tumor nerosis ftor F TGTCTCAGCCTCTTCTCATT lph (TNF) R AGATGATCTGAGTGTGAGGG Chrles, MO, USA). The plsm gluose onentrtion ws mesured enzymtilly y using ommeril kit (BioClinil System). Rel-time RT-PCR nlysis. Totl RNA ws isolted from the epididyml ft tissues of eh mouse y using Trizol (Invitrogen, Crlsd, CA, USA) nd ws reverse-trnsried using the Supersript II kit (Invitrogen) ording to the mnufturer s reommendtions. The GenBnk ession numers of the relevnt templtes nd the forwrd (F) nd reverse (R) primer sequenes re shown in Tle 2. Primers were lso designed to mplify the 530-p DNA frgment enoding -tin (sense: 5 0 -ACCTTCAACACCCCAGCCA- TGTACG-3 0 ; nti-sense: 5 0 -CTGATCCACATCTGC- TGGAAGGTGG-3 0 ) s n internl ontrol. Rel-time PCR retions were then rried out in 20-ml retion mixture (2 ml of DNA, 16 ml of SYBR green PCR mster mix, whih inluded 2 ml of 1LightCyler, 2.4 ml of 1.5 mmol/l MgCl 2 nd 11.6 ml ofh 2 O, nd 1 ml of 0.5 mmol/l of speifi gene primer pir) in LightCyler instrument (Rohe Dignostis, Indinpolis, IN, USA). The PCR progrm ws initited y 10 min t 95 C, efore 40 therml yles, eh of 10 s t 95 C, 5 s t 55 C, nd 30 s t 70 C. The dt otined were nlyzed y using the omprtive yle threshold method, nd were normlized y the -tin expression vlue. Melting urves for eh PCR retion were generted to ensure the purity of the mplifition produt. Sttistil nlysis. All the results otined re expressed s the men SEM of 12 mie in eh group. Sttistil evlution ws done y using one-wy ANOVA nd followed y Dunn s multiple-rnge test. The level of signifine ws set t p < 0:05 for ll sttistil tests. Results Body weight nd viserl ft-pd weights The ody weights in the ND, HFD, nd HFD+G groups egn to diverge from d 24 nd styed different for the reminder of the experimentl period (p < 0:05) (Fig. 1). The finl ody weight nd 12-wk ody weight gin of mie in the HFD group were 43% nd 202% greter, respetively, thn the equivlent vlues for the ND mie. Dietry supplementtion with the Grini mogi extrt signifintly redued the finl ody weight (22% lower) nd ody weight gin (46% lower) of the mie onsuming HFD. The food intke nd food effiieny rtio (FER) of mie in the HFD+G group were signifintly lower thn the vlues for the HFD group (p < 0:05) (Tle 3). The reltive weights of the totl viserl ft depots were signifintly higher y feeding HFD thn the vlue for the ND mie (137% greter, p < 0:05) nd were signifintly lower y supplementing HFD with the Grini mogi extrt (39% lower, p < 0:05). The epididyml, perirenl, retroperitonel, nd mesenteri ft-pd weights were redued y 37%, 48%, 36%, nd 42%, respetively, in the mie fed HFD+G thn in the HFD mie (p < 0:05) (Fig. 2). The dipoytes from the epididyml ft-pd of the mie fed HFD+G were 34% smller thn those of the nimls fed HFD (Fig. 3). Plsm nd hepti iohemistry The HFD-indued hyperholesterolemi ws signifintly improved y dietry supplementtion with the Grini mogi extrt. The plsm totl holesterol nd triglyeride onentrtions were 24% nd 25%

4 Body weight (g) Anti-Oesity Effet of Grini mogi Extrt 1775 Fig Dys Body Weight of Mie Fed on the Experimentl Diets for 12 Weeks. Eh vlue is the men SEM (n ¼ 12).,, Mens not shring ommon supersript re signifintly different (p < 0:05). Tle 3. Body Weight Gin, nd Plsm nd Hepti Biohemisty of Mie Fed on the Experimentl Diets for 12 Weeks Group Initil ody weight (g) 22:6 0:21 22:3 0:17 22:0 0:20 Finl ody weight (g) 29:0 0:51 41:5 0:91 32:4 0:61 Body weight gin (g/12 weeks) 6:35 0:50 19:2 1:55 10:4 0:77 Food intke (g/d) 2:29 0:01 2:58 0:01 2:37 0:03 FER 1Þ 0:03 0:002 0:09 0:004 0:05 0:003 Plsm Totl holesterol (mmol/l) 2:83 0:11 4:96 0:17 3:76 0:18 Triglyeride (mmol/l) 0:50 0:01 0:56 0:02 0:42 0:03 Gluose (mmol/l) 9:94 0:62 11:8 0:53 10:4 0:65 Insulin (pmol/l) 35:3 6:4 68:3 10:2 39:0 7:1 Leptin (ng/ml) 6:58 0:86 22:2 1:15 10:7 0:59 Adiponetin (mg/ml) 7:15 0:78 6:54 0:70 6:50 1:41 Liver Liver weight (mg/g of ody weight) 34:5 0:8 61:9 2:5 50:7 2:3 Triglyeride (mmol/g of liver) 28:6 3:30 43:5 2:49 37:1 1:51 Cholesterol (mmol/g of liver) 10:8 0:64 23:9 1:06 20:5 1:10 Eh vlue is the men SEM (n ¼ 12).,, Mens in row with supersripts without ommon letter differ, p < 0:05. 1Þ Body weight gin during experimentl period (g/d) Food effiieny rtio (FER) ¼ Food intke during experimentl period (g/d) lower, respetively, in the mie fed with HFD+G thn those for the HFD-fed mie (p < 0:05). The enlrgement of the liver nd the umultions of triglyeride nd holesterol in the liver of the mie fed HFD were meliorted y dietry supplementtion with the Grini mogi extrt ( 18% redution in the liver weight, p < 0:05; 14 15% redutions in the hepti triglyeride nd holesterol levels, p < 0:05). The elevted levels of plsm insulin nd leptin whih hd een used y feeding HFD were redued y 43% nd 52%, respetively, y dietry supplementtion with the Grini mogi extrt (p < 0:05). The plsm gluose nd diponetin levels were not ffeted y the experimentl diets (Tle 3). Expression levels of dipogenesis-relted genes Results from the rel-time RT-PCR nlyses of totl RNA prepred from the epididyml dipose tissue of mie indite tht HFD signifintly down-regulted the expression of the SREBP1, C/EBP, nd PPAR2 genes, wheres it signifintly up-regulted the TNF gene. The P2 gene expression tended to e deresed in the mie fed with HFD thn in the ND nimls, ut without showing sttistil signifine. These HFDindued hnges in the expression pttern of the edipidyml dipose tissue genes implited in dipogenesis were reversed y feeding the Grini mogi extrt. Signifint up-regultion of the P2 (120% inrese, p < 0:05), SREBP1 (12% inrese, p < 0:05),

5 1776 K.-Y. KIM et l. Ft pd weight (mg/g ody weight) Retroperitonel Epididyml Mesenteri Perirenl Totl Fig. 2. Viserl Ft Pd Weights of Mie Fed on the Experimentl Diets for 12 Weeks. Eh vlue is the men SEM (n ¼ 12).,, Mens not shring ommon supersript re signifintly different (p < 0:05). A B Men dipoyte surfe re (µm 2 ) Fig. 3. Histology of Epididyml Adipose Tissue nd Men Adipoyte Surfe Are of Mie Fed on the Experimentl Diets for 12 Weeks. A, Representtive photomirogrphs of the epididyml dipose tissue. All setions were stined with hemtoxylin nd eosin; mgnifition, 200. Mgnifition r = 50 mm. B, Epididyml men dipoyte surfe re. Eh vlue is the men SEM (n ¼ 12).,, Mens not shring ommon supersript re signifintly different (p < 0:05). C/EBP (174% inrese, p < 0:05), nd PPAR2 (70% inrese, p < 0:05) genes, in onjuntion with signifint down-regultion of the TNF gene (20% redution, p < 0:05) were oserved in the epididyml dipose tissue of mie fed with HFD+G ompred to those oserved in the HFD mie (p < 0:05) (Fig. 4). Disussion HCA, n tive ingredient of the Grini mogi extrt, redues food onsumption in humns nd in rodent models of oesity y possily diverting rohydrtes nd ftty ids tht would hve eome ft in the

6 Anti-Oesity Effet of Grini mogi Extrt Fold hnge P2 SREBP1 C/EBPα PPARγ 2 TNFα Fig. 4. Fold Chnges in Gene Expression s Determined y the Rel-Time PCR Anlyses in the Epididyml Ft Tissues of Mie Fed on the Experimentl Diets for 12 Weeks. Eh vlue is shown s the men SEM of triplite nlyses of RNA smples pooled from 12 mie. Results were normlized to -tin mrna expression. The mrna levels of mie fed with HFD or HFD+G re expressed s the fold hnges ompred with the ND mie.,, Mens not shring ommon supersript re signifintly different (p < 0:05). liver into hepti glyogen. 13,14,17,18) This metoli hnge my send signl to the rin tht results in redued ppetite. 16) In the present study, suppressed food intke does not pper to e the only use of weight loss in the mie fed with the Grini mogi extrt, sine, in ddition to the food intke, FER ws lso signifintly lower in this group thn in the HFD mie, whih implies tht the mie dministered the Grini mogi extrt were less effiient in trnsforming the nutrients fed into their own iomss. HCA resulted in signifint inrese in the serum serotonin level, onomitnt with redued ppetite, weight loss, fvorle lipid profile, nd redution in the plsm leptin level in humn linil trils. 20) The rin serotonin level hs lso een inresed y HCA in oese Zuker rts. 21) It therefore ppers tht the ility of the Grini mogi extrt to redue ody weight gin ould hve een due to its omined effets on the metoli nd serotonin pthwys. 21) The plsm nd hepti onentrtions of holesterol nd triglyeride were signifintly lower in nimls tht were given the Grini mogi extrt thn in the HFD ontrol mie. These results were expeted euse HCA is known to inhiit the lipogenesis tlyzed y ATP itrte-lyse in the liver nd peripherl tissues, s reported previously. 22) It is well known tht HCA prevents the prodution of etyl-coa nd, susequently, mlonyl-coa. 23) The results of the present study lerly show tht the Grini mogi extrt meliorted HFD-indued hyperinsulinemi. In ddition, Grini mogi, in previous report y other investigtors, restored the impired gluose tolerne in oese Zuker rts. 24) Tken together, these results suggest tht the Grini mogi extrt might hve enefiil role in improving the insulin resistne indued y HFD, lthough the mehnism for this needs to e lrified. Leptin is ft-derived key regultor of ppetite nd energy expenditure, nd is exlusively sereted y dipoytes in proportion to their triglyeride stores. 25) Therey, the irulting leptin level is orrelted with the extent of oesity. 26) In the present study, the Grini mogi extrt deresed not only the leptin onentrtion ut lso the sizes of dipoytes, inditing tht it deresed lipid umultion in the viserl dipoytes of rts rendered oese y HFD. Adiponetin is lso sereted y ft ells nd hs nti-therosleroti nd insulin-sensitizing properties tht suppress the hepti gluose prodution nd enhne the gluose uptke into the skeletl musles. 27) In the urrent study, feeding HFD to mie did not led to ny signifint derese in the plsm diponetin level. The inverse ssoition of ody weight nd the serum diponetin level hs not een oserved onsistently in rodent models, 27) lthough Brne, M., et l. 28) hve reently reported tht the irulting diponetin level of mie fed HFD remined reltively onstnt nd ws highly regulted y mehnisms tht hs yet to e investigted. To mintin lipid homeostsis, dipoytes rry out two reiprol iohemil proesses: lipogenesis nd lipolysis. These two proesses re tightly ontrolled y severl hormones, lipid metolites, nd nutritionl onditions suh s feeding nd fsting. With these signls, lipogeni trnsription ftors, inluding SREBP1, liver X reeptors, PPAR, nd C/EBP, tively prtiipte in the lipid metolism of dipoytes. 29) These trnsription ftors re highly expressed in the dipose tissue nd ply key role in dipoyte

7 1778 K.-Y. KIM et l. differentition y oordinting lipogeni nd dipoytespeifi gene expression. 30) PPAR, one of the first identified nuler reeptors whih ind mny ftty ids s lignds, interts with severl other trnsription ftors. 31) C/EBP nd PPAR re initilly expressed t low levels, nd re then le to indue eh other s expression vi positive feedk loop in the differentited dipoytes. 32) Another trnsription ftor tht PPAR interts with is SREBP1. Co-expression of this trnsription ftor with PPAR inreses the trnsriptionl tivity of PPAR. Sine SREBP1 is le to inrese the expression of severl genes involved in ftty id metolism, it hs een suggested tht SREBP1 indues the prodution of n endogenous lignd tht enhnes the trnsriptionl tivity of PPAR. 33) Severl genes speilizing in lipid metolism nd storge re indued in the dipogeni differentition proess, mny of whih ontin funtionl PPAR-response elements. P2, whih is mrker of terminl dipoyte differentition nd involved in free ftty id trnsporttion nd shunting within the ell, is one suh gene, 34) together with luster of other dipoyte-speifi genes suh s diponetin, insulin reeptor, leptin, gluose trnsporter 4 (GLUT4) nd glyerol phosphte dehydrogense. 30) In the present study, the P2, SREBP1, C/EBP, nd PPAR2 mrna levels were not inresed, ut rther deresed in the viserl dipose tissue of HFD-indued oese mie. This is in greement with the previous reports, showing tht the ftty id synthse, etyl-coa roxylse 1, nd SREBP1 mrna onentrtions were deresed in the dipose tissue of oese humn sujets 35) nd of the oese niml models. 36) The HFD-indued down-regultion of the PPAR2 nd C/EBP genes supports the response seen fter the tretment of 3T3-L1 dipose ells with TNF. 37) These ould e explined s n dptive response of the viserl dipose tissue imed t limiting further expnsion of ft storge in the dipose tissue. From proteomi pproh, Shmid, G. M., et l. 38) hve oserved tht the proteins involved in oxidtive phosphoryltion were over-expressed in the rown dipose tissue of rts y feeding HFD. Therefore, the dptive response of nimls to HFD does not pper to e limited to the viserl fts, ut expnded into the rown dipose tissue for the purpose of inresing energy expenditure to ompenste for the weight gin. TNF is involved in pro-inflmmtion, poptosis, lipid metolism, nd insulin resistne. 39) Both the mrna nd protein expression of TNF re inresed in the dipose tissue from oese rodents nd humns, 40) nd high level of TNF suppresses suh trnsription ftors s PPAR nd C/EBP whih, in turn, tivtes the GLUT4 gene. 41,42) The ddition of TNF to suh dipoytes s 3T3-L1 nd TA1 uses down-regultion of enzymes involved in lipid metolism nd of suh dipoyte speifi genes s P2 nd ft-speifi protein ,44) Xing H., et l. 42) hve oserved tht TNF prevented the mrna expression of PPAR nd orresponding proteins from inresing in the dipogeni ells (3T3-L1 ells). The expression levels of PPAR2 nd C/EBP in the epididyml dipose tissue showed signifintly more up-regultion (70 174% inreses) in the nimls fed with HFD supplemented with the Grini mogi extrt thn in the mie fed with HFD lone in the present study. These remrkle hnges in the mrna expression of PPAR2 nd C/EBP indued y the Grini mogi extrt supplemented to HFD were lso ssoited with notiele regultion of the P2 gene ( 120% inrese), one of the trget genes of PPAR. These results re in greement with the previous oservtion y other investigtors tht the inhiitory effet of the Grini mogi extrt ginst the insulin-indued differentition of 3T3-L1 ells trgeted the dipogeni trnsription ftor, C/ EBP. 45) Furthermore, the result tht the expression of the TNF gene, whih ws up-regulted y HFD, ws down-regulted gin y the Grini mogi extrt supplemented to HFD orresponds well with the dietindued hnges in the expression of suh other genes s PPAR2, C/EBP, nd SREBP1. Therefore, the Grini mogi extrt ppers to hve modulted the expression of ritil nuler trnsription ftor tht n trigger the entire proess of dipoyte differentition. It ould e speulted from the gene expression dt, together with the relevnt iohemil results for mie, tht the lood levels of insulin nd leptin, nd the viserl ft-pd weights might hve inverse reltionships with the expression levels of PPAR2, C/EBP, SREBP1, nd P2, nd tht they might e positively relted with the TNF expression level in their viserl dipose tissues. In onlusion, the Grini mogi extrt ws effetive in reduing the ody weight gin, nd in improving ftty liver, dyslipidemi, hyperinsulinemi, nd hyperleptinemi in mie rendered oese y HFD. We report here for the first time tht these nti-oesity effets of the Grini mogi extrt were ssoited with modultion of the multiple genes ssoited with viserl dipogenesis suh s PPAR2, SREBP1, C/EBP, nd P2 in the viserl ft tissue of mie. Aknowledgments This study ws supported y the Projet for Bio-food Reserh from the Kore Siene nd Engineering Foundtion (KOSEF) under the Ministry of Siene nd Tehnology in Kore, nd y the Brin Kore 21 Projet of Yonsei University. Referenes 1) Nkmur, T., Tokung, K., Shimomur, I., Nishid, M., Yoshid, S., Kotni, K., Islm, A. H. M. W., Keno, Y., Kotke, T., Ngi, Y., Fujiok, S., Trui, S., nd

8 Mtuzw, Y., Contriution of viserl ft umultion to the development of oronry rtery disese in nonoese men. Atheroslerosis, 107, (1994). 2) Uuy, R., nd Dis, E., Consequenes of food energy exess nd positive energy lne. Puli Helth Nutr., 8, (2005). 3) Hnsen, P. A., Hn, D. H., Nolte, L. A., Chen, M., nd Holloszy, J. O., DHEA protets ginst viserl oesity nd musle insulin resistne in rts fed high-ft diet. Am. J. Physiol., 273, (1997). 4) Ktgiri, K., Arkw, S., Kurhshi, R., nd Htno, Y., Impired ontt hypersensitivity in diet-indued oese mie. Dermtol. Si., 46, (2007). 5) Levin, B. E., Trisri, J., nd Sullivn, A. C., Metoli fetures of diet-indued oesity without hyperphgi in young rts. Am. J. Physiol. Regul. Integr. Comp. Physiol., 251, (1986). 6) Velsquez, M. T., nd Bhthen, S. J., Role of dietry soy protein in oesity. Int. J. Med. Si., 26, (2007). 7) Kishino, E., Ito, T., Fujit, K., nd Kiuhi, Y., A mixture of the Sli retiult (Kotl himutu) queous extrt nd ylodextrin redues the umultion of viserl ft mss in mie nd rts with high-ft dietindued oesity. J. Nutr., 136, (2006). 8) Sito, M., Ueno, M., Ogino, S., Kuo, K., Ngt, J., nd Tkeuhi, M., High dose of Grini mogi is effetive in suppressing ft umultion in developing mle Zuker oese rts, ut highly toxi to the testis. Food Chem. Toxiol., 43, (2005). 9) Attele, A. S., Zhou, Y. P., Xie, J. T., Wu, J. A., Zhng, L., Dey, L., Pugh, W., Rue, P. A., Polonsky, K. S., nd Yun, C. S., Anti-dieti effets of Pnx ginseng erry extrt nd the identifition of n effetive omponent. Dietes, 51, (2002). 10) Hn, L. K., Gong, X. J., Kwno, S., Sito, M., Kimur, Y., nd Okud, H., Antioesity tions of Zingier offiinle Rosoe. Ykugku Zsshi, 125, (2005). 11) Hn, L. K., Xu, B. J., Kimur, Y., Zheng, Y., nd Okud, H., Pltyodi rdix ffets lipid metolism in mie with high-ft diet-indued oesity. J. Nutr., 130, (2000). 12) Bnk, M. S., Physiins Desk Referene for Herl Mediines, Medil Eonomis Compny, New Jersey (2000). 13) Sullivn, A. C., nd Trisri, J., Metoli regultion s ontrol for lipid disorders. I. Influene of ( )- hydroxyitrte on experimentlly indued oesity in the rodent. Am. J. Clin. Nutr., 30, (1977). 14) Ohi, S. E., Opere, C. A., LeDy, A. M., Bghi, M., Bghi, D., nd Stohs, S. J., Sfety nd mehnism of ppetite suppression y novel hydroxyitri id extrt (HCA-SX). Mol. Cell. Biohem., 238, (2002). 15) Heymsfield, S. B., Allison, D. B., Vsselli, J. R., Pietroelli, A., Greenfield, D., nd Nunez, C., Grini mogi (hydroxyitri id) s potentil ntioesity gent: rndomized ontrolled tril. JAMA, 280, (1998). 16) Sullivn, A. C., Trisri, J., Hmilton, J. G., Miller, O. N., nd Whetley, V. R., Effet of ( )-hydroxyitrte upon the umultion of lipid in the rt. I. Lipogenesis. Anti-Oesity Effet of Grini mogi Extrt 1779 Lipids, 9, (1974). 17) Sullivn, A. C., Trisri, J., Hmilton, J. G., nd Miller, O. N., Effet of ( )-hydroxyitrte upon the umultion of lipid in the rt. II. Appetite. Lipids, 9, (1973). 18) Leonhrdt, M., nd Lnghns, W., Hydroxyitrte hs long-term effets on feeding ehvior, ody weight regin nd metolism fter ody weight loss in mle rts. J. Nutr., 132, (2002). 19) Folh, J., Lees, M., nd Slone-Stnley, G. H., A simple method for the isoltion nd purifition of totl lipids from niml tissues. J. Biol. Chem., 226, (1957). 20) Preuss, H. G., Bghi, D., Bghi, M., Ro, C. V. S., Dey, D. K., nd Stynryn, S., Effets of nturl extrt of ( )-hydroxyitri id (HCA-SX) nd omintion of HCA-SX plus niine-ound hromium nd Gymnem sylvestre extrt in weight loss. Dietes Oes. Met., 24, (2004). 21) Asghr, M., Zeyssig, R., Monjok, E., Koumou, G., Ohi, S. E., Lokhndwl, M. F., nd Bghi, D., Hydroxyitri id (HCA-SX) dereses oxidtive stress nd insulin resistne nd inreses rin serotonin levels in oese Zuker rts. Exp. Biol. Meet., 20, 655 (2006). 22) Sullivn, A. C., Singh, M., Srere, P. A., nd Glusker, J. P., Retivity nd inhiitor potentil of hydroxyitrte isomers with itrte synthse, itrte lyse, nd ATP itrte lyse. J. Biol. Chem., 252, (1977). 23) Sh, A. K., Vvvs, D., Kurowshi, T. G., Apnidis, A., Witters, L. A., Shfrir, E., nd Rudermn, N. B., Mlonyl-CoA regultion in skeletl musles, its link to ell itrte nd the gluose-ftty id yle. Am. J. Physiol., 272, (1997). 24) Asghr, M., Monjok, E., Koumou, G., Ohi, S. E., Bghi, D., nd Lokhndwl, M. F., Super CitriMx (HCA-SX) ttenutes inreses in oxidtive stress, inflmmtion, insulin resistne, nd ody weight in developing oese Zuker rts. Mol. Cell. Biohem., 304, (2007). 25) Stiger, H., Tshritter, O., Mhnn, J., Thmer, C., Fritshe, A., Merker, E., Shik, F., Hring, H. U., nd Stumvoll, M., Reltionship of serum diponetin nd leptin onentrtions with ody ft distriution in humns. Oes. Res., 11, (2003). 26) Mffei, M., Hls, J., Rvussin, E., Prtley, R. E., Lee, G. H., Zhng, Y., Fei, H., Kim, S., Lllone, R., nd Rngnthn, S., Leptin levels in humn nd rodent: mesurement of plsm leptin nd o RNA in oese nd weight-redued sujets. Nt. Med., 1, (1995). 27) Nderli, E. K., Estdell, D., nd Roh, M., A ftenrihed, gluose-enrihed diet mrkedly ttenutes diponetin mrna levels in rt epididyml dipose tissue. Clin. Si. (Lond), 105, (2003). 28) Brne, M., Shmy, A., Strk, A. H., nd Mdr, Z., A high-ft diet hs tissue-speifi effet on diponetin nd relted enzyme expression. Oesity, 14, (2006). 29) Prk, J., Rho, H. K., Kim, K. H., Choe, S. S., Lee, Y. S., nd Kim, J. B., Overexpression of gluose-6-phosphte dehydrogense is ssoited with lipid dysregultion nd insulin resistne in oesity. Mol. Cell. Biol., 25, 5146

9 1780 K.-Y. KIM et l (2005). 30) Rosen, E. D., Wlkey, C. J., Puigserver, P., nd Spiegelmn, B. M., Trnsriptionl regultion of dipogenesis. Genes Dev., 14, (2000). 31) Xu, H. E., Lmert, M. H., Montn, V. G., Prks, D. J., Blnhrd, S. G., Brown, P. J., Sternh, D. D., Lehmnn, J. M., Wisely, G. B., Willson, T. M., Kliewer, S. A., nd Milurn, M. V., Moleulr reognition of ftty ids y peroxisome prolifertor-tivted reeptors. Mol. Cell, 3, (1999). 32) Rosen, E. D., Hsu, C. H., Wng, X., Ski, S., Freemn, M. W., Gonzlez, F. J., nd Spiegelmn, B. M., C/EBP indues dipogenesis through PPAR: unified pthwy. Genes Dev., 16, (2002). 33) Kim, J. B., Wright, H. M., Wright, M., nd Spiegelmn, B. M., ADD1/SREBP1 tivtes PPAR through the prodution of endogenous lignd. Pro. Ntl. Ad. Si. USA, 95, (1998). 34) Tontonoz, P., Hu, E., Grves, R. A., Budvri, A. I., nd Spiegelmn, B. M., mppar gmm 2: tissue-speifi regultor of n dipoyte enhner. Genes Dev., 8, (1994). 35) Dirison, F., Dusserre, E., Vidl, H., Sothier, M., nd Beylot, M., Inresed hepti lipogenesis ut deresed expression of lipogeni gene in dipose tissue in humn oesity. Am. J. Physiol., 282, (2002). 36) Ndler, S., Stoehr, J., Shueler, K., Tnimoto, G., Yndell, B., nd Attie, A., The expression of dipogeni genes is deresed in oesity nd dietes mellitus. Pro. Ntl. Ad. Si. USA, 97, (2000). 37) Ron, D., Brsier, A. R., MGehee, R. E. Jr., nd Hener, J. F., Tumor nerosis ftor-indued reversl of dipoyti phenotype of 3T3-L1 ells is preeded y loss of nuler CCAAT/enhner inding protein (C/EBP). J. Clin. Invest., 89, (1992). 38) Shmid, G. M., Converset, V., nd Wlter, N., Effet of high-ft diet on the expression of proteins in musle, dipose tissues, nd liver of C57BL/6 mie. Proteomis, 4, (2004). 39) Hmmrstedt, A., Andersson, C. X., Rotter-Sopskis, V., nd Smith, U., The effet of PPAR lignds on the dipose tissue in insulin resistne. Prostglndins Leukot. Essent. Ftty Aids, 73, (2005). 40) Hotmisligil, G. S., Shrgill, N. S., nd Spiegelmn, B. M., Adipose expression of tumor nerosis ftorlph: diret role in oesity-linked insulin resistne. Siene, 259, (1993). 41) Stephens, J. M., nd Pekl, P. H., Trnsriptionl repression of the C/EBP nd GLUT4 genes in 3T3-L1 dipoytes y tumor nerosis ftor-lph. Regultions is oordinte nd independent of protein synthesis. J. Biol. Chem., 267, (1992). 42) Xing, H., Northrop, J. P., Grove, J. R., Kilptrik, K. E., Su, J. L., nd Ringold, G. M., TNF-medited inhiition nd reversl of dipoyte differentition is ompnied y suppressed expression of PPAR without effets on Pref-1 expression. Endorinology, 138, (1997). 43) Chpmn, A. B., Knight, D. M., Diekmn, B. S., nd Ringold, G. M., Anlysis of gene expression during differentition of dipogeni ells in ulture nd hormonl ontrol of the developmentl progrm. J. Biol. Chem., 259, (1984). 44) Torti, F. M., Torti, S. V., Lrrik, J. W., nd Ringold, G. M., Modultion of dipoyte differentition y tumor nerosis ftor nd trnsforming growth ftor et. J. Cell Biol., 108, (1989). 45) Kim, M. S., Kim, J. K., Kwon, D. Y., nd Prk, R., Antidipogeni effets of Grini extrt on the lipid droplet umultion nd the expression of trnsription ftor. BioFtors, 22, (2004).