British Journal of Nutrition

Transcription

1 British Journl of Nutrition (2014), 111, q The Authors 2013 doi: /s PUFA rtio is involved in regulting lipid metolism nd inflmmtion in pigs Yehui Dun 1,2, Fengn Li 1 *, Lili Li 1, Juexin Fn 3, Xioming Sun 1,4 nd Yulong Yin 1 * 1 Key Lortory of Agro-eologil Proesses in Sutropil Region, Hunn Provinil Engineering Reserh Center of Helthy Livestok, Institute of Sutropil Agriulture, Chinese Ademy of Sienes, Sientifi Oserving nd Experimentl Sttion of Animl Nutrition nd Feed Siene in South-Centrl, Ministry of Agriulture, No. 644 Yund Rod, Furong Distrit, Chngsh Hunn , People s Repuli of Chin 2 Institute of Bst Fier Crops, Chinese Ademy of Agriulturl Sienes, Chngsh Hunn , People s Repuli of Chin 3 College of Animl Sienes, Hunn Agriulturl University, Chngsh Hunn , People s Repuli of Chin 4 The Grdute Shool of the Chinese Ademy of Sienes, Beijing , People s Repuli of Chin British Journl of Nutrition (Sumitted 11 April 2013 Finl revision reeived 12 June 2013 Aepted 10 July 2013 First pulished online 15 August 2013) Astrt The ojetive of the present study ws to investigte the optiml dietry PUFA rtios tht regulte lipid metolism nd inflmmtion in pigs. A totl of ninety-six ross-red (Lrge White Lndre) growing-finishing pigs (73 8 (SEM 1 6) kg) were hosen nd fed one of the four isoenergeti diets with PUFA rtios of 1:1, 2 5:1, 5:1 nd 10:1. The growth performne of pigs fed the diet with n PUFA rtio of 5:1 ws the est, ut the group fed the diet with n PUFA rtio of 1:1 hd the highest musle mss nd the lowest dipose tissue mss (P,0 05). The onentrtions of IL-6 nd IL-1 of pigs fed the diet with n PUFA rtio of 1:1 were deresed ompred with those of the other groups (P,0 05). The onentrtion of diponetin of pigs fed the diet with n PUFA rtio of 1:1 ws lso mrkedly deresed, ut the onentrtion of leptin ws inresed ompred with tht of the groups fed the diets with PUFA rtios of 5:1 nd 10:1 (P,0 05). Additionlly, the optiml dietry rtios of PUFA of 1:1 nd 5:1 mrkedly suppressed the expression levels of lipid metolism-relted genes nd proteins suh s phosphoinositide-3-kinse-, ftty id trnsport protein-1 nd PPARg. They lso signifintly suppressed the expression levels of the inflmmtory ytokines IL-1, TNF- nd IL-6. The results indited tht the optiml PUFA rtios of 1:1 nd 5:1 exerted enefiil effets on lipid metolism nd inflmmtory system, leding to the vilility of more energy nd nutrients for high performne nd homeostti pthwys. Key words: rtios: PUFA: Lipid metolism: Inflmmtion: Pigs Essentil ftty ids, inluding n-6 nd n-3 PUFA, nnot onvert into eh other in the ody. Hene, PUFA re ruil omponents of the food or diet (1,2). It hs een widely epted tht the present Western diet is low in n-3 ftty ids with rtio of rnging from 15:1 to 20:1, insted of 1:1, while vlue s muh s possily lose to 1:1 is onsidered protetive ginst degenertive pthologies (3,4). Both n-6 nd n-3 PUFA n regulte gene expression: n-3 PUFA exert suppressive effets on hroni diseses; onversely, n-6 PUFA inrese the onentrtions of inflmmtory meditors (2,5). On the one hnd, it hs een hypothesised tht diets with high rtios of PUFA my inrese the prodution of inflmmtory meditors nd led to the pthology of the metoli syndrome, suh s ognitive impirment, Alzheimer s disese nd type 2 dietes (6 10). On the other hnd, diets with higher rtios of ftty ids my led to the pthology of the metoli syndrome (5). Therefore, lowering the PUFA rtio in diets is enefiil for the helth of nimls nd humns. A lower PUFA rtio is required for the prevention nd mngement of hroni diseses (2). Some previous studies hve suggested tht n PUFA rtio of 5:1 suppresses inflmmtion in ptients with sthm (3). It should e noted tht the iologil effets of n-6 nd n-3 PUFA re not lwys in opposition. It is widely epted tht the n-6-derived lipoxins lso exert nti-inflmmtory effets (3). Due to their opposing nd oordintive effets, proper lne etween n-6 nd n-3 ftty ids in the diet is very importnt to mintin the optimum growth nd development of nimls nd lso the helth of humns (11). Arevitions: FATP-1, ftty id trnsport protein-1; PI3K, phosphoinositide-3-kinse-. * Corresponding uthors: F. Li, fx þ , emil lifengn@is..n; Y. Yin, emil yinyulong@is..n

2 446 Y. Dun et l. British Journl of Nutrition The morphology nd physiology of the orgns of humns nd pigs re similr. Thus, the pig is n exellent niml model for studying humn nutrition nd metolism. In the present study, we used pig model to investigte the optiml dietry rtios of PUFA tht regulte lipid metolism nd inflmmtion. Mterils nd methods Animls nd diets All proedures followed in the present experiment were pproved y the ommittee on niml re of the Institute of Sutropil Agriulture, the Chinese Ademy of Sienes. A totl of ninety-six mle ross-red (Lrge White Lndre) pigs with similr initil weight (73 8 (SEM 1 6) kg) were hosen nd divided into four groups using rndomised omplete lok design sed on ody weight, with six replites (pens) per group nd four pigs per replite. The pigs in the four groups were fed isoenergeti diets (3 % ft) with different rtios, prepred using 3 00, 1 50, 0 75 nd 0 30 % of linseed oil to reple equivlent mounts of soyen oil to mke the dietry rtios of the four diets out 1:1, 2 5:1, 5:1 nd 10:1, respetively. The omposition nd nutrient levels of the four diets re listed in Tle 1. All the pigs hd d liitum ess to diets nd wter nd onsumed the diets for 2 months. Smple olletion Body weights nd feed intke of the pigs were reorded fter n overnight fst to lulte weight gin nd feed onversion. Tle 1. Composition nd nutrient levels of the diets (ir-dry sis, %) Ingredients (%) 1:1 2 5:1 5:1 10:1 Mize Soyen mel Whet rn Soyen oil* Linseed oil Dilium phosphte Limestone Slt Premix Nutrient level (%) Digestile energy (MJ/kg) Crude protein SID Lys SID Met C Aville P SID, stndrdised ilel digestile. * To reple equivlent mounts of soyen oil, 3 00, 1 50, 0 75 nd 0 30 % of linseed oil were used, mking the dietry rtios out 1:1, 2 5:1, 5:1 nd 10:1, respetively (see Tle 2). Premix provided per kg diet: retinol ette, IU; holeliferol, 3600 IU; DL--toopherol ette, 15 IU; thimin, 3 0 mg; rioflvin, 7 8 mg; olmin, mg; pyridoxine, 3 0 mg; mendione, 3 0 mg; pntotheni id, 150 mg; niin, 30 mg; holine, 600 mg; foli id, 1 5 mg; iotin, mg; Cu (s CuSO 4.5H 2 O), 10 mg; Fe (s FeSO 4.7H 2 O), 80 mg; Zn (s ZnSO 4.7H 2 O), 80 mg; Mn (s MnSO 4.H 2 O), 10 mg; Se (s N 2 SeO 3 ), 0 30 mg; I (s KI), 0 30 mg. From eh replite, one pig ws hosen nd killed t the end of the feeding test. Blood smples were olleted vi jugulr vein punture into 10 ml tues, nd serum ws seprted y entrifugtion t 2000 g for 15 min t 48C nd then stored t 2208C until nlysis. The pigs were eletrilly stunned, exsnguinted nd eviserted. Immeditely, smples (out 5 g) of the longissimus lumorum musle nd suutneous dipose tissue disseted from the left side of the rsses were pled in liquid N 2 nd then stored t 2808C until further nlyses. Lter, skeletl musle nd ft were disseted from the right side of the rsses nd weighed seprtely. The weights were used to lulte the totl perentges of these omponents in the rsses. Mesurement of the onentrtions of sereted dipokines y ELISA The serum onentrtions of IL-6 (R&D), TNF- (Endogen), IL-1, leptin, totl diponetin (Usn) nd insulin (Merodi) were quntified using ELISA kits for porine ssy ording to the mnufturers instrutions. All the smples were mesured in six replites. Rel-time PCR Totl RNA ws extrted from the hrvested tissue using the TRIzol regent (Invitrogen). Primers for the seleted genes (Tle 2) were designed using the Oligo 6.0 softwre. RT ws performed using the AMV Reverse Trnsriptse Kit (Promeg). The reltive expression levels of the trget genes were determined using quntittive rel-time PCR, performed with n ABI 7900 PCR system (ABI Biotehnology). The finl volume of the retion mixtures (20 ml) ontined diluted omplementry DNA nd SYBR Green I (Moleulr Proes) s PCR ore regent. -Atin ws used s housekeeping gene or n internl ontrol to normlise the expression of trget genes. The reltive quntifition of gene mplifition y RT-PCR ws performed using the vlue of the threshold yle (C t ). The omprtive C t vlue method using the formul 2 2DDC t ws employed to quntify the expression levels of phosphoinositide-3-kinse- (PI3K), ftty id trnsport protein-1 (FATP-1), PPARg, IL-1, TNF- nd IL-6 reltive to those of -tin using the following formul: 2 2DDC t ðddc t ¼ C t gene of interest 2 C t -tin Þ tret 2 ðc t gene of interest 2 C t -tin Þ untret : Western lotting Tissue smples (out mg) were powdered in liquid N 2 to extrt totl protein. Approximtely 30 mg of the protein smple were size-frtionted on SDS PAGE gel nd trnsferred onto polyvinylidene difluoride memrnes (Millipore) under the onditions of 30 ma nd 48C overnight. Lter, the memrnes were loked with 5 % ovine serum lumin (BSA) for 1 h nd then proed overnight t 48C with the ntiodies ginst FATP-1 (69458; Am) t 1:800 dilution nd

3 Ftty ids nd lipid metolism nd inflmmtion 447 British Journl of Nutrition Tle 2. Primers used for rel-time PCR Genes Primers Sequenes ( ) PPARg (#2435; Cell Signling Tehnology) nd PI3K (#4255; Cell Signling Tehnology) t 1:1000 dilution. The memrnes were then rinsed with Tris-uffered sline plus 0 1 % Tween 20 three times nd inuted with peroxidse-onjugted got nti-rit or nti-mouse IgG for 1 h t 1:5000 dilution t room temperture; -tin monolonl ntiody (s47778) t 1:2000 dilution ws used to normlise the mount of proteins (Snt Cruz Biotehnology). The protein nds were visulised using hemiluminesent regent. The density of the protein nds ws determined using the Alph Imger 2200 softwre (Alph Innoteh Corportion). Sttistil nlyses All the results re expressed s mens with their stndrd errors. Sttistil nlyses were rried out using one-wy ANOVA, SAS 8.2 (SAS Institute, In.), followed y Tukey test of multiple omprisons. In se of P vlue, 0 05, differenes were onsidered to e sttistilly signifint. Results Effets of dietry PUFA rtios on the growth performne nd ody omposition of pigs The ftty id ontents of the experimentl diets re listed in Tle 3. The mesured vlues oinided etter with the Tle 3. Ftty id omposition of the diets Items 1:1 2 5:1 5:1 10:1 16 : : : : : 2n : 3n : 6n Sn-6 : Sn-3* 1 1:1 2 6:1 4 9:1 10 2:1 * ¼ (18 : 2)/(18 : 3 þ 22 : 6). Size (p) T A (8C) PI3K Forwrd CTGGACTGCCTGCGCTACTG Reverse TGGTGGTGCTGCGGTGAAT FATP-1 Forwrd GGAGTAGAGGGCAAAGCAGG Reverse AGGTCTGGCGTGGGTCAAAG PPARg Forwrd TGACCATGGTTGACACCG Reverse AAGCATGAACTCCATAGTGG IL 1 Forwrd GCTAACTACGGTGACAACAA Reverse TCTTCATCGGCTTCTCCACT TNF- Forwrd CCACGTTGTAGCCAATGTCA Reverse CAGCAAAGTCCAGATAGTCG IL-6 Forwrd TCAGTCCAGTCGCCTTCTCC Reverse GGCATTTGTGGTGGGGTTAG -Atin Forwrd TGCGGGACATCAAGGAGAAG Reverse AGTTGAAGGTGGTCTCGTGG T A, nneling temperture; PI3K, phosphoinositide-3-kinse-; FATP-1, ftty id trnsport protein-1. lulted vlues. The growth performne nd ody omposition of pigs fed diets with different PUFA rtios re summrised in Tle 4. Compred with those of the other groups, the ody weight nd dily weight gin of pigs fed the diet with n PUFA rtio of 5:1 were inresed signifintly (P, 0 05), while the dily intke nd feed onversion rte of this group were deresed (P, 0 05). However, the group fed the diet with n PUFA rtio of 1:1 hd high musle mss nd low dipose tissue mss. We speulted tht n optiml PUFA rtio ould regulte the rosstlk etween the musle nd dipose tissue of pigs. Effets of different PUFA rtios on serum gluose nd ytokine onentrtions As shown in Tle 5, the onentrtions of gluose, TNF- nd insulin were not different mong the tretment groups. The onentrtions of IL-6 nd IL-1 of pigs fed the diet with n PUFA rtio of 1:1 were deresed y 12 3 nd 37 9 % (P, 0 05), respetively, ompred with those fed diets with n PUFA rtio of 10:1. Furthermore, the serum onentrtions of diponetin of pigs fed the diet with n PUFA rtio of 1:1 were lso deresed y 13 5 % ompred with those of pigs fed the diet with n PUFA rtio of 10:1 (P, 0 05); on the ontrry, the onentrtion of leptin of this group ws inresed y 16 4 % (P, 0 05). Effets of dietry PUFA rtios on the gene expression levels of pigs The expression levels of genes in the musle nd dipose tissue of pigs re shown in Fig. 1(A) nd (B). The expression levels of PI3K mrna were lower (P, 0 05) in the groups fed diets with PUFA rtios of 1:1 nd 2 5:1, nd there ws no differene etween these two groups (P. 0 05). The expression levels of the FATP-1 gene in the musle nd dipose tissue of pigs fed diets with n PUFA rtio of 1:1 were the lowest (P, 0 05), nd those fed diets with PUFA rtios of 1:1 nd 2 5:1 exhiited down-regulted expression levels of the PPARg gene in the musle nd dipose tissue (P, 0 05); lso, there ws no differene (P, 0 05) etween these two groups. Interestingly, the diet with n PUFA rtio of 1:1 mrkedly down-regulted the expression levels of IL-1, TNF- nd IL-6 genes in the skeletl musle nd dipose tissue of pigs (P, 0 05). Effet of dietry PUFA rtios on the protein expression levels of pigs The reltive expression levels of PI3K, FATP-1 nd PPARg proteins re shown in Fig. 2(A) nd (B). The expression level of the PI3K protein ws higher in the musle of pigs fed the diet with n PUFA rtio of 10:1 (P, 0 05). The trend of the expression levels of the FATP-1 protein ws the sme s those of the gene in the musle. However, the trend of the expression levels of the FATP-1 protein in the dipose tissue ws the reverse. The diets with PUFA

4 448 Y. Dun et l. Tle 4. Effet of dietry PUFA rtios on the growth performne of pigs Items 1:1 2 5:1 5:1 10:1 SEM P Initil ody weight (kg) Finl ody weight (kg) Dily weight gin (kg/d) Feed intke (kg/d) ,0 01 Feed onversion rte (gin:feed) ,0 01 Musle mss (%)* Adipose tissue mss (%)* , , Vlues with unlike letters within row were signifintly different (P,0 05). * The rtio represents the musle or dipose tissue mss:rss weight. British Journl of Nutrition rtios of 1:1 nd 2 5:1 signifintly down-regulted the expression levels of the PPARg protein in the musle nd dipose tissue (P, 0 05), lso prtilly orresponding to the expression levels of the gene. Disussion In the present study, with n ompnying deline in the verge dily feed intke nd feed onversion rte, the finl ody weight nd dily gin of pigs fed the diet with n PUFA rtio of 5:1 improved signifintly. This result is in greement with erlier reports showing tht diet with lower PUFA rtio, rih in n-3 PUFA, is enefiil for the growth performne nd helth of nimls (12 15). The min omponents of dipose tissue re ftty ids, whih my influene the expression of dipokines, suh s diponetin nd leptin (15). Interestingly, the results of the present experiment showed tht the serum onentrtions of diponetin of pigs deresed grdully s the dietry PUFA rtio deresed. Adiponetin is n dipokine exlusively derived from the dipose tissue (16,17). It hs een reported tht fish oil rih in n-3 PUFA inreses the serum onentrtions of diponetin in mie 2 3-fold in dosedependent mnner nd lso in PPARg-dependent mnner (17). However, the present results showed tht low PUFA rtio ould redue the serum onentrtions of diponetin. The results led us to hypothesise tht the serum onentrtions of diponetin re ffeted y different rtios of dietry PUFA. Leptin irultes in the ody t onentrtion highly orrelted with white dipose tissue mss nd my e of gret importne in the regultory tion on ody ft (15,18). It hs een shown tht the serum onentrtions of leptin re signifintly redued in mie fed diets with n PUFA rtio of 1:1, ut these re not signifintly redued in mie fed diets with PUFA rtios of 5:1, 10:1 nd 20:1 (19). In the present study, the onentrtions of leptin of the group fed the diets with PUFA rtios of 1:1 nd 2 5:1 were higher, inditing tht the optiml rtio my vry in different niml models. However, no differene in the serum onentrtions of insulin ws oserved in the present study. We speulted tht PUFA rtios ould stimulte the negtive feedk regultory mehnism of diponetin nd leptin. Immune stimultion in the rering environment results in the prodution of potent pro-inflmmtory ytokines, whih ntgonise noli growth ftors nd thus suppress growth. IL-6, IL-1 nd TNF-, whih re ll inflmmtory ytokines, initite the prodution of n rry of inflmmtory meditors, thus leding to n inflmmtory response. The onentrtions of these ytokines re inresed on inresing n-6 ftty id intke nd deresed on inresing n-3 ftty id intke in ovine hondroytes nd in mouse kidney, spleen nd peritonel mrophges, s well s in humn monoytes (20). The irulting levels of IL-6 might reflet, t lest in prt, the prodution of IL-6 in the dipose tissue, lthough it is lso sereted y the exerising musle (21). The onentrtions of IL-6 derese y 10 5 % on ltering the rtio to 1 3 (22). Moreover, the onentrtions of TNF- deline signifintly y 30 % in response to flxseed oil diet rih in n-3 PUFA nd derese y 74 % fter fish oil supplementtion (23). Tle 5. Effet of dietry rtios on serum gluose nd ytokine onentrtions of pigs Items 1:1 2 5:1 5:1 10:1 SEM P Gluose (mmol/l) IL-6 (ng/ml) TNF- (ng/ml) IL-1 (ng/ml) Adiponetin (mg/ml) , Leptin (ng/ml) , Insulin (mu/ml) , Vlues with unlike letters within row were signifintly different (P,0 05).

5 Ftty ids nd lipid metolism nd inflmmtion 449 (A) Reltive mrna expression level ,,, (B) Reltive mrna expression level ,, 0 0 P13K FATP-1 PPARg IL-1 TNF- IL-6 P13K FATP-1 PPARg IL-1 TNF- IL-6 Fig. 1. Reltive expression levels of phosphoinositide-3-kinse- (PI3K), ftty id trnsport protein-1 (FATP-1), PPARg, IL-1, TNF- nd IL-6 mrna in the (A) musle nd (B) dipose tissue of pigs fed diets with PUFA rtios of 1:1 ( ), 2 5:1 ( ), 5:1 ( ) nd 10:1 ( ). Rel-time PCR method ws employed. Vlues re mens (n 6), with their stndrd errors represented y vertil rs.,, Men vlues with unlike letters were signifintly different (P,0 05). British Journl of Nutrition The present results lso indited tht higher n-3 PUFA ould redue the serum onentrtions of IL-6 s well s IL-1, ut not of TNF-. Additionlly, we lso found tht the expression levels of IL-6, IL-1 nd TNF- mrna in the skeletl musle nd dipose tissue of pigs fed the diet with n PUFA rtio 1:1 were mrkedly down-regulted. Numerous studies hve reported tht n-3 PUFA n derese the prodution of these inflmmtory ytokines (10,24,25). It hs een shown tht n optiml PUFA rtio ould regulte severl ytokines to redue inflmmtory events in the ody. The PI3K pthwy ontrols essentil ellulr funtions suh s signl trnsdution, ytoskeletl dynmis nd memrne trffiking (26). The expression levels of the PI3K gene in mononuler ells of helthy humn sujets hve een reported to derese fter supplementtion with fish oil (10). In the present study, the expression levels of PI3K gene nd protein in the musle nd dipose tissue of pigs fed the diet with n PUFA rtio of 1:1 were the lowest nd the PI3K pthwy ws tivted. In mmmls, FATP-1 trnsports long-hin ftty ids tively ross dipoyte ell memrnes. In the present study, it ws found tht the expression levels of FATP-1 mrna nd protein in the musle nd dipose tissue were down-regulted signifintly in pigs fed the diet with lower PUFA rtio. We speulted tht n-3 PUFA ould suppress dipogeni proesses y down-regulting the expression levels of FATP-1 nd the optiml dietry rtios of PUFA might e 1:1 nd 5:1. PPARg regultes genes involved in dipoyte differentition nd lipogenesis, while n-3 PUFA nd their metolites hve een shown to suppress the trnsription of lipogeni genes (A) (B) P13Kα FATP-1 PPARγ β-atin P13Kα FATP-1 PPARγ β-atin Reltive protein expression level P13Kα FARP-1 PPARγ P13Kα FARP-1 PPARγ Fig. 2. Reltive expression levels of phosphoinositide-3-kinse- (PI3K), ftty id trnsport protein-1 (FATP-1) nd PPARg proteins in the (A) musle nd (B) dipose tissue of pigs fed diets with different PUFA rtios. Western lotting method ws employed. Lnes 1, 2, 3 nd 4 represent PUFA rtios of 1:1 ( ), 2 5:1 ( ), 5:1 ( ) nd 10:1 ( ), respetively. Vlues re mens (n 6), with their stndrd errors represented y vertil rs.,, Men vlues with unlike letters were signifintly different (P,0 05). Reltive protein expression level

6 450 Y. Dun et l. British Journl of Nutrition y funtioning s nturl lignds for PPAR (27 31). Interestingly, n-3 PUFA nd their metolites n tivte the extrellulr signl-regulted kinse pthwy (29,31,32), whih primrily regultes ellulr growth nd differentition (33,34). Some previous studies hve lredy demonstrted tht PPARg lignds inhiit the prodution of IL-6, TNF- nd IL-1 (28,35,36) nd tht TNF- n inhiit dipoyte differentition nd dipogenesis y suppressing the expression of the PPARg gene (20,36). In the present study, the expression levels of PPARg gene nd protein in oth the musle nd dipose tissue of pigs fed the diets with PUFA rtios of 1:1 nd 2 5:1 were mrkedly redued. It ws oserved tht diet with lower PUFA rtio ould redue the expression levels of PPARg, whih further suppress the trnsription of lipogeni genes nd lipogenesis. Conlusion On the whole, PUFA rtios regulte lipid metolism nd inflmmtion differently nd the optiml rtios re 1:1 to 5:1, whih vry sed on the roles under onsidertions. Optiml PUFA rtios ould inhiit immune stimultion to ensure the vilility of more energy nd nutrients for high performne nd homeostti pthwys. We speulted tht there ws ommon pthwy shred y energy metolism nd inflmmtion modultion. However, further reserh is neessry to onfirm the results nd to illustrte the underlying metoli pthwys. Aknowledgements The present study ws jointly supported y the Ntionl Bsi Reserh Progrm of Chin (2013CB127305, 2012CB124704), the Nnjing Brnh Ademy of Chinese Ademy of Siene nd Jingxi Provine Coopertion Projet, the Ntionl Nture Siene Foundtion of Chin ( , ) nd the Projet of Institute of Sutropil Agriulture, the Chinese Ademy of Sienes (ISACX-LYQY-QN-1104). None of the funders hd ny role in the design nd nlysis of the study nd in the writing of this rtile. The uthors ontriutions re s follows: Y. Y., F. L. nd L. L. were in hrge of the whole tril; Y. D. nd F. L. wrote the mnusript; J. F. nd X. S. ssisted with the niml tril nd iohemil nlyses. The uthors hve no onflits of interest to delre. Referenes 1. Lim GP, Clon F, Morihr T, et l. (2005) A diet enrihed with the omeg-3 ftty id dooshexenoi id redues myloid urden in n ged Alzheimer mouse model. J Neurosi 25, Simopoulos AP (2006) Evolutionry spets of diet, the omeg-6/omeg-3 rtio nd geneti vrition: nutritionl implitions for hroni diseses. Biomed Phrmother 60, Simopoulos AP (2002) The importne of the rtio of omeg- 6/omeg-3 essentil ftty ids. Biomed Phrmother 56, Koyshi N, Brnrd RJ, Henning SM, et l. (2006) Effet of ltering dietry v-6/v-3 ftty id rtios on prostte ner memrne omposition, ylooxygense-2, nd prostglndin E2. Clin Cner Res 12, Hieln JR, Nieminen LR, Blslg TL, et l. (2006) Helthy intkes of n-3 nd n-6 ftty ids: estimtions onsidering worldwide diversity. Am J Clin Nutr 83, 1483S 1493S. 6. Gmoh S, Hshimoto M, Hossin S, et l. (2001) Chroni dministrtion of dooshexenoi id improves the performne of rdil rm mze tsk in ged rts. Clin Exp Phrmol Physiol 28, Ikemoto A, Ohishi M, Sto Y, et l. (2001) Reversiility of n-3 ftty id defiieny-indued ltertions of lerning ehvior in the rt: level of n-6 ftty ids s nother ritil ftor. J Lipid Res 42, Ctln J, Moriguhi T, Slotnik B, et l. (2002) Cognitive defiits in dooshexenoi id-defiient rts. Behv Neurosi 116, Rhej B, Sdikot SM, Phtk RB, et l. (1993) Signifine of the n-6/n-3 rtio for insulin tion in dietes. Ann N Y Ad Si 683, Wever KL, Ivester P, Seeds M, et l. (2009) Effet of dietry ftty ids on inflmmtory gene expression in helthy humns. J Biol Chem 284, Dutt-Roy AK (2000) Trnsport mehnisms for long-hin polyunsturted ftty ids in the humn plent. Am J Clin Nutr 71, Suppl., 315S 322S. 12. Newmn RE, Bryden WL, Flek E, et l. (2002) Dietry n-3 nd n-6 ftty ids lter vin metolism: metolism nd dominl ft deposition. Br J Nutr 88, Ferrini G, Buells MD, Esteve-Gri E, et l. (2008) Dietry polyunsturted ft redues skin ft s well s dominl ft in roiler hikens. Poult Si 87, Qi KK (2009) Effet of dietry v6/v3 on ftty id omposition nd met qulity in hiken. PhD Thesis, Chinese Ademy of Agriulturl Sienes, Animl Nutrition Deprtment, Beijing. 15. Drevon CA (2005) Ftty ids nd expression of dipokines. Biohim Biophys At 1740, Stefn N, Whl HG, Fritshe A, et l. (2001) Effet of the pttern of elevted free ftty ids on insulin sensitivity nd insulin seretion in helthy humns. Horm Met Res 33, Neshen S, Morino K, Rossher JC, et l. (2006) Fish oil regultes diponetin seretion y peroxisome prolifertor-tivted reeptor-g-dependent mehnism in mie. Dietes 55, Lgo F, Dieguez C, Gómez-Reino J, et l. (2007) The emerging role of dipokines s meditors of inflmmtion nd immune responses. Cytokine Growth Ftor Rev 18, Xu F, Fn CN, Zhu HY, et l. (2009) Effets of dietry rtio hnges of n-6/n-3 polyunsturted ftty ids on expression of plsm leptin in mie. J Appl Clin Peditr 24, Ti CC & Ding ST (2010) n-3 Polyunsturted ftty ids regulte lipid metolism through severl inflmmtion meditors: mehnisms nd implitions for oesity prevention. J Nutr Biohem 21, Lfontn M & Lngin D (2009) Lipolysis nd lipid moiliztion in humn dipose tissue. Prog Lipid Res 48, Rllidis L, Pshos G, Likos GK, et l. (2003) Dietry lphlinoleni id dereses C-retive protein, serum myloid A nd interleukin-6 in dyslipidemi ptients. Atheroslerosis 167,

7 Ftty ids nd lipid metolism nd inflmmtion Cughey GE, Mntzioris E, Gison RA, et l. (1996) The effet on humn tumor nerosis ftor lph nd interleukin 1 et prodution of diets enrihed in n-3 ftty ids from vegetle oil or fish oil. Am J Clin Nutr 63, Clder PC (2001) n-3 Polyunsturted ftty ids, inflmmtion, nd immunity. Lipids 36, Clder PC (2002) Dietry modifition of inflmmtion with lipids. Pro Nutr So 61, Lindmo K & Stenmrk H (2005) Regultion of memrne trffi y phosphoinositide 3-kinses. J Cell Si 119, Mdsen L, Petersen RK & Kristinsen K (2005) Regultion of dipoyte differentition nd funtion y polyunsturted ftty ids. Biohim Biophys At 1740, Mores LA, Piquers L & Bishop-Biley D (2006) Peroxisome prolifertor-tivted reeptors nd inflmmtion. Phrmol Ther 110, Feige JN, Gelmn L, Mihlik L, et l. (2006) From moleulr tion to physiologil outputs: peroxisome prolifertortivted reeptors re nuler reeptors t the rossrods of key ellulr funtions. Prog Lipid Res 45, Mihlik L, Auwerx J, Berger JP, et l. (2006) Interntionl union of phrmology. LXI. Peroxisome prolifertortivted reeptors. Phrmol Rev 58, Edwrds IJ & O Flherty JT (2008) Omeg-3 ftty ids nd PPARg in ner. PPAR Res 2008, Cmp HS, Tfuri SR & Leff T (1999) C-Jun N-terminl kinse phosphoryltes peroxisome prolifertor-tivted reeptorg1 nd negtively regultes its trnsriptionl tivity. Endorinology 140, Dormn CM & Johnson SE (1999) Ativted Rf inhiits vin myogenesis though MAPK dependent mehnism. Onogene 18, Lee MY, Jeong WJ, Oh JW, et l. (2009) NM23H2 inhiits EGF- nd Rs-indued prolifertion of NIH3T3 ells y loking the ERK pthwy. Cner Lett 275, Jing C, Ting AT & Seed B (1998) PPAR-gmm gonists inhiit prodution of monoyte inflmmtory ytokines. Nture 391, Esher P & Whli W (2000) Peroxisome prolifertor-tivted reeptors: insight into multiple ellulr funtions. Mutt Res 448, British Journl of Nutrition