British Journal of Nutrition
|
|
- Lora Ball
- 6 years ago
- Views:
Transcription
1 British Journl of Nutrition (2014), 111, q The Authors 2013 doi: /s PUFA rtio is involved in regulting lipid metolism nd inflmmtion in pigs Yehui Dun 1,2, Fengn Li 1 *, Lili Li 1, Juexin Fn 3, Xioming Sun 1,4 nd Yulong Yin 1 * 1 Key Lortory of Agro-eologil Proesses in Sutropil Region, Hunn Provinil Engineering Reserh Center of Helthy Livestok, Institute of Sutropil Agriulture, Chinese Ademy of Sienes, Sientifi Oserving nd Experimentl Sttion of Animl Nutrition nd Feed Siene in South-Centrl, Ministry of Agriulture, No. 644 Yund Rod, Furong Distrit, Chngsh Hunn , People s Repuli of Chin 2 Institute of Bst Fier Crops, Chinese Ademy of Agriulturl Sienes, Chngsh Hunn , People s Repuli of Chin 3 College of Animl Sienes, Hunn Agriulturl University, Chngsh Hunn , People s Repuli of Chin 4 The Grdute Shool of the Chinese Ademy of Sienes, Beijing , People s Repuli of Chin British Journl of Nutrition (Sumitted 11 April 2013 Finl revision reeived 12 June 2013 Aepted 10 July 2013 First pulished online 15 August 2013) Astrt The ojetive of the present study ws to investigte the optiml dietry PUFA rtios tht regulte lipid metolism nd inflmmtion in pigs. A totl of ninety-six ross-red (Lrge White Lndre) growing-finishing pigs (73 8 (SEM 1 6) kg) were hosen nd fed one of the four isoenergeti diets with PUFA rtios of 1:1, 2 5:1, 5:1 nd 10:1. The growth performne of pigs fed the diet with n PUFA rtio of 5:1 ws the est, ut the group fed the diet with n PUFA rtio of 1:1 hd the highest musle mss nd the lowest dipose tissue mss (P,0 05). The onentrtions of IL-6 nd IL-1 of pigs fed the diet with n PUFA rtio of 1:1 were deresed ompred with those of the other groups (P,0 05). The onentrtion of diponetin of pigs fed the diet with n PUFA rtio of 1:1 ws lso mrkedly deresed, ut the onentrtion of leptin ws inresed ompred with tht of the groups fed the diets with PUFA rtios of 5:1 nd 10:1 (P,0 05). Additionlly, the optiml dietry rtios of PUFA of 1:1 nd 5:1 mrkedly suppressed the expression levels of lipid metolism-relted genes nd proteins suh s phosphoinositide-3-kinse-, ftty id trnsport protein-1 nd PPARg. They lso signifintly suppressed the expression levels of the inflmmtory ytokines IL-1, TNF- nd IL-6. The results indited tht the optiml PUFA rtios of 1:1 nd 5:1 exerted enefiil effets on lipid metolism nd inflmmtory system, leding to the vilility of more energy nd nutrients for high performne nd homeostti pthwys. Key words: rtios: PUFA: Lipid metolism: Inflmmtion: Pigs Essentil ftty ids, inluding n-6 nd n-3 PUFA, nnot onvert into eh other in the ody. Hene, PUFA re ruil omponents of the food or diet (1,2). It hs een widely epted tht the present Western diet is low in n-3 ftty ids with rtio of rnging from 15:1 to 20:1, insted of 1:1, while vlue s muh s possily lose to 1:1 is onsidered protetive ginst degenertive pthologies (3,4). Both n-6 nd n-3 PUFA n regulte gene expression: n-3 PUFA exert suppressive effets on hroni diseses; onversely, n-6 PUFA inrese the onentrtions of inflmmtory meditors (2,5). On the one hnd, it hs een hypothesised tht diets with high rtios of PUFA my inrese the prodution of inflmmtory meditors nd led to the pthology of the metoli syndrome, suh s ognitive impirment, Alzheimer s disese nd type 2 dietes (6 10). On the other hnd, diets with higher rtios of ftty ids my led to the pthology of the metoli syndrome (5). Therefore, lowering the PUFA rtio in diets is enefiil for the helth of nimls nd humns. A lower PUFA rtio is required for the prevention nd mngement of hroni diseses (2). Some previous studies hve suggested tht n PUFA rtio of 5:1 suppresses inflmmtion in ptients with sthm (3). It should e noted tht the iologil effets of n-6 nd n-3 PUFA re not lwys in opposition. It is widely epted tht the n-6-derived lipoxins lso exert nti-inflmmtory effets (3). Due to their opposing nd oordintive effets, proper lne etween n-6 nd n-3 ftty ids in the diet is very importnt to mintin the optimum growth nd development of nimls nd lso the helth of humns (11). Arevitions: FATP-1, ftty id trnsport protein-1; PI3K, phosphoinositide-3-kinse-. * Corresponding uthors: F. Li, fx þ , emil lifengn@is..n; Y. Yin, emil yinyulong@is..n
2 446 Y. Dun et l. British Journl of Nutrition The morphology nd physiology of the orgns of humns nd pigs re similr. Thus, the pig is n exellent niml model for studying humn nutrition nd metolism. In the present study, we used pig model to investigte the optiml dietry rtios of PUFA tht regulte lipid metolism nd inflmmtion. Mterils nd methods Animls nd diets All proedures followed in the present experiment were pproved y the ommittee on niml re of the Institute of Sutropil Agriulture, the Chinese Ademy of Sienes. A totl of ninety-six mle ross-red (Lrge White Lndre) pigs with similr initil weight (73 8 (SEM 1 6) kg) were hosen nd divided into four groups using rndomised omplete lok design sed on ody weight, with six replites (pens) per group nd four pigs per replite. The pigs in the four groups were fed isoenergeti diets (3 % ft) with different rtios, prepred using 3 00, 1 50, 0 75 nd 0 30 % of linseed oil to reple equivlent mounts of soyen oil to mke the dietry rtios of the four diets out 1:1, 2 5:1, 5:1 nd 10:1, respetively. The omposition nd nutrient levels of the four diets re listed in Tle 1. All the pigs hd d liitum ess to diets nd wter nd onsumed the diets for 2 months. Smple olletion Body weights nd feed intke of the pigs were reorded fter n overnight fst to lulte weight gin nd feed onversion. Tle 1. Composition nd nutrient levels of the diets (ir-dry sis, %) Ingredients (%) 1:1 2 5:1 5:1 10:1 Mize Soyen mel Whet rn Soyen oil* Linseed oil Dilium phosphte Limestone Slt Premix Nutrient level (%) Digestile energy (MJ/kg) Crude protein SID Lys SID Met C Aville P SID, stndrdised ilel digestile. * To reple equivlent mounts of soyen oil, 3 00, 1 50, 0 75 nd 0 30 % of linseed oil were used, mking the dietry rtios out 1:1, 2 5:1, 5:1 nd 10:1, respetively (see Tle 2). Premix provided per kg diet: retinol ette, IU; holeliferol, 3600 IU; DL--toopherol ette, 15 IU; thimin, 3 0 mg; rioflvin, 7 8 mg; olmin, mg; pyridoxine, 3 0 mg; mendione, 3 0 mg; pntotheni id, 150 mg; niin, 30 mg; holine, 600 mg; foli id, 1 5 mg; iotin, mg; Cu (s CuSO 4.5H 2 O), 10 mg; Fe (s FeSO 4.7H 2 O), 80 mg; Zn (s ZnSO 4.7H 2 O), 80 mg; Mn (s MnSO 4.H 2 O), 10 mg; Se (s N 2 SeO 3 ), 0 30 mg; I (s KI), 0 30 mg. From eh replite, one pig ws hosen nd killed t the end of the feeding test. Blood smples were olleted vi jugulr vein punture into 10 ml tues, nd serum ws seprted y entrifugtion t 2000 g for 15 min t 48C nd then stored t 2208C until nlysis. The pigs were eletrilly stunned, exsnguinted nd eviserted. Immeditely, smples (out 5 g) of the longissimus lumorum musle nd suutneous dipose tissue disseted from the left side of the rsses were pled in liquid N 2 nd then stored t 2808C until further nlyses. Lter, skeletl musle nd ft were disseted from the right side of the rsses nd weighed seprtely. The weights were used to lulte the totl perentges of these omponents in the rsses. Mesurement of the onentrtions of sereted dipokines y ELISA The serum onentrtions of IL-6 (R&D), TNF- (Endogen), IL-1, leptin, totl diponetin (Usn) nd insulin (Merodi) were quntified using ELISA kits for porine ssy ording to the mnufturers instrutions. All the smples were mesured in six replites. Rel-time PCR Totl RNA ws extrted from the hrvested tissue using the TRIzol regent (Invitrogen). Primers for the seleted genes (Tle 2) were designed using the Oligo 6.0 softwre. RT ws performed using the AMV Reverse Trnsriptse Kit (Promeg). The reltive expression levels of the trget genes were determined using quntittive rel-time PCR, performed with n ABI 7900 PCR system (ABI Biotehnology). The finl volume of the retion mixtures (20 ml) ontined diluted omplementry DNA nd SYBR Green I (Moleulr Proes) s PCR ore regent. -Atin ws used s housekeeping gene or n internl ontrol to normlise the expression of trget genes. The reltive quntifition of gene mplifition y RT-PCR ws performed using the vlue of the threshold yle (C t ). The omprtive C t vlue method using the formul 2 2DDC t ws employed to quntify the expression levels of phosphoinositide-3-kinse- (PI3K), ftty id trnsport protein-1 (FATP-1), PPARg, IL-1, TNF- nd IL-6 reltive to those of -tin using the following formul: 2 2DDC t ðddc t ¼ C t gene of interest 2 C t -tin Þ tret 2 ðc t gene of interest 2 C t -tin Þ untret : Western lotting Tissue smples (out mg) were powdered in liquid N 2 to extrt totl protein. Approximtely 30 mg of the protein smple were size-frtionted on SDS PAGE gel nd trnsferred onto polyvinylidene difluoride memrnes (Millipore) under the onditions of 30 ma nd 48C overnight. Lter, the memrnes were loked with 5 % ovine serum lumin (BSA) for 1 h nd then proed overnight t 48C with the ntiodies ginst FATP-1 (69458; Am) t 1:800 dilution nd
3 Ftty ids nd lipid metolism nd inflmmtion 447 British Journl of Nutrition Tle 2. Primers used for rel-time PCR Genes Primers Sequenes ( ) PPARg (#2435; Cell Signling Tehnology) nd PI3K (#4255; Cell Signling Tehnology) t 1:1000 dilution. The memrnes were then rinsed with Tris-uffered sline plus 0 1 % Tween 20 three times nd inuted with peroxidse-onjugted got nti-rit or nti-mouse IgG for 1 h t 1:5000 dilution t room temperture; -tin monolonl ntiody (s47778) t 1:2000 dilution ws used to normlise the mount of proteins (Snt Cruz Biotehnology). The protein nds were visulised using hemiluminesent regent. The density of the protein nds ws determined using the Alph Imger 2200 softwre (Alph Innoteh Corportion). Sttistil nlyses All the results re expressed s mens with their stndrd errors. Sttistil nlyses were rried out using one-wy ANOVA, SAS 8.2 (SAS Institute, In.), followed y Tukey test of multiple omprisons. In se of P vlue, 0 05, differenes were onsidered to e sttistilly signifint. Results Effets of dietry PUFA rtios on the growth performne nd ody omposition of pigs The ftty id ontents of the experimentl diets re listed in Tle 3. The mesured vlues oinided etter with the Tle 3. Ftty id omposition of the diets Items 1:1 2 5:1 5:1 10:1 16 : : : : : 2n : 3n : 6n Sn-6 : Sn-3* 1 1:1 2 6:1 4 9:1 10 2:1 * ¼ (18 : 2)/(18 : 3 þ 22 : 6). Size (p) T A (8C) PI3K Forwrd CTGGACTGCCTGCGCTACTG Reverse TGGTGGTGCTGCGGTGAAT FATP-1 Forwrd GGAGTAGAGGGCAAAGCAGG Reverse AGGTCTGGCGTGGGTCAAAG PPARg Forwrd TGACCATGGTTGACACCG Reverse AAGCATGAACTCCATAGTGG IL 1 Forwrd GCTAACTACGGTGACAACAA Reverse TCTTCATCGGCTTCTCCACT TNF- Forwrd CCACGTTGTAGCCAATGTCA Reverse CAGCAAAGTCCAGATAGTCG IL-6 Forwrd TCAGTCCAGTCGCCTTCTCC Reverse GGCATTTGTGGTGGGGTTAG -Atin Forwrd TGCGGGACATCAAGGAGAAG Reverse AGTTGAAGGTGGTCTCGTGG T A, nneling temperture; PI3K, phosphoinositide-3-kinse-; FATP-1, ftty id trnsport protein-1. lulted vlues. The growth performne nd ody omposition of pigs fed diets with different PUFA rtios re summrised in Tle 4. Compred with those of the other groups, the ody weight nd dily weight gin of pigs fed the diet with n PUFA rtio of 5:1 were inresed signifintly (P, 0 05), while the dily intke nd feed onversion rte of this group were deresed (P, 0 05). However, the group fed the diet with n PUFA rtio of 1:1 hd high musle mss nd low dipose tissue mss. We speulted tht n optiml PUFA rtio ould regulte the rosstlk etween the musle nd dipose tissue of pigs. Effets of different PUFA rtios on serum gluose nd ytokine onentrtions As shown in Tle 5, the onentrtions of gluose, TNF- nd insulin were not different mong the tretment groups. The onentrtions of IL-6 nd IL-1 of pigs fed the diet with n PUFA rtio of 1:1 were deresed y 12 3 nd 37 9 % (P, 0 05), respetively, ompred with those fed diets with n PUFA rtio of 10:1. Furthermore, the serum onentrtions of diponetin of pigs fed the diet with n PUFA rtio of 1:1 were lso deresed y 13 5 % ompred with those of pigs fed the diet with n PUFA rtio of 10:1 (P, 0 05); on the ontrry, the onentrtion of leptin of this group ws inresed y 16 4 % (P, 0 05). Effets of dietry PUFA rtios on the gene expression levels of pigs The expression levels of genes in the musle nd dipose tissue of pigs re shown in Fig. 1(A) nd (B). The expression levels of PI3K mrna were lower (P, 0 05) in the groups fed diets with PUFA rtios of 1:1 nd 2 5:1, nd there ws no differene etween these two groups (P. 0 05). The expression levels of the FATP-1 gene in the musle nd dipose tissue of pigs fed diets with n PUFA rtio of 1:1 were the lowest (P, 0 05), nd those fed diets with PUFA rtios of 1:1 nd 2 5:1 exhiited down-regulted expression levels of the PPARg gene in the musle nd dipose tissue (P, 0 05); lso, there ws no differene (P, 0 05) etween these two groups. Interestingly, the diet with n PUFA rtio of 1:1 mrkedly down-regulted the expression levels of IL-1, TNF- nd IL-6 genes in the skeletl musle nd dipose tissue of pigs (P, 0 05). Effet of dietry PUFA rtios on the protein expression levels of pigs The reltive expression levels of PI3K, FATP-1 nd PPARg proteins re shown in Fig. 2(A) nd (B). The expression level of the PI3K protein ws higher in the musle of pigs fed the diet with n PUFA rtio of 10:1 (P, 0 05). The trend of the expression levels of the FATP-1 protein ws the sme s those of the gene in the musle. However, the trend of the expression levels of the FATP-1 protein in the dipose tissue ws the reverse. The diets with PUFA
4 448 Y. Dun et l. Tle 4. Effet of dietry PUFA rtios on the growth performne of pigs Items 1:1 2 5:1 5:1 10:1 SEM P Initil ody weight (kg) Finl ody weight (kg) Dily weight gin (kg/d) Feed intke (kg/d) ,0 01 Feed onversion rte (gin:feed) ,0 01 Musle mss (%)* Adipose tissue mss (%)* , , Vlues with unlike letters within row were signifintly different (P,0 05). * The rtio represents the musle or dipose tissue mss:rss weight. British Journl of Nutrition rtios of 1:1 nd 2 5:1 signifintly down-regulted the expression levels of the PPARg protein in the musle nd dipose tissue (P, 0 05), lso prtilly orresponding to the expression levels of the gene. Disussion In the present study, with n ompnying deline in the verge dily feed intke nd feed onversion rte, the finl ody weight nd dily gin of pigs fed the diet with n PUFA rtio of 5:1 improved signifintly. This result is in greement with erlier reports showing tht diet with lower PUFA rtio, rih in n-3 PUFA, is enefiil for the growth performne nd helth of nimls (12 15). The min omponents of dipose tissue re ftty ids, whih my influene the expression of dipokines, suh s diponetin nd leptin (15). Interestingly, the results of the present experiment showed tht the serum onentrtions of diponetin of pigs deresed grdully s the dietry PUFA rtio deresed. Adiponetin is n dipokine exlusively derived from the dipose tissue (16,17). It hs een reported tht fish oil rih in n-3 PUFA inreses the serum onentrtions of diponetin in mie 2 3-fold in dosedependent mnner nd lso in PPARg-dependent mnner (17). However, the present results showed tht low PUFA rtio ould redue the serum onentrtions of diponetin. The results led us to hypothesise tht the serum onentrtions of diponetin re ffeted y different rtios of dietry PUFA. Leptin irultes in the ody t onentrtion highly orrelted with white dipose tissue mss nd my e of gret importne in the regultory tion on ody ft (15,18). It hs een shown tht the serum onentrtions of leptin re signifintly redued in mie fed diets with n PUFA rtio of 1:1, ut these re not signifintly redued in mie fed diets with PUFA rtios of 5:1, 10:1 nd 20:1 (19). In the present study, the onentrtions of leptin of the group fed the diets with PUFA rtios of 1:1 nd 2 5:1 were higher, inditing tht the optiml rtio my vry in different niml models. However, no differene in the serum onentrtions of insulin ws oserved in the present study. We speulted tht PUFA rtios ould stimulte the negtive feedk regultory mehnism of diponetin nd leptin. Immune stimultion in the rering environment results in the prodution of potent pro-inflmmtory ytokines, whih ntgonise noli growth ftors nd thus suppress growth. IL-6, IL-1 nd TNF-, whih re ll inflmmtory ytokines, initite the prodution of n rry of inflmmtory meditors, thus leding to n inflmmtory response. The onentrtions of these ytokines re inresed on inresing n-6 ftty id intke nd deresed on inresing n-3 ftty id intke in ovine hondroytes nd in mouse kidney, spleen nd peritonel mrophges, s well s in humn monoytes (20). The irulting levels of IL-6 might reflet, t lest in prt, the prodution of IL-6 in the dipose tissue, lthough it is lso sereted y the exerising musle (21). The onentrtions of IL-6 derese y 10 5 % on ltering the rtio to 1 3 (22). Moreover, the onentrtions of TNF- deline signifintly y 30 % in response to flxseed oil diet rih in n-3 PUFA nd derese y 74 % fter fish oil supplementtion (23). Tle 5. Effet of dietry rtios on serum gluose nd ytokine onentrtions of pigs Items 1:1 2 5:1 5:1 10:1 SEM P Gluose (mmol/l) IL-6 (ng/ml) TNF- (ng/ml) IL-1 (ng/ml) Adiponetin (mg/ml) , Leptin (ng/ml) , Insulin (mu/ml) , Vlues with unlike letters within row were signifintly different (P,0 05).
5 Ftty ids nd lipid metolism nd inflmmtion 449 (A) Reltive mrna expression level ,,, (B) Reltive mrna expression level ,, 0 0 P13K FATP-1 PPARg IL-1 TNF- IL-6 P13K FATP-1 PPARg IL-1 TNF- IL-6 Fig. 1. Reltive expression levels of phosphoinositide-3-kinse- (PI3K), ftty id trnsport protein-1 (FATP-1), PPARg, IL-1, TNF- nd IL-6 mrna in the (A) musle nd (B) dipose tissue of pigs fed diets with PUFA rtios of 1:1 ( ), 2 5:1 ( ), 5:1 ( ) nd 10:1 ( ). Rel-time PCR method ws employed. Vlues re mens (n 6), with their stndrd errors represented y vertil rs.,, Men vlues with unlike letters were signifintly different (P,0 05). British Journl of Nutrition The present results lso indited tht higher n-3 PUFA ould redue the serum onentrtions of IL-6 s well s IL-1, ut not of TNF-. Additionlly, we lso found tht the expression levels of IL-6, IL-1 nd TNF- mrna in the skeletl musle nd dipose tissue of pigs fed the diet with n PUFA rtio 1:1 were mrkedly down-regulted. Numerous studies hve reported tht n-3 PUFA n derese the prodution of these inflmmtory ytokines (10,24,25). It hs een shown tht n optiml PUFA rtio ould regulte severl ytokines to redue inflmmtory events in the ody. The PI3K pthwy ontrols essentil ellulr funtions suh s signl trnsdution, ytoskeletl dynmis nd memrne trffiking (26). The expression levels of the PI3K gene in mononuler ells of helthy humn sujets hve een reported to derese fter supplementtion with fish oil (10). In the present study, the expression levels of PI3K gene nd protein in the musle nd dipose tissue of pigs fed the diet with n PUFA rtio of 1:1 were the lowest nd the PI3K pthwy ws tivted. In mmmls, FATP-1 trnsports long-hin ftty ids tively ross dipoyte ell memrnes. In the present study, it ws found tht the expression levels of FATP-1 mrna nd protein in the musle nd dipose tissue were down-regulted signifintly in pigs fed the diet with lower PUFA rtio. We speulted tht n-3 PUFA ould suppress dipogeni proesses y down-regulting the expression levels of FATP-1 nd the optiml dietry rtios of PUFA might e 1:1 nd 5:1. PPARg regultes genes involved in dipoyte differentition nd lipogenesis, while n-3 PUFA nd their metolites hve een shown to suppress the trnsription of lipogeni genes (A) (B) P13Kα FATP-1 PPARγ β-atin P13Kα FATP-1 PPARγ β-atin Reltive protein expression level P13Kα FARP-1 PPARγ P13Kα FARP-1 PPARγ Fig. 2. Reltive expression levels of phosphoinositide-3-kinse- (PI3K), ftty id trnsport protein-1 (FATP-1) nd PPARg proteins in the (A) musle nd (B) dipose tissue of pigs fed diets with different PUFA rtios. Western lotting method ws employed. Lnes 1, 2, 3 nd 4 represent PUFA rtios of 1:1 ( ), 2 5:1 ( ), 5:1 ( ) nd 10:1 ( ), respetively. Vlues re mens (n 6), with their stndrd errors represented y vertil rs.,, Men vlues with unlike letters were signifintly different (P,0 05). Reltive protein expression level
6 450 Y. Dun et l. British Journl of Nutrition y funtioning s nturl lignds for PPAR (27 31). Interestingly, n-3 PUFA nd their metolites n tivte the extrellulr signl-regulted kinse pthwy (29,31,32), whih primrily regultes ellulr growth nd differentition (33,34). Some previous studies hve lredy demonstrted tht PPARg lignds inhiit the prodution of IL-6, TNF- nd IL-1 (28,35,36) nd tht TNF- n inhiit dipoyte differentition nd dipogenesis y suppressing the expression of the PPARg gene (20,36). In the present study, the expression levels of PPARg gene nd protein in oth the musle nd dipose tissue of pigs fed the diets with PUFA rtios of 1:1 nd 2 5:1 were mrkedly redued. It ws oserved tht diet with lower PUFA rtio ould redue the expression levels of PPARg, whih further suppress the trnsription of lipogeni genes nd lipogenesis. Conlusion On the whole, PUFA rtios regulte lipid metolism nd inflmmtion differently nd the optiml rtios re 1:1 to 5:1, whih vry sed on the roles under onsidertions. Optiml PUFA rtios ould inhiit immune stimultion to ensure the vilility of more energy nd nutrients for high performne nd homeostti pthwys. We speulted tht there ws ommon pthwy shred y energy metolism nd inflmmtion modultion. However, further reserh is neessry to onfirm the results nd to illustrte the underlying metoli pthwys. Aknowledgements The present study ws jointly supported y the Ntionl Bsi Reserh Progrm of Chin (2013CB127305, 2012CB124704), the Nnjing Brnh Ademy of Chinese Ademy of Siene nd Jingxi Provine Coopertion Projet, the Ntionl Nture Siene Foundtion of Chin ( , ) nd the Projet of Institute of Sutropil Agriulture, the Chinese Ademy of Sienes (ISACX-LYQY-QN-1104). None of the funders hd ny role in the design nd nlysis of the study nd in the writing of this rtile. The uthors ontriutions re s follows: Y. Y., F. L. nd L. L. were in hrge of the whole tril; Y. D. nd F. L. wrote the mnusript; J. F. nd X. S. ssisted with the niml tril nd iohemil nlyses. The uthors hve no onflits of interest to delre. Referenes 1. Lim GP, Clon F, Morihr T, et l. (2005) A diet enrihed with the omeg-3 ftty id dooshexenoi id redues myloid urden in n ged Alzheimer mouse model. J Neurosi 25, Simopoulos AP (2006) Evolutionry spets of diet, the omeg-6/omeg-3 rtio nd geneti vrition: nutritionl implitions for hroni diseses. Biomed Phrmother 60, Simopoulos AP (2002) The importne of the rtio of omeg- 6/omeg-3 essentil ftty ids. Biomed Phrmother 56, Koyshi N, Brnrd RJ, Henning SM, et l. (2006) Effet of ltering dietry v-6/v-3 ftty id rtios on prostte ner memrne omposition, ylooxygense-2, nd prostglndin E2. Clin Cner Res 12, Hieln JR, Nieminen LR, Blslg TL, et l. (2006) Helthy intkes of n-3 nd n-6 ftty ids: estimtions onsidering worldwide diversity. Am J Clin Nutr 83, 1483S 1493S. 6. Gmoh S, Hshimoto M, Hossin S, et l. (2001) Chroni dministrtion of dooshexenoi id improves the performne of rdil rm mze tsk in ged rts. Clin Exp Phrmol Physiol 28, Ikemoto A, Ohishi M, Sto Y, et l. (2001) Reversiility of n-3 ftty id defiieny-indued ltertions of lerning ehvior in the rt: level of n-6 ftty ids s nother ritil ftor. J Lipid Res 42, Ctln J, Moriguhi T, Slotnik B, et l. (2002) Cognitive defiits in dooshexenoi id-defiient rts. Behv Neurosi 116, Rhej B, Sdikot SM, Phtk RB, et l. (1993) Signifine of the n-6/n-3 rtio for insulin tion in dietes. Ann N Y Ad Si 683, Wever KL, Ivester P, Seeds M, et l. (2009) Effet of dietry ftty ids on inflmmtory gene expression in helthy humns. J Biol Chem 284, Dutt-Roy AK (2000) Trnsport mehnisms for long-hin polyunsturted ftty ids in the humn plent. Am J Clin Nutr 71, Suppl., 315S 322S. 12. Newmn RE, Bryden WL, Flek E, et l. (2002) Dietry n-3 nd n-6 ftty ids lter vin metolism: metolism nd dominl ft deposition. Br J Nutr 88, Ferrini G, Buells MD, Esteve-Gri E, et l. (2008) Dietry polyunsturted ft redues skin ft s well s dominl ft in roiler hikens. Poult Si 87, Qi KK (2009) Effet of dietry v6/v3 on ftty id omposition nd met qulity in hiken. PhD Thesis, Chinese Ademy of Agriulturl Sienes, Animl Nutrition Deprtment, Beijing. 15. Drevon CA (2005) Ftty ids nd expression of dipokines. Biohim Biophys At 1740, Stefn N, Whl HG, Fritshe A, et l. (2001) Effet of the pttern of elevted free ftty ids on insulin sensitivity nd insulin seretion in helthy humns. Horm Met Res 33, Neshen S, Morino K, Rossher JC, et l. (2006) Fish oil regultes diponetin seretion y peroxisome prolifertor-tivted reeptor-g-dependent mehnism in mie. Dietes 55, Lgo F, Dieguez C, Gómez-Reino J, et l. (2007) The emerging role of dipokines s meditors of inflmmtion nd immune responses. Cytokine Growth Ftor Rev 18, Xu F, Fn CN, Zhu HY, et l. (2009) Effets of dietry rtio hnges of n-6/n-3 polyunsturted ftty ids on expression of plsm leptin in mie. J Appl Clin Peditr 24, Ti CC & Ding ST (2010) n-3 Polyunsturted ftty ids regulte lipid metolism through severl inflmmtion meditors: mehnisms nd implitions for oesity prevention. J Nutr Biohem 21, Lfontn M & Lngin D (2009) Lipolysis nd lipid moiliztion in humn dipose tissue. Prog Lipid Res 48, Rllidis L, Pshos G, Likos GK, et l. (2003) Dietry lphlinoleni id dereses C-retive protein, serum myloid A nd interleukin-6 in dyslipidemi ptients. Atheroslerosis 167,
7 Ftty ids nd lipid metolism nd inflmmtion Cughey GE, Mntzioris E, Gison RA, et l. (1996) The effet on humn tumor nerosis ftor lph nd interleukin 1 et prodution of diets enrihed in n-3 ftty ids from vegetle oil or fish oil. Am J Clin Nutr 63, Clder PC (2001) n-3 Polyunsturted ftty ids, inflmmtion, nd immunity. Lipids 36, Clder PC (2002) Dietry modifition of inflmmtion with lipids. Pro Nutr So 61, Lindmo K & Stenmrk H (2005) Regultion of memrne trffi y phosphoinositide 3-kinses. J Cell Si 119, Mdsen L, Petersen RK & Kristinsen K (2005) Regultion of dipoyte differentition nd funtion y polyunsturted ftty ids. Biohim Biophys At 1740, Mores LA, Piquers L & Bishop-Biley D (2006) Peroxisome prolifertor-tivted reeptors nd inflmmtion. Phrmol Ther 110, Feige JN, Gelmn L, Mihlik L, et l. (2006) From moleulr tion to physiologil outputs: peroxisome prolifertortivted reeptors re nuler reeptors t the rossrods of key ellulr funtions. Prog Lipid Res 45, Mihlik L, Auwerx J, Berger JP, et l. (2006) Interntionl union of phrmology. LXI. Peroxisome prolifertortivted reeptors. Phrmol Rev 58, Edwrds IJ & O Flherty JT (2008) Omeg-3 ftty ids nd PPARg in ner. PPAR Res 2008, Cmp HS, Tfuri SR & Leff T (1999) C-Jun N-terminl kinse phosphoryltes peroxisome prolifertor-tivted reeptorg1 nd negtively regultes its trnsriptionl tivity. Endorinology 140, Dormn CM & Johnson SE (1999) Ativted Rf inhiits vin myogenesis though MAPK dependent mehnism. Onogene 18, Lee MY, Jeong WJ, Oh JW, et l. (2009) NM23H2 inhiits EGF- nd Rs-indued prolifertion of NIH3T3 ells y loking the ERK pthwy. Cner Lett 275, Jing C, Ting AT & Seed B (1998) PPAR-gmm gonists inhiit prodution of monoyte inflmmtory ytokines. Nture 391, Esher P & Whli W (2000) Peroxisome prolifertor-tivted reeptors: insight into multiple ellulr funtions. Mutt Res 448, British Journl of Nutrition
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationDepartment of Animal Resource and Science, Dankook University, Cheonan, Choongnam, , Republic of Korea
British Journl of Nutrition (1), 115, 57575 The Authors 1 doi:1.117/s711515857 Ltoillus idophilus modultes inflmmtory tivity y regulting the TLR nd NF-κB expression in porine peripherl lood mononuler ells
More informationResearch Article A Comparison of Inflammatory and Oxidative Stress Markers in Adipose Tissue from Weight-Matched Obese Male and Female Mice
Hindwi Pulishing Corportion Experimentl Dietes Reserh Volume 1, Artile ID 859395, 8 pges doi:1.1155/1/859395 Reserh Artile A Comprison of Inflmmtory nd Oxidtive Stress Mrkers in Adipose Tissue from Weight-Mthed
More informationSome aspects of nutritive and sensory quality of meat of restrictively fattened chickens
Chiken met qulity: T. Komprd nd J. Zelenk Some spets of nutritive nd sensory qulity of met of restritively fttened hikens T. KOMPRDA 1 * nd J. ZELENKA 2 1 Deprtment of Food Tehnology 2 Deprtment of Animl
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationARTICLE. E. O. List & A. J. Palmer & D. E. Berryman & B. Bower & B. Kelder & J. J. Kopchick
Dietologi (2009) 52:1647 1655 DOI 10.1007/s00125-009-1402-z ARTICLE Growth hormone improves ody omposition, fsting lood gluose, gluose tolerne nd liver triylglyerol in mouse model of diet-indued oesity
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationResearch Article Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice
Hindwi Pulishing Corportion Evidene-Bsed Complementry nd Alterntive Mediine, Artile ID 718379, 14 pges http://dx.doi.org/1.1155/214/718379 eserh Artile Deffeinted Green Coffee Ben Extrt Attenutes Diet-Indued
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationSupplementary information to accompany the manuscript entitled:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementry informtion to ompny the mnusript entitled: A mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationBritish Journal of Nutrition
(1), 11, 8 87 q The Authors 1 doi:1.117/s711117x Chnges in plsm mino id profiles, growth performne nd intestinl ntioxidnt pity of piglets following inresed onsumption of methionine s its hydroxy nlogue
More informationInfluence of Ad libitum or Control Feeding on the Performance of Broilers Fed Diets Low in Crude Protein 1
Interntionl Journl of Poultry Siene 4 (5): 74-79, 005 ISSN 168-8356 Asin Network for Sientifi Informtion, 005 Influene of Ad liitum or Control Feeding on the Performne of Broilers Fed Diets Low in Crude
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationHydrodynamic Delivery of mil10 Gene Protects Mice From High-fat Diet-induced Obesity and Glucose Intolerance
originl rtile The Amerin Soiety of Gene & Cell Therpy Hydrodynmi Delivery of mil Gene Protets Mie From High-ft Diet-indued Oesity nd Gluose Intolerne Mingming Go, Chuno Zhng, Yongjie M, Le Bu, Linn Yn
More informationErucin Exerts Anti-Inflammatory Properties in Murine Macrophages and Mouse Skin: Possible Mediation through the Inhibition of NFκB Signaling
Int. J. Mol. Si. 213, 14, 2564-2577; doi:1.339/ijms1412564 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Eruin Exerts Anti-Inflmmtory Properties in Murine
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationEffects of Feeding Citrus Pulp or Corn Supplements With Increasing Levels of Added Undegraded Intake Protein on the Performance of Growing Cattle
Effets of Feeding Citrus Pulp or Corn Supplements With Inresing Levels of Added Undegrded Intke Protein on the Performne of Growing Cttle Deke Alkire Todd Thrift Willim Kunkle 1 Citrus pulp-sed supplements
More informationSupplemental epilactose prevents metabolic disorders through uncoupling protein-1 induction in the skeletal muscle of mice fed high-fat diets
British Journl of Nutrition (215), 114, 1774 1783 The Authors 215 doi:1.117/s7114515355 Supplementl epiltose prevents metoli disorders through unoupling protein-1 indution in the skeletl musle of mie fed
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationDifferential expression of cyclin G2, cyclin dependent kinase inhibitor 2C and peripheral myelin protein 22 genes during adipogenesis..
The Ohio Stte University From the SeletedWorks of Jiin Zhng Summer My 5, 214 Differentil expression of ylin G2, ylin dependent kinse inhiitor 2C nd peripherl myelin protein 22 genes during dipogenesis..pdf
More informationA maternal junk food diet in pregnancy and lactation promotes an exacerbated taste for junk food and a greater propensity for obesity in rat offspring
British Journl of Nutrition (27), pge 1 of 9 q The uthors 27 doi: 1.117/S7114781237 mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity for oesity in rt
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationGarcinia cambogia Extract Ameliorates Visceral Adiposity in C57BL/6J Mice Fed on a High-Fat Diet
Biosi. Biotehnol. Biohem., 72 (7), 1772 1780, 2008 Grini mogi Extrt Ameliortes Viserl Adiposity in C57BL/6J Mie Fed on High-Ft Diet Keun-Young KIM, Hye Nm LEE, Yun Jung KIM, nd Tesun PARK y Deprtment of
More informationComparative Efficacy of DL-Methionine and Herbal Methionine on Performance of Broiler Chicken
Interntionl Journl of Poultry Siene 5 (11): 1034-1039, 2006 ISSN 1682-8356 Asin Network for Sientifi Informtion, 2006 Comprtive Effiy of DL-Methionine nd Herl Methionine on Performne of Broiler Chiken
More informationTHE EFFECT OF DIFFERENT LEVELS OF OLIVE OIL IN RATION SUPPLEMENTATION ON SOME BIOCHEMICAL AND PRODUCTIVE TRAITS IN BROILERS
I.J.S.N., VOL.9 (1) 2018: 137-142 ISSN 2229 6441 TH T O IRNT LVLS O OLIV OIL IN RTION SUPPLMNTTION ON SOM IOHMIL N PROUTIV TRITS IN ROILRS huh Smir Hdi, s wzy l- khlisy ep. of Veterinry Puli Helth/ollege
More informationWhite adipose tissue overproduces the lipid-mobilizing factor zinc a2-glycoprotein in chronic kidney disease
si reserh http://www.kidney-interntionl.org & 13 Interntionl Soiety of Nephrology White dipose tissue overprodues the lipid-moilizing ftor zin -glyoprotein in hroni kidney disese Croline C. Pelletier 1,,3,5,
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationAdipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
Reeived 11 Jul 1 Aepted Fe Pulished 11 Mr DOI: 1.138/nomms795 OPEN Adipose tissue NAPE-PLD ontrols ft mss development y ltering the rowning proess nd gut miroiot Luie Geurts 1, Amndine Everrd 1,, Mtthis
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationBeta-Glucan-Rich Extract from
Evidene-Bsed Complementry nd Alterntive Mediine Volume 2013, Artile ID 185259, 10 pges http://dx.doi.org/10.1155/2013/185259 Reserh Artile Bet-Glun-Rih Extrt from Pleurotus sjor-ju (Fr.) Singer Prevents
More informationIranian Food Science and Technology Research Journal Vol. 6, No. 3, Fall, 2010.
Irnin Food Siene nd Tehnology Reserh Journl Vol. 6, No. 3, Fll, 2010. rvghi.mrym@gmil.om C ( AOAC 920.87 AOAC 942.05 AOAC 962.09 AOAC 922.06 AOAC 925.10 AACC 1- Extrusion-Expelling 2- Protein Dispersiility
More informationEFFECTS OF DIETARY CALCIUM LEVELS ON GROWTH-PERFORMANCE AND DIGESTIVE FUNCTION IN CATTLE FED A HIGH-FAT FINISHING DIET
EFFECTS OF DIETARY CALCIUM LEVELS ON GROWTH-PERFORMANCE AND DIGESTIVE FUNCTION IN CATTLE FED A HIGH-FAT FINISHING DIET R. A. Zinn, Y. Shen, R. Brjs, M. Montño, E. Alvrez, nd E. Rmirez Desert Reserh nd
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationRaina Devi Ramnath, Jia Sun, and Madhav Bhatia. Department of Pharmacology, National University of Singapore, Singapore
-3565/9/39-48 48$. THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 39, No. Copyright 9 y The Amerin Soiety for Phrmology nd Experimentl s 48684/346663 JPET 39:48 48, 9 Printed in U.S.A.
More informationChapter 7. Control and Coordination
Chpter 7 Control n Coorintion 1 Whih of the following sttements is orret out reeptors? Gusttory reeptors etet tste while olftory reeptors etet smell Both gusttory n olftory reeptors etet smell Auitory
More informationLipid Composition of Egg Yolk and Serum in Laying Hens Fed Diets Containing Black Cumin (Nigella sativa)
Interntionl Journl of Poultry Siene 5 (6): 574-578, 2006 ISSN 682-8356 Asin Network for Sientifi Informtion, 2006 Lipid Composition of Egg Yolk nd Serum in Lying Hens Fed Diets Contining Blk Cumin (Nigell
More informationComparative Performance of Broiler Chickens Fed Varying Levels of Palm Kernel Cake and Maize Offal
Pkistn Journl of Nutrition 3 (4): 254-257, 2004 Asin Network for Sientifi Informtion, 2004 Comprtive Performne of Broiler Chikens Fe Vrying Levels of Plm Kernel Cke n Mize Offl E.V. Ezieshi n J.M. Olomu
More informationThe Body Vitamin B 1 Levels of Rats Fed a Diet Containing the Minimum Requirement of Vitamin B 1 Is Reduced by Exercise
J Nutr Si Vitminol, 59, 87 92, 213 The Body Vitmin B 1 Levels of Rts Fed Diet Contining the Minimum Requirement of Vitmin B 1 Is Redued y Exerise Ktsumi Shit nd Tsutomu Fukuwtri Deprtment of Food Siene
More informationEpiphyseal growth plate growth hormone receptor signaling is decreased in chronic kidney disease related growth retardation
http://www.kidney-interntionl.org & 213 Interntionl Soiety of Nephrology Epiphysel growth plte growth hormone reeptor signling is deresed in hroni kidney disese relted growth retrdtion Ariel Troi 1, Dniel
More informationIrisin biomarker, TSH, Trygleceriads and High Density Lipoproteins in thyroid diesase patients
Interntionl Journl of ChemTeh Reserh CODEN (USA): IJCRGG, ISSN: 0974-4290, ISSN(Online):2455-9555 Vol.10 No.2, pp 674-678, 2017 Irisin biomrker, TSH, Trygleerids nd High Density Lipoproteins in thyroid
More informationAssessment of Partial Equi-Protein Replacement of Soyabean Meal with Cassava and Leucaena Leaf Meals in the Diets of Broiler Chicken Finishers
Interntionl Journl of Poultry Siene 7 (4): 408-43, 008 ISSN 68-8356 Asin Network for Sientifi Informtion, 008 Assessment of Prtil Equi-Protein Replement of Soyen Mel with Cssv nd Leuen Lef Mels in the
More informationMesozeaxanthin protects the liver and reduces cardio-metabolic risk factors in an insulin resistant rodent model
FOOD & NUTRITION RESEARCH, 217 VOL. 61, 135336 https://doi.org/1.18/16546628.217.135336 ARTICLE Mesozexnthin protets the liver nd redues rdio-metoli risk ftors in n insulin resistnt rodent model Kzim Shin,
More informationBSC 2094C MOCK EXAM A
BSC 2094C MOCK EXAM A PART A: Multiple Choie True/Flse Items 1. Vriose veins re hrterized by. 1. tortuous nd irregulr diltions in superfiil veins due to inompetent vlves 2. being used by prolonged bk pressure
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationDietary iron concentration influences serum concentrations of manganese in rats consuming organic or inorganic sources of manganese
British Journl of Nutrition (2016), 115, 585 593 The Authors 2015 doi:10.1017/s0007114515004900 Dietry iron onentrtion influenes serum onentrtions of mngnese in rts onsuming orgni or inorgni soures of
More informationReplacement Value of Low Tannin Sorghum (Sorghum bicolor) for Maize in Broiler Chickens Diets in the Semi-Arid Zone of Nigeria
Interntionl Journl of Poultry Siene 11 (5): 333-337, 2012 ISSN 1682-8356 Asin Network for Sientifi Informtion, 2012 Replement Vlue of Low Tnnin Sorghum (Sorghum iolor) for Mize in Broiler Chikens Diets
More informationEffect of Dietary Lipid Levels on Fatty Acids Composition of Cultured Sparusaurata
Journl of Life Sienes 10 (2016) 312-320 doi: 10.17265/1934-7391/2016.06.007 D DAVID PUBLISHING Effet of Dietry Lipid Levels on Ftty Aids Composition of Cultured Sprusurt Zyene Nesrine 1,2, Gm Hous Wf 1,2,
More informationBritish Journal of Nutrition
British Journl of Nutrition (211), 15, 238 247 q The Authors 21 doi:1.117/s711451343 Adrenoortiotrophi hormone-stimulted ortisol relese y the hed kidney inter-renl tissue from se rem (Sprus urt) fed with
More informationScholars Research Library
ville online t www.sholrsreserhlirry.om Europen Journl of Zoologil Reserh, 2014, 3 (3):24-30 (http://sholrsreserhlirry.om/rhive.html) The effet of Wlnut onsumption on the serum levels of Gluose, Triglyeride,
More informationEffects of soybean isoflavones on reproductive parameters in Chinese mini-pig boars
Yun et l. Journl of Animl Siene nd Biotehnology 2012, 3:31 JOURNAL OF ANIMAL SCIENCE AND BIOTECHNOLOGY RESEARCH Open Aess Effets of soyen isoflvones on reprodutive prmeters in Chinese mini-pig ors Xio-xue
More informationREVIEW Study of the Formation of trans Fatty Acids in Model Oils (triacylglycerols) and Edible Oils during the Heating Process
JARQ 46 (3), 215 220 (2012) http://www.jirs.ffr.go.jp REVIEW Study of the Formtion of trns Ftty Aids in Model Oils (triylglyerols) nd Edible Oils during the Heting Proess Wkko TSUZUKI* Food Resoure Division,
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationEffect of Dietary Crude Protein, Lysine Level and Amino Acid Balance on Performance of Broilers 0 to 18 Days of Age
Interntionl Journl of Poultry Siene 9 (): 2-27, 200 ISSN 682-8356 Asin Network for Sientifi Informtion, 200 Effet of Dietry Crude Protein, Lysine Level nd Amino Aid Blne on Performne of Broilers 0 to 8
More informationDifferential expression of growth and immunity related genes influenced by in ovo supplementation of amino acids in broiler chickens
Czeh J. Anim. Si., 59, 2014 (9): 399 408 Originl Pper Differentil expression of growth nd immunity relted genes influened y in ovo supplementtion of mino ids in roiler hikens S.K. Bhnj, M. Sudhgr, A. Goel,
More informationCONCENTATION OF MINERAL ELEMENTS IN CALLUS TISSUE CULTURE OF SOME SUNFLOWER INBRED LINES
CONCENTATION OF MINERAL ELEMENTS IN CALLUS TISSUE CULTURE OF SOME SUNFLOWER INBRED LINES M. Sri 1, Drgn Vsi, Lj. Vsiljevi, D. Skori, Snezn Mezei nd Sloodnk Pjevi 2 ABSTRACT Conentrtion of minerl elements
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationInternational Journal of Poultry Science 12 (1): 37-44, 2013 ISSN Asian Network for Scientific Information, 2013
Interntionl Journl of Poultry Siene 12 (1): 37-44, 2013 ISSN 1682-8356 Asin Network for Sientifi Informtion, 2013 Repling Soyen Oil in the Finisher Phse with Different Levels of Dry Proteted Plnt Ft nd
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationLIPIDOMICS OF BLOOD AND ORGANS OF RATS FED DIETS SUPPLEMENTED WITH DIFFERENT EDIBLE OILS
Animl Reserh Interntionl (215) 12(2): 2189 222 2189 LIPIDOMICS OF BLOOD AND ORGANS OF RATS FED DIETS SUPPLEMENTED WITH DIFFERENT EDIBLE OILS 1 UGBAJA, Regin Ngozi, 2 AFOLABI, Olusegun Kyode, 1 ONUNKWOR,
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationEffect of Different Seasons on the Performance of Grey Giant Rabbits under Sub-Temperate Himalayan Conditions
812 Effet of Different Sesons on the Performne of Grey Gint Rits under Su-Temperte Himlyn Conditions R. S. Bhtt*, S. R. Shrm, Umesh Singh, Dvendr Kumr nd V. Bhsin North Temperte Regionl Sttion, Centrl
More informationNutrition Guide. National Swine. Trace Minerals and Vitamins for Swine Diets. Introduction. Objectives. Minerals required
Ntionl Swine Nutrition Guide Tre Minerls nd Vitmins for Swine Diets Introdution Authors Dune E. Reese, University of Nersk Grethen Myers Hill, Mihign Stte University Reviewers Donnie Cmpell, DSM Nutritionl
More informationARTICLE. I. Chopra & H. F. Li & H. Wang & K. A. Webster
Dietologi (212) 55:783 794 DOI 1.17/s125-11-247-y ARTICLE Phosphoryltion of the insulin reeptor y AMP-tivted protein kinse (AMPK) promotes lignd-independent tivtion of the insulin signlling pthwy in rodent
More informationThe Effect of Different Levels of Canola Oil on Performance, Egg Shell Quality and Fatty Acid Composition of Laying Hens
Interntionl Journl of Poultry Siene 11 (12): 769-776, 2012 ISSN 1682-8356 Asin Network for Sientifi Informtion, 2012 The Effet of Different Levels of Cnol Oil on Performne, Egg Shell Qulity nd Ftty Aid
More informationResearch Article TNF-α and IFN-s-Dependent Muscle Decay Is Linked to NF-κB- and STAT-1α-Stimulated Atrogin1 and MuRF1 Genes in C2C12 Myotubes
Hindwi Pulishing Corportion Meditors of Inflmmtion Volume 213, Artile ID 171437, 18 pges http://dx.doi.org/1.1155/213/171437 Reserh Artile nd IFN-s-Dependent Musle Dey Is Linked to NF-κB- nd STAT-1α-Stimulted
More informationA. B. C. Succiniclasticum. Paraprevotella. Control DPA EPA DHA Control DPA EPA DHA a b. a a. b c.
389 Session 2: Miroil eosystem nd herivore nutrition Effet of dietry ddition of EPA, DPA nd DHA on rumen teril ommunity in ows nd ewes. An in vitro pproh Dvid Crreño 1, Álvro Belenguer 1, Eri Pinlohe 2,
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationIntroduction to Study Designs II
Introdution to Study Designs II Commonly used study designs in publi helth & epidemiologi reserh Benjmin Rihrd H. Muthmbi, DrPH, MPH Stte HIV Epidemiologist HIV Epidemiology Investigtion Setion PA Deprtment
More informationMeat Science 81 (2009) Contents lists available at ScienceDirect. Meat Science. journal homepage:
Met Siene 81 (2009) 533 539 Contents lists ville t SieneDiret Met Siene journl homepge: www.elsevier.om/lote/metsi The effet of rtopmine hydrohloride (Pylen Ò ) on len rss yields nd pork qulity hrteristis
More informationProgestin effects on cell proliferation pathways in the postmenopausal mammary gland
Wood et l. Brest Cner Reserh 213, 15:R62 http://rest-ner-reserh.om/ontent/15/4/r62 RESEARCH ARTICLE Open Aess Progestin effets on ell prolifertion pthwys in the postmenopusl mmmry glnd Chrles E Wood 1,
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationlarvi 2013 Optimum phospholipids and antioxidant levels in microdiets for gilthead seabream larvae Reda Saleh & Marisol Izquierdo
lrvi 213 th fish & shellfish lrviulture symposium Optimum phospholipids nd ntioxidnt levels in mirodiets for gilthed serem lrve Red Sleh & Mrisol Izquierdo ghent university, elgium, 2- septemer 213 Optimum
More informationJOURNAL OF ENVIRONMENTAL SCIENCES 34 (2015) Available online at ScienceDirect
JOURNAL OF ENVIRONMENTAL SCIENCES 4 (5) 9 99 Aville online t www.sienediret.om SieneDiret www.journls.elsevier.om/journl-of-environmentl-sienes Effets of nitrogen dioxide nd its id mist on retive oxygen
More informationEffect of Feeding Different Levels of Concentrates on Buffalo Calves Performance, Digestibility and Carcass Traits
Amerin-Eursin J. Agri. & Environ. Si., 10 (2): 186-192, 2011 ISSN 1818-6769 IDOSI Pulitions, 2011 Effet of Feeding Different Levels of Conentrtes on Bufflo Clves Performne, Digestiility nd Crss Trits 1
More informationEffect of age and moderate food restriction on insulin sensitivity in Wistar rats: role of adiposity
131 Effet of ge nd moderte food restrition on insulin sensitivity in Wistr rts: role of diposity Fernndo Esrivá, M Luí Gvete, Ysmín Fermín 1, Corli Pérez 1, Nild Gllrdo 2, Crmen Alvrez, Antonio Andrés
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationResearch Article Lactobacillus plantarum LG42 Isolated from Gajami Sik-Hae Inhibits Adipogenesis in 3T3-L1 Adipocyte
Hindwi Pulishing Corportion BioMed Reserh Interntionl Volume 23, Artile ID 46927, 7 pges http://dx.doi.org/.55/23/46927 Reserh Artile Ltoillus plntrum LG42 Isolted from Gjmi Sik-He Inhiits Adipogenesis
More informationAUTHOR COPY ONLY. Glycogen synthase kinase 3b mediates high glucose-induced ubiquitination and proteasome degradation of insulin receptor substrate 1
Glyogen synthse kinse 3 medites high gluose-indued uiquitintion nd protesome degrdtion of insulin reeptor sustrte 1 171 Snhu Leng, Wenshuo Zhng, Ynin Zheng, Ziv Liermn 1, Christopher J Rhodes, Hgit Eldr-Finkelmn
More informationMaternal Body Mass Index, Dietary Intake and Socioeconomic Status: Differential Effects on Breast Milk Zinc, Copper and Iron Content
P P P Helth Promotion Perspetives, Vol. 1, No., 011; P: 140-146 ORIGINAL ARTICLE Open Aess Mternl Body Mss Index, Dietry Intke nd Soioeonomi Sttus: Differentil Effets on Brest Milk Zin, Copper nd Iron
More informationJeffrey D. Coleman, 1 Jerry T. Thompson, 1 Russell W. Smith III, 1 Bogdan Prokopczyk, 2,3 and John P. Vanden Heuvel 1,3,4. 1.
PPAR Reserh Volume 213, Artile ID 121956, 11 pges http://dx.doi.org/1.1155/213/121956 Reserh Artile Role of Peroxisome Prolifertor-Ativted Reeptor β/δ nd B-Cell Lymphom-6 in Regultion of Genes Involved
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationEffects of Lemmon Grass (Cymbopogon citratus) Leaf Meal Feed Supplement on Growth Performance of Broiler Chicks
Interntionl Journl of Poultry Siene 9 (12): 1107-1111, 2010 ISSN 1682-8356 Asin Network for Sientifi Informtion, 2010 Effets of Lemmon Grss (Cymopogon itrtus) Lef Mel Feed Supplement on Growth Performne
More informationInfluence of arbuscular mycorrhizal fungi on uptake of Zn and P by two contrasting rice genotypes
Influene of rusulr myorrhizl fungi on uptke of Zn nd P y two ontrsting rie genotypes R. Hjiolnd 1, 3, N. Alisghrzd, R. Brzeghr 1 1 Plnt Siene Deprtment, University of Triz, Triz, Irn Soil Siene Deprtment,
More information