Distribution, recognition and regulation of non-cpg methylation in the adult mammalian brain

Transcription

1 Distriution, reognition nd regultion of non-cpg methyltion in the dult mmmlin rin Junjie U Guo,9,, Yijing Su,,, Joo Heon Shin, Jehoon Shin,5, Hongd Li 6, Bin Xie, Chun Zhong,, Shohui Hu 7, Thu Le 8, Guoping Fn 8, Heng Zhu 7, Qing Chng 6, Yun Go,, Guo-li Ming,5 & Hongjun Song,5 npg Nture Ameri, In. All rights reserved. DNA methyltion hs ritil roles in the nervous system nd hs een trditionlly onsidered to e restrited to CpG dinuleotides in metzon genomes. Here we show tht the single se resolution DNA methylome from dult mouse dentte neurons onsists of oth CpG (~75%) nd CpH (~5%) methyltion (H = A/C/T). Neuronl CpH methyltion is onserved in humn rins, enrihed in regions of low CpG density, depleted t protein-dna intertion sites nd ntiorrelted with gene expression. Funtionlly, oth methylted CpGs (mcpgs) nd mcphs n repress trnsription in vitro nd re reognized y methyl-cpg inding protein (MeCP) in neurons in vivo. Unlike most CpG methyltion, CpH methyltion is estlished de novo during neuronl mturtion nd requires DNA methyltrnsferse A (DNMTA) for tive mintenne in postmitoti neurons. These hrteristis of CpH methyltion suggest tht sustntilly expnded proportion of the neuronl genome is under ytosine methyltion regultion nd provide new foundtion for understnding the role of this key epigeneti modifition in the nervous system. Aumulting evidene suggests ritil roles of epigeneti mehnisms, inluding oth histone nd DNA modifitions, in neuronl plstiity, neurogenesis nd neurologil nd psyhitri disorders 8. Cytosine methyltion is the predominnt ovlent modifition of eukryoti genomi DNA nd regultes trnsription in highly ell type nd genomi ontext dependent mnner 9,. In vertertes, DNA methyltion is estlished nd mintined y onserved fmily of DNMTs 9 nd n e removed in oth pssive nd tive mnners. The funtions of DNA methyltion, espeilly trnsriptionl repression, re medited in prt y fmily of methylted DNA inding proteins. Muttions in MeCP, well-hrterized CpG methyltion reder tht is highly expressed in mture neurons, led to defiits in neurl development nd neuronl funtions nd re uslly linked to Rett syndrome, severe neurodevelopmentl disorder in humns,. In metzon genomes, ytosine methyltion is thought to e restrited lrgely to the CpG dinuleotide, whih filittes mitoti trnsmission of the methyltion pttern 5,6. Notly, oth the mintenne DNMT (DNMT) nd de novo DNMTs (DNMTA nd DNMTB) hve een shown to methylte non-cpg ytosines in vitro 7,8. Previous studies hve shown tht CpH methyltion is present in ultured pluripotent stem ells, inluding emryoni stem ells (ESCs) nd indued pluripotent stem ells 9, s well s in the mouse germ line 5 7, ut is sent in most somti tissues 9,. Severl reent profiling studies hve shown the presene of CpH methyltion in the dult mouse ortex 8,9 nd humn rin 9,, whih onsist of mixtures of mny neurl sutypes. These oservtions rise importnt questions. For exmple, does CpH methyltion hve ny roles in trnsriptionl regultion in mmmlin ells, nd if so, wht protein reders my reognize CpH methyltion? In ddition, little is known out the enzymti mehnisms tht estlish nd mintin CpH methyltion in neurons. Here we generted the single se resolution neuronl DNA methyltion profile of the dult mouse dentte gyrus nd hrterized the genomi distriution of CpH methyltion. We further demonstrted tht CpH methyltion is onserved in humn rins in orthologous genes. Using plsmid reporter system, we showed tht CpH methyltion ould use trnsriptionl repression in mouse neurons. Notly, MeCP ound to mcph oth in vitro nd in neurons in vivo. In ddition, we found tht CpH methyltion ws estlished postntlly during neuronl mturtion nd required DNMTA for its tive mintenne in neurons in vivo. RESULTS Single se resolution neuronl DNA methylome To systemtilly hrterize the in vivo neuronl methylome, we purified genomi DNA from reltively homogeneous popultion of grnule neurons from the dult mouse dentte gyrus nd Institute for Cell Engineering, Johns Hopkins University Shool of Mediine, Bltimore, Mrylnd, USA. The Solomon H. Snyder Deprtment of Neurosiene, Johns Hopkins University Shool of Mediine, Bltimore, Mrylnd, USA. Deprtment of Neurology, Johns Hopkins University Shool of Mediine, Bltimore, Mrylnd, USA. Lieer Institute for Brin Development, Johns Hopkins University Shool of Mediine, Bltimore, Mrylnd, USA. 5 Grdute Progrm in Cellulr nd Moleulr Mediine, Johns Hopkins University Shool of Mediine, Bltimore, Mrylnd, USA. 6 Wismn Center, University of Wisonsin-Mdison, Mdison, Wisonsin, USA. 7 Deprtment of Phrmology nd Moleulr Sienes, Johns Hopkins University Shool of Mediine, Bltimore, Mrylnd, USA. 8 Deprtment of Humn Genetis, Dvid Geffen Shool of Mediine, University of Cliforni Los Angeles, Los Angeles, Cliforni, USA. 9 Present ddress: Whitehed Institute for Biomedil Reserh, Cmridge, Msshusetts, USA. These uthors ontriuted eqully to this work. Correspondene should e ddressed to H.S. (shongju@jhmi.edu). Reeived Otoer; epted 9 Novemer; pulished online Deemer ; doi:.8/nn.67 nture NEUROSCIENCE VOLUME 7 NUMBER FEBRUARY 5

2 Figure Pervsive CpH methyltion in the in vivo DNA methylome of dult dentte grnule neurons. () Composition of ll methylted ytosine loi in the genome of dult mouse dentte grnule neurons. () Sensitivity to FspEI digestion, mesured y quntittive PCR using primers flnking the predited digestion sites (Supplementry Tle ), of genomi DNA smples from dult dentte grnule neurons tht were digested t methylted C m C motifs y FspEI. Vlues represent the men ± s.e.m. (n = ). Bisulfite-Seq results for eh region re indited y gry rs. () Four CpH-methylted loi tht were further exmined y Snger isulfite sequening in independent dult mouse dentte gyrus nd spleen smples, s well s in FACS-sorted NeuN + neuronl nulei. Eh row represents one DNA lone. Eh olumn represents one methylted ytosine site. Unmethylted nd methylted ytosines re represented y open nd filled oxes, respetively. CpG nd CpH methyltion re olor oded (lk, CpG; red, CpH). Corresponding Bisulfite-Seq results re shown t the top. Bisulfite-Seq (%) mchg % mchh % 5 mcpg 75% FspEI sensitivity (%) C m CH C m CG Lr Cr Ptprt Slmo Lgr6 Phf7 Bisulfite-Seq Dentte gyrus Spleen Cql ( ) Opml (+) Lr (+) Sox6 (+) npg Nture Ameri, In. All rights reserved. performed whole-genome isulfite sequening (Bisulfite-Seq) for two iologil replites. We otined totl of ~ G of sequenes ( -p pired-end reds; ~6 overge per strnd) tht were uniquely mpped to the in silio isulfite-onverted mouse genome with no mismth. To identify signifintly methylted ytosines genome wide, we used stringent inomil distriution sed filter to eliminte flse positives from inomplete isulfite onversion nd sequening errors. Our nlysis pipeline onfirmed the previous finding tht CpH methyltion is present in humn ESCs ut not firolsts (dt not shown). Notly, our nlysis lso reveled tht ~5% of ll methylted ytosine loi in the dult mouse dentte neuronl genome were mcphs (Fig. ), whih onsisted of ~% mchgs nd ~% mchhs, with mchgs eing under-represented (P < 5, χ test). Glol CpG nd CpH methyltion levels were similr mong utosomes, wheres sex hromosomes exhiited the lowest levels of CpH methyltion (Supplementry Fig. ). Methyltion levels of individul mcphs nd mcpgs etween two iologil replites were highly orrelted (Supplementry Fig. ). We next seleted group of loi with high levels of CpH methyltion for more detiled nlyses. Bisulfite onversion independent mesurements using methyltion-dependent restrition enzyme, FspEI, whih seletively digests C m C motifs, onfirmed the presene of mcph in the dult dentte gyrus (Fig. nd Supplementry Tle ). Snger isulfite sequening in independent smples lso onfirmed the presene of CpH methyltion t seleted loi in the dult mouse dentte gyrus (Fig. nd Supplementry Tle ). CpH methyltion t these loi ws virtully sent in mouse spleen, wheres methyltion of the exmined CpG loi ws lrgely onserved (Fig. ). In ontrst to CpG methyltion, CpH methyltion ws pprently heterogeneous mong different lleles from homogenous popultion of neurons, lthough it did not segregte lerly into hypermethylted nd hypomethylted lleles (Fig. ). To exlude the potentil ontriution from non-neuronl ells, suh s neurl progenitors, stroytes nd oligodendroytes, we nlyzed the genomi DNA of fluoresene-tivted ell sorting (FACS)-purified NeuN + neuronl nulei from the dult dentte gyrus nd oserved similr levels of CpG nd CpH methyltion (Fig. ). Therefore, our study omprehensively nd relily identified lrge numer of mcphs in the dult mouse dentte neuronl DNA methylome in vivo. Conservtion of CpH methyltion in dult humn rins To exmine whether neuronl CpH methyltion identified in mouse genomi DNA ws onserved in other mmmls, we performed Snger isulfite sequening in the orthologous genomi regions using dult humn rin nd spleen DNA smples (Supplementry Tle ). Despite tht most of these regions exhiited different CpG ptterns, Dentte gyrus NeuN + Spleen Methylted CpG Unmethylted CpG Methylted CpH Unmethylted CpH we oserved highly reproduile levels of CpH nd CpG methyltion in ll orthologous regions exmined using dult humn rin genomi DNA from different individuls ut not using spleen DNA (Fig.,), suggesting the evolutionry onservtion of neuronl CpH methyltion. To extend this finding to the genome sle, we nlyzed the redued representtion isulfite sequening (RRBS) dt generted y the Enylopedi of DNA Elements (ENCODE) onsortium nd oserved muh higher glol levels of CpH methyltion in the humn rin nd plent thn in other somti tissues (Fig. ). We then foused on genes with ler one-to-one orthologs in humn nd mouse (5,7 ortholog pirs in totl) nd quntified the degree of overlp of CpH-methylted genes (genes tht ontined mcphs with 5% methyltion levels) in humn nd mouse rins. Although RRBS did not provide high overge genome wide, nd therefore fewer genes were identified s eing CpH methylted in the humn rin thn in the mouse rin, mjority (~8%) of the humn CpH-methylted genes hd orthologs tht were lso CpH-methylted in the mouse rin (Fig. d). Together these results indite not only tht CpH methyltion widely exists in mmmlin neurons ut lso tht it mrks onserved sets of genes in oth mie nd humns. Genomi fetures of neuronl CpH methyltion To hrterize the genome-wide distriution of CpH methyltion in dult dentte neurons, we foused on high-overge ( ) ytosines for detiled ioinformti nlyses. Unlike individul mcpgs, whih exhiited imodl distriution of methyltion levels, we oserved intermedite methyltion levels (mostly ~5%) in most mchgs nd mchhs (Fig. ), suggesting tht only frtion of ll lleles were methylted t the stedy stte. Although most mchgs nd mchhs were djent to highly methylted CpGs (Supplementry Fig. ), hromosome-wide view of three lsses of ytosine methyltion 6 VOLUME 7 NUMBER FEBRUARY nture NEUROSCIENCE

3 npg Nture Ameri, In. All rights reserved. Figure Conserved CpH methyltion in orthologous regions of the humn rin DNA. () Snger isulfite sequening results of orthologous regions in dult humn rin nd spleen genomi DNA. () Consistent levels of CpH methyltion in multiple dult humn ortil genomi DNA smples (Ctx Ctx). mc, methylted ytosine. () RRBS dt generted y the ENCODE projet nlyzed using the mitohondril CpH methyltion rte (~%) s the kground proility. The perentge of mcpg/mcph ws orreted y the flse disovery rte (FDR) estimted y inomil distriution. (d) Quntifition of the numers of mcphs for eh of the 5,7 one-to-one orthologous gene pirs etween mouse nd humn (Enseml nnottions). A gene ws onsidered to e CpH methylted if two or more CpHs were 5% methylted (the P vlue is indited; χ test). (CpG, CHG nd CHH) showed tht the orreltion etween CHG nd CHH methyltion ws muh higher thn tht etween CpG nd CpH methyltion (Fig. nd Supplementry Fig. ), mostly euse of regions with high levels of CpG methyltion ut low levels of CpH methyltion. Motif nlysis identified prominent CAC preferene for CpH methyltion in neurons (Fig. ). The preferene for denine t the + position would predit symmetri methyltion ptterns on two DNA strnds. Indeed, lthough genome-wide CpG methyltion on two strnds ws highly orrelted, the orreltions were muh weker for CHG nd CHH methyltion (Supplementry Fig. ). Also s predited y the CpA preferene, for eh mchg (mostly CAG), the ytosine t the + position in the opposite strnd (mostly CTG) ws rrely methylted (Supplementry Fig. ). In ontrst to the distint sping ptterns of mchg nd mchh found in ESCs, the sme nlysis showed similr 8-p sping for oth mchgs nd mchhs in neurons (Fig. d nd Supplementry Fig. 5), suggesting ommon mehnism regulting CHG nd CHH methyltion in neurons. In ddition, we oserved periodiity of ~8 p for neuronl mcphs (Fig. d), supporting previous findings on the reltionship etween DNA methyltion nd nuleosome positioning 5. Notly, mcphs preferentilly resided in regions of low CpG density (Fig. e), with ~8% of mcphs hving no Frtion of mcs d mcphs mcpg, mchg nd mchh.5.5 Bits, mc/c (%) +8 Distne from mc (p) 85 mc/c (%) mc/c (%) mc/c (%) Refseq genes CpG CHG CHH 6 8, 5 Distne from mcph (p) e Frtion of mcs.. Chr mcph mcpg CpGs per 5 p CQL ( ) OPCML ( ) LRBA ( ) SOX6 (+) 8 8 Brin Spleen mcs per lone Perentge of CpHs Perentge of CpGs Ctx CQL ( ) OPCML ( ) LRBA ( ) SOX6 (+) Ctx- Ctx- Brin Brest Ctx- Ctx- Ctx- mcph mcpg Ctx- Ctx- Kidney Liver Lung Pnres Perirdium Plent Skin Stomh CpH-methylted genes Humn neighoring CpGs within 5-p flnking sequenes, rising the possiility of mcpg-independent role for mcphs in these regions of low CpG density. Antiorreltion etween mcph nd gene expression To egin to understnd the potentil funtion of CpH methyltion in neurons, we first exmined its reltionship with neuronl protein- DNA intertions. Both CpGs nd CpHs were hypomethylted round neuronl trnsription ftor inding sites tht hve een identified previously in neurons 6 (Fig. nd Supplementry Tle ), suggesting tht protein-dna intertions exhiit similr effets on CpGs nd CpHs in preventing de novo DNA methyltion nd/or using tive DNA demethyltion. In ontrst, hypomethyltion of neuronl DNA t ESC-speifi trnsription ftor inding sites 7 ws muh less pronouned in neurons (Supplementry Fig. 6). Similr to round neuronl trnsription ftor inding sites, oth CpGs nd CpHs were hypomethylted round trnsription strt sites (TSSs; Fig. ). To further understnd the potentil role of CpH methyltion in trnsriptionl regultion, we profiled gene expression in the dult mouse dentte gyrus y mrna-seq (~9 million reds from three iologil replites). In ontrst to ESCs nd onsistent with previous results from mixed popultion of neurl ells 8,9, oth Ctx- Testis Ctx- d Ctx- Ctx- 65 P <. 6,995 Mouse CpG CpH Figure Genomi fetures of the neuronl CpH methyltion. () Distriutions of the methyltion levels of mcpg (lk), mchg (lue) nd mchh (red) in the genome of dult mouse dentte grnule neurons. () Motif nlysis of ll mcphs, with methylted ytosines in position. () A hromosome-wide view of three types of methylted ytosines on hromosome (hr). Methyltion levels were moving verged y -k windows. Refseq trnsript nnottion is shown t the ottom. (d) Sping nlysis of djent mcphs. The ui spline smoothing urve is shown. Supplementry Figure 5 shows the omprison etween dult dentte grnule neurons nd ESCs. (e) Reltionship etween mcpg or mcph ourrene nd their lol CpG densities. nture NEUROSCIENCE VOLUME 7 NUMBER FEBRUARY 7

4 npg Nture Ameri, In. All rights reserved. Figure Reltionship etween CpH methyltion nd protein-dna intertion or gene expression in vivo. () Averged methyltion levels t previously profiled protein-dna intertion sites. The dt referenes for protein-dna intertions re listed in Supplementry Tle. CBP, CREB-inding protein; CREB, AMP responsive element inding protein; NPAS, neuronl PAS domin protein ; POL, RNA polymerse II; SRF, serum response element inding trnsription ftor; CTCF, CCCTCinding ftor. () Averged methyltion levels ross ll nnotted genes strtified y their mrna levels in the dult mouse dentte gyrus. Both CpG nd CpH methyltion were ntiorrelted with expression levels of ssoited genes. PAS, poly(a) site; RPKM, reds per kilose of exon model per million mpped reds. Supplementry Figure 7 shows the ntiorreltion etween CpH methyltion in lotions fr from CpGs in regultory regions nd gene expression. neuronl CpG nd CpH methyltion ntiorrelted with the ssoited gene expression levels throughout the 5 -upstrem, gene-ody nd -downstrem regions in dentte grnule neurons (Fig. ). To minimize the ontriution from nery mcpgs, we foused on the ~8%, or 7,6, mcphs tht did not hve ny neighoring CpGs within 5-p flnking sequenes (Fig. e). Of these CpG-fr mcphs, 95, nd were loted within k of extrgeni enhners, intrgeni enhners 6 nd TSSs, respetively. Notly, these mcph-ontining regultory regions loted fr from CpGs were lso ssoited with signifintly lower nerest-gene expression levels s ompred to orresponding kground gene sets (P < 6 ; Supplementry Fig. 7), further suggesting potentil funtion of CpH methyltion in trnsriptionl repression. Repression of reporter gene expression y mcph To ssess diretly the intrinsi pity of CpH methyltion in trnsriptionl repression, we modified well-estlished quntittive reporter ssy using in vitro methylted plsmids,,8,9. We methylted GFP-expressing plsmids t speifi lotions using pnel of teril DNMTs efore o-trnsfetion with unmethylted RFP expression plsmids into HEK9 ells (Supplementry Fig. 8) or ultured mouse hippompl neurons (Fig. 5). Notly, with the sme density of methylted ytosine, CpH methyltion y M.MspI ( m CCGG) used similr degree of repression ompred to CpG methyltion y M.HpII (C m CGG; Fig. 5 nd Supplementry Fig. 8). In ddition, GpC methyltion y M.CviPI (G m C), most of whih resided in the CpH ontext, used similr repression s CpG methyltion y M.SssI ( m CG; Fig. 5 nd Supplementry Fig. 8). The strong repression used y GpC methyltion ws not due simply to the overlpping CpGs (G m CGs), s the repression used y M.SssItlyzed CpG methyltion ould e further strengthened y either M.MspI or M.CviPI methyltion (Supplementry Fig. 8). None of these methyltion ptterns showed detetle effets on trnsfetion effiienies (Fig. 5 nd Supplementry Fig. 8). Bisulfite sequening RFP GFP Phse RFP ontrol vetor Mouse hippompl neurons Mok GFP vetor In vitro methyltion nd purifition Trnsfetion y eletroportion week M.Hpll (C m CGG) M.Mspl ( m CCGG) M.Sssl ( m CG) M.CviPI (G m C) mcpg/cpg (%) Methyltion (%) CBP CREB NPAS POL SRF CTCF Distne from inding sites (k) CpG CpH 5K TSS PAS +5K 5K TSS PAS +5K Gene expression (RPKM) of plsmid DNA reovered fter trnsfetion showed high effiienies of ll types of in vitro methyltion nd no de novo CpG methyltion in CpH-methylted plsmids (Supplementry Fig. 8), inditing tht CpH methyltion did not repress GFP expression indiretly y induing CpG methyltion. Although in vitro methyltion did not fully repitulte endogenous CpH methyltion ptterns, these results suggested tht mcpgs nd mcphs oth hve the intrinsi pity to repress trnsription in mmmlin ells, inluding in neurons. Reognition of mcph y MeCP in vitro nd in vivo MeCP hs een well estlished to reognize mcpgs nd regulte gene expression in the nervous system,. Aross the genome, oth CpGs nd CpHs were hypermethylted ner MeCP-ound regions tht were previously determined y hromtin immunopreipittion (ChIP) in neurons (Fig. 6). We diretly tested the inding pity of reominnt MeCP protein to synthetilly methylted oligonuleotides y eletrophoreti moility shift ssy (EMSA). MeCP exhiited ler inding to mcpg-ontining oligonuleotides (Fig. 6). Notly, MeCP lso ound to CpH-methylted oligonuleotides with lower ffinity in the sene of ny mcpgs. Furthermore, the presene of oth mcpgs nd mcphs gretly enhned MeCP inding (Fig. 6). In ontrst, nother methyl-cpg inding domin (MBD) protein, MBD, exhiited higher seletivity towrd mcpgs nd ound minimlly to CpH-methylted oligonuleotides in this ssy, lthough the oexistene of mcpgs nd mcphs lso enhned MBD inding (Supplementry Fig. 9). To determine physiologilly whether endogenous MeCP reognizes mcphs in vivo, we exmined the methyltion ptterns of endogenous MeCP-ound DNA y isulfite sequening of the MeCP ChIP DNA from the dult mouse hippompus. Consistent with previous studies, MeCP ChIP seletively enrihed CpG-methylted lleles t given lous (Fig. 6). Notly, CpH-methylted regions Imging nd quntifition GFP + /RFP + (%) 5 P =.8 P =. P =. 6 P =.8 6 Mok M.Hpll M.Mspl M.Sssl M.CviPI..5 Figure 5 Repression of reporter gene expression y CpH methyltion in neurons. () A shemti digrm of the experimentl design of the in vitro methylted plsmid reporter ssy. () Representtive phseontrst nd immunofluoresene imges of ultured hippompl neurons o-trnsfeted with n unmethylted RFP plsmid nd GFP plsmids with different methyltion ptterns (left). Sle r, 5 µm. Also shown is quntifition of the perentges of GFP + RFP + neurons mong ll RFP + neurons (right). Vlues represent the men ± s.e.m. (n = ; P vlues re indited for eh ondition; one-wy nlysis of vrine nd Tukey s test). mcph/cph (%) 8 VOLUME 7 NUMBER FEBRUARY nture neuroscience

5 npg Nture Ameri, In. All rights reserved. Figure 6 Reognition of CpH methyltion y MeCP in vitro nd in vivo. () Neuronl CpG (top) nd CpH (ottom) methyltion levels verged round MeCP-ound regions previously determined using whole-mouse rins. () EMSA nlysis using four oligonuleotide proes methylted t the speifi positions indited in old (top). Quntifition of MeCP-ound oligonuleotides is lso shown (ottom). Vlues represent the men ± s.e.m. (n = ). The results for MBD re shown in Supplementry Figure 9. () MeCP ChIP isulfite sequening nlysis of unmethylted, CpG-methylted nd CpH-unmethylted, nd CpH-methylted regions in the dult mouse hippompus. The levels of CpH methyltion in the ltter regions were signifintly higher in ChIP smples thn in the input DNA from the dult mouse hippompus (P vlues re indited; Fisher s ext test). tht were depleted of CpGs were lso highly enrihed in the MeCP- ound hromtin (Fig. 6), supporting the in vivo intertion etween MeCP nd mcphs in neurons. mcph estlishment nd mintenne in vivo We next exmined the developmentl timing of CpH methyltion in neurons. Consistent with reent study of the ortex 9, timeourse nlyses reveled tht CpH methyltion t the seleted loi ws estlished during postntl development of the hippompus nd ws then present throughout life, wheres CpG methyltion ws estlished during erly development (Fig. 7). Mturing mouse hippompl neurons in vitro lso showed grdul inrese in CpH, ut not CpG, methyltion over time (Fig. 7). Furthermore, CpH methyltion levels in the dult humn rin DNA were muh higher thn those in fetl rin smples nd in dult nd fetl humn hert DNA (Fig. 7). Together these results indite tht, in ontrst to most CpG methyltion 5, CpH methyltion is estlished during postntl neuronl mturtion in oth mouse nd humn rins. mcs per hone mcs per lone mcs per lone mcs per lone 9 6 E Fzd Cql Lr CpH Cql ( ) P =. CpG FZD (+) LRBA ( ) 8 P P P7 OPCML ( ) P P56 yer yers E mcpg mcph Fzd (+) P =.85 P P P7 SOX6 (+) P P56 yer yers Lr (+) P = 7. 6 DIV 7 DIV DIV 7 DIV DIV 7 DIV Fetl hert Adult hert Fetl rin Adult rin Fetl hert Adult hert Fetl rin Adult rin Methyltion (%) Methyltion (%) Input MeCP ound 8 79 CpG 78 5K.. CpH Bdnf IV FgfB Hd Megf Bi Smd Sox6 Not mplified 5K.97 5K Distne from 5K MeCP inding sites Reltive intensity MeCP iotin - - No mc MeCP protein 5 ng 5 ng ng No mc mcpg mcpg mcph mcph mcpg + mcph mcpg mcph mcpg + mcph P = <. <. <. <. We then exmined the regultion of CpH methyltion in postmitoti neurons in vivo. Conditionl neuronl triple knokout of Dnmt, Dnmt nd Dnmt (CmKIIα-Cre) led to preferentil loss of CpH methyltion in the postntl hippompus, wheres CpG methyltion ws only modestly redued, s hs een oserved previously (Fig. 8). Among the three DNMTs, DNMT nd DNMTA re expressed t higher levels in postmitoti neurons. To determine their individul roles in mintining neuronl CpH methyltion in vivo, we injeted deno-ssoited viruses (AAVs) expressing short hirpin RNAs (shrnas) tht speifilly trgeted DNMT or DNMTA into the dentte gyrus of dult wild-type mie (Supplementry Fig. ). DNMTA knokdown led to signifint redution in CpH, ut not CpG, methyltion t these loi, wheres DNMT knokdown showed little effet (Fig. 8). Notly, the preferentil loss of CpH methyltion used y DNMTA knokdown ws ompnied y the signifint derepression of the mrna expression of these CpH-methylted genes (Fig. 8), wheres we oserved no methyltion or mrna expression hnges in unmethylted gene (Bdnf IV) or CpG-methylted nd CpH-unmethylted genes (Bdnf IX nd FgfB; Supplementry Fig. ). Furthermore, DNMTA ChIP nlysis showed tht CpH-methylted regions were ound y DNMTA in dentte neurons in vivo (Supplementry Fig. nd Supplementry Tle e). These results strongly support physiologil role of CpH methyltion in the repression of gene expression Figure 7 Estlishment of CpH methyltion during neuronl mturtion. () Progression of CpH (left) nd CpG (right) methyltion levels in the mouse rin t eight developmentl time points. Vlues represent the mens (n = ). P, postntl dy; E, emryoni dy. () CpG nd CpH methyltion in mouse hippompl neuronl ultures mesured fter 7 or dys in vitro (DIV). Vlues represent the men ± s.e.m. (n = ; P vlues re indited; Student s t test). () CpG nd CpH methyltion in fetl nd dult humn tissues (n = ). nture NEUROSCIENCE VOLUME 7 NUMBER FEBRUARY 9

6 npg Nture Ameri, In. All rights reserved. Figure 8 Neuronl CpH methyltion is tively mintined y DNMTA nd regultes endogenous gene expression in vivo. () CpH methyltion levels were signifintly deresed in postntl smples with neuronspeifi Dnmt, Dnmt nd Dnmt triple knokout (DNMT-TKO; CmKIIα-Cre). Smples from the dult hippompus were exmined (P vlues re indited; Fisher s ext test). () Requirement of DNMTA for mintenne of CpH methyltion in the dult dentte gyrus. Shown is DNA methyltion from mirodisseted dentte gyri mesured week fter AAVs expressing different shrnas were stereotxilly injeted into the dult mouse dentte gyrus. Vlues represent the men ± s.e.m. (n = ; P vlues re indited; Student s t test). sh-control, ontrol shrna; sh-dnmt nd sh-dnmt, shrnas ginst Dnmt nd Dnmt, respetively. () mrna expression of CpH-methylted genes fter DNMTA knokdown. Vlues represent the men ± s.e.m. (n = ; P vlues re indited; Student s t test). Supplementry Figure shows the results for unmethylted nd CpG-methylted nd CpH-unmethylted genes. in neurons in vivo. To exmine whether differenes in de novo DNMT expression ould explin the rin-speifi umultion of CpH methyltion, we mesured the reltive expression levels of DNMTs in vriety of mouse tissues. Surprisingly, we found similr expression level of DNMTA nd muh lower expression levels of DNMTA nd DNMTB in the rin ompred to in other tissues without CpH methyltion (Supplementry Fig. ). Colletively these results suggest tht ontinuous DNMTA expression is required ut not suffiient to umulte neuronl CpH methyltion in vivo. DISCUSSION Our systemti nlysis of the in vivo neuronl methylome from the dult mouse dentte gyrus t single-se resolution nd susequent mehnisti studies generted new insights into the genomi fetures, onservtion, potentil funtion, reder nd regultor of CpH methyltion in the dult mmmlin rin. Given tht CpGs only represent % of the metzon genome, CpH methyltion gretly expnds the proportion of the neuronl genome tht is sujet to regultion y ytosine methyltion nd is new mehnism of neuronl trnsription regultion. Our study provided numer of findings tht hve importnt implitions for the future understnding of this epigeneti modifition in the nervous system. In ontrst to previous profiling studies 8, we otined single se resolution DNA methylomes from in vivo dult dentte gyrus preprtions, with the vst mjority of ells onsisting of single neuronl sutype, therey providing unique resoure for the field. In dult dentte neurons, CpH methyltion ounted for ~5% of ll methylted ytosines, whih is similr to reent findings in the mouse ortex 8 nd humn pluripotent stem ells in vitro 9. Our study reveled some ler distintions etween mcphs in the rin nd those in pluripotent stem ells (Supplementry Fig. ). For exmple, the preferene of mchgs over mchhs nd the 8-, -, 9-p sping pttern of mchgs in proliferting pluripotent stem ells re sent in postmitoti neurons. Insted, their highly orrelted genomi distriutions, identil 8-p sping (reminisent of the DNMTA-DNMTL omplex ) nd requirement for DNMTA for tive mintenne suggest tht mchg nd mchh re similrly regulted in neurons. Although the isulfite sequening pproh does not differentite etween methylted ytosine nd hydroxymethylytosine (hmc), the vst mjority of stedy-stte mcphs re unlikely to e hydroxymethylted. Reent single se resolution hmc studies hve shown very low levels of hmcphs in pluripotent stem ells nd in the rin 9,,. In ddition, mcphs nd hmcs exhiit opposite orreltions with gene expression 5. Cql ( ) Fzd (+) Lr (+) WT DNMT-TKO mcphs per lone mcpgs per lone Reltive expression (log sle) P =.76 Cql ( ) Fzd (+) Lr (+) 8 P =. 6 P =. P =. P =.5 Cql P =. P =.5 Fzd Our study provides the first evidene, to our knowledge, of the potentil funtion of CpH methyltion in the nervous system. In plsmid reporter ssy, mcphs were suffiient to repress gene trnsription in ultured neurons s effetively s mcpgs. Although in vitro methyltion ws omplete nd symmetri, wheres endogenous CpH methyltion ws mostly intermedite nd symmetri, our results suggest n intrinsi pity of mcphs to repress trnsription independently of CpG ontexts. The derepression of CpH-methylted genes fter DNMTA knokdown, whih preferentilly deresed CpH, ut not CpG, methyltion provided physiologil evidene for ritil role of CpH methyltion in repressing gene expression in vivo. We further showed genome-wide ntiorreltion etween CpH methyltion levels nd the ssoited gene expression, inluding mcphs in regultory genomi regions without ny nery CpGs. Reent studies hve shown dynmi hnges of neuronl DNA methyltion in development, mturtion, plstiity, lerning memory nd rin disorders 7,8. Notly, oth CpGs nd CpHs re sustrtes for methyltion 6,7 nd demethyltion. Our results suggest tht mcphs re more dynmi popultion in the neuronl DNA methylome in vivo. When de novo DNMT tivities were deresed, CpH methyltion ws preferentilly lost efore CpG methyltion showed ny hnges. The pprently higher turnover of mcphs thn mcpgs ould e due to either or oth of two possiilities. First, demethyltion of mcphs ould e more effiient thn tht of mcpgs. Our previous in vitro study using fully hydroxymethylted DNA indited tht hmcphs were more effiiently demethylted thn hmcpgs y pproximtely fourfold in mmmlin ells. Seond, remethyltion of CpG ould e more effiient thn tht of CpH. Beuse demethyltion is medited y se-exision repir mehnism in strnd-speifi mnner, demethyltion of mcpg would first generte hemimethylted CpG, whih ould e Lr Sox6 (+).5 < sh-control sh-dnmt sh-dnmt sh-control sh-dnmt sh-dnmt 5 sh-control sh-dnmt sh-dnmt sh-control sh-dnmt VOLUME 7 NUMBER FEBRUARY nture neuroscience

7 npg Nture Ameri, In. All rights reserved. redily remethylted y DNMT. In ontrst, mcph, one demethylted, n only e remethylted de novo y DNMTA. The pprent heterogeneous methyltion ptterns of mcphs in neurons (Fig. ) my e result of their dynmi turnover, with only frtion of ll lleles ptured in the methylted sttus t the stedy stte. It will e interesting for future studies to ddress how DNMTA nd DNA demethylses re trgeted speifilly to mcph loi nd the iologil importne of the dynmi turnover of mcphs in the neuronl gene expression progrm. It lso remins to e investigted to wht extent CpH methyltion medites the unique nd essentil role of DNMTA in postntl development nd funtions of the nervous system,8. Notly, DNMTA hs een shown to regulte emotionl ehvior nd spine plstiity in the nuleus umens 9. Our study pinpointed the developmentl timing of CpH methyltion during neuronl mturtion nd identified MeCP s the first mcph inding protein in vitro nd in vivo. Despite the widely reognized importne of MeCP s DNA methyltion reder for mcpgs 5 nd, more reently, for hmcpgs 5, little is known out how it tully reds DNA methyltion on fine sle. Our results from the in vitro inding ssy nd in vivo ChIP isulfite sequening ssys shed light onto this fundmentl question diretly. Interestingly, the timing of the postntl onset of Rett syndrome oinides with the emergene of CpH, ut not CpG, methyltion in neurons. Our finding of strong influene of mcph on MeCP inding in neurons in vivo indites new diretion for understnding the iology of MeCP nd the mehnisms underlying MeCP-relted mentl disorders. Cytosine methyltion hs ritil roles in regulting gene expression under oth physiologil nd pthologil onditions. Although CpG methyltion ours more frequently on verge ross the genome, lrge frtions of mmmlin genomes re devoid of CpGs. Our oservtion of preferentil CpH methyltion in these CpG-depleted regions suggests tht CpH methyltion might ompenste t lest prtilly for the lk of CpGs nd inrese the lol density of methylted ytosine in neurons without dding onstitutively methylted new CpG dinuleotides in the genome. We oserved suh ompenstory effet not only in the trnsriptionl regultory effets of mcpgs nd mcphs ut lso in MeCP inding, whih ws gretly enhned when mcpg nd mcph were djent to eh other. In summry, CpH methyltion gretly expnds the proportion of the neuronl genome tht is under regultion y ytosine methyltion nd is new lyer of epigeneti modultion of the neuronl genome. The newly identified hrteristis of CpH methyltion point to new diretions for future understnding of this epigeneti modifition in neuronl identity, development nd plstiity nd in psyhitri nd neurologil disorders. Methods Methods nd ny ssoited referenes re ville in the online version of the pper. Aession odes. NCBI Gene Expression Omnius: GSE5. Note: Any Supplementry Informtion nd Soure Dt files re ville in the online version of the pper. Aknowledgments We thnk S. Bylin, D. Ginty nd memers of the Song nd Ming lortories for omments nd suggestions nd Y. Ci nd L. Liu for tehnil support. This work ws supported y the US Ntionl Institutes of Helth (NIH) (NS7, ES957 nd MH8787), the Simons Foundtion Autism Reserh Inititive nd NARSAD to H.S., y the NIH (HD698 nd NS87), the Mrylnd Stem Cell Reserh Fund (MSCRF), the Dr. Mirim nd Sheldon G. Adelson Medil Reserh Foundtion nd NARSAD to G.-l.M., y the Lieer Institute fund to Y.G., y NIH (HD67, HD6656) to Q.C. nd y NIH (NS79) to G.F.; J.U.G. is Dmon Runyon Fellow supported y the Dmon Runyon Cner Reserh Foundtion. Y.S. nd C.Z. were supported y MSCRF postdotorl fellowships; J.S. ws supported y Smsung Sholrship. AUTHOR CONTRIBUTIONS J.U.G. nd Y.S. onduted most of the experiments. Y.S. onstruted the lirries, nd J.U.G. performed the ioinformti nlyses. J.H.S., B.X. nd Y.G. ssisted with high-throughput sequening. J.S. ontriuted to the EMSA nd ChIP experiments. H.L. nd Q.C. provided the MeCP-ChIP smples. C.Z. performed the shrna experiment. S.H. nd H.Z. ssisted with the EMSA experiments. T.L. nd G.F. provided the DNMT-TKO smples. Y.G., G.-l.M. nd H.S. supervised the projet. J.U.G., G.-l.M. nd H.S. wrote the mnusript. All of the uthors disussed results nd ommented on the mnusript. COMPETING FINANCIAL INTERESTS The uthors delre no ompeting finnil interests. Reprints nd permissions informtion is ville online t reprints/index.html.. Borrelli, E., Nestler, E.J., Allis, C.D. & Sssone-Corsi, P. Deoding the epigeneti lnguge of neuronl plstiity. Neuron 6, (8).. Feng, J. & Fn, G. The role of DNA methyltion in the entrl nervous system nd neuropsyhitri disorders. Int. Rev. Neuroiol. 89, 67 8 (9).. Dy, J.J. & Swett, J.D. DNA methyltion nd memory formtion. Nt. Neurosi., 9 ().. Zhng, T.Y. & Meney, M.J. Epigenetis nd the environmentl regultion of the genome nd its funtion. Annu. Rev. Psyhol. 6, 9 66, C C (). 5. M, D.K. et l. Epigeneti horeogrphers of neurogenesis in the dult mmmlin rin. Nt. Neurosi., 8 (). 6. Nelson, E.D. & Monteggi, L.M. Epigenetis in the mture mmmlin rin: effets on ehvior nd synpti trnsmission. Neuroiol. Lern. Mem. 96, 5 6 (). 7. Gräff, J., Kim, D., Doin, M.M. & Tsi, L.H. Epigeneti regultion of gene expression in physiologil nd pthologil rin proesses. Physiol. Rev. 9, 6 69 (). 8. Telese, F., Gmliel, A., Skowronsk-Krwzyk, D., Gri-Bssets, I. & Rosenfeld, M.G. Seq-ing insights into the epigenetis of neuronl gene regultion. Neuron 77, 66 6 (). 9. Bird, A. DNA methyltion ptterns nd epigeneti memory. Genes Dev. 6, 6 ().. Lw, J.A. & Josen, S.E. Estlishing, mintining nd modifying DNA methyltion ptterns in plnts nd nimls. Nt. Rev. Genet., ().. Wu, S.C. & Zhng, Y. Ative DNA demethyltion: mny rods led to Rome. Nt. Rev. Mol. Cell Biol., 67 6 ().. Klose, R.J. & Bird, A.P. Genomi DNA methyltion: the mrk nd its meditors. Trends Biohem. Si., (6).. Chhrour, M. & Zoghi, H.Y. The story of Rett syndrome: from lini to neuroiology. Neuron 56, 7 (7).. Guy, J., Chevl, H., Selfridge, J. & Bird, A. The role of MeCP in the rin. Annu. Rev. Cell Dev. Biol. 7, 6 65 (). 5. Hollidy, R. & Pugh, J.E. DNA modifition mehnisms nd gene tivity during development. Siene 87, 6 (975). 6. Jones, P.A. & Ling, G. Rethinking how DNA methyltion ptterns re mintined. Nt. Rev. Genet., 85 8 (9). 7. Yokohi, T. & Roertson, K.D. Preferentil methyltion of unmethylted DNA y mmmlin de novo DNA methyltrnsferse Dnmt. J. Biol. Chem. 77, (). 8. Yoder, J.A., Somn, N.S., Verdine, G.L. & Bestor, T.H. DNA (ytosine-5)- methyltrnsferses in mouse ells nd tissues. Studies with mehnism-sed proe. J. Mol. Biol. 7, (997). 9. Rmshoye, B.H. et l. Non-CpG methyltion is prevlent in emryoni stem ells nd my e medited y DNA methyltrnsferse. Pro. Ntl. Ad. Si. USA 97, 57 5 ().. Lister, R. et l. Humn DNA methylomes t se resolution show widespred epigenomi differenes. Nture 6, 5 (9).. Lurent, L. et l. Dynmi hnges in the humn methylome during differentition. Genome Res., ().. Lister, R. et l. Hotspots of errnt epigenomi reprogrmming in humn indued pluripotent stem ells. Nture 7, 68 7 ().. Ziller, M.J. et l. Genomi distriution nd inter-smple vrition of non-cpg methyltion ross humn ell types. PLoS Genet. 7, e89 ().. Stdler, M.B. et l. DNA-inding ftors shpe the mouse methylome t distl regultory regions. Nture 8, 9 95 (); errtum 8, 55 (). 5. Smith, Z.D. et l. A unique regultory phse of DNA methyltion in the erly mmmlin emryo. Nture 8, 9 (). 6. Tomizw, S. et l. Dynmi stge-speifi hnges in imprinted differentilly methylted regions during erly mmmlin development nd prevlene of non-cpg methyltion in ooytes. Development 8, 8 8 (). nture NEUROSCIENCE VOLUME 7 NUMBER FEBRUARY

8 npg Nture Ameri, In. All rights reserved. 7. Ihiyngi, T., Ihiyngi, K., Miyke, M. & Sski, H. Aumultion nd loss of symmetri non-cpg methyltion during mle germ-ell development. Nulei Aids Res., (). 8. Xie, W. et l. Bse-resolution nlyses of sequene nd prent-of-origin dependent DNA methyltion in the mouse genome. Cell 8, 86 8 (). 9. Lister, R. et l. Glol epigenomi reonfigurtion during mmmlin rin development. Siene, 795 ().. Vrley, K.E. et l. Dynmi DNA methyltion ross diverse humn ell lines nd tissues. Genome Res., ().. M, D.K. et l. Neuronl tivity-indued Gdd5 promotes epigeneti DNA demethyltion nd dult neurogenesis. Siene, 7 77 (9).. Guo, J.U., Su, Y., Zhong, C., Ming, G.L. & Song, H. Hydroxyltion of 5-methylytosine y TET promotes tive DNA demethyltion in the dult rin. Cell 5, ().. Guo, J.U. et l. Neuronl tivity modifies the DNA methyltion lndspe in the dult rin. Nt. Neurosi., 5 5 ().. Zheng, Y. et l. A unique fmily of Mrr-like modifition-dependent restrition endonuleses. Nulei Aids Res. 8, (). 5. Chodvrpu, R.K. et l. Reltionship etween nuleosome positioning nd DNA methyltion. Nture 66, 88 9 (). 6. Kim, T.K. et l. Widespred trnsription t neuronl tivity-regulted enhners. Nture 65, 8 87 (). 7. Mrson, A. et l. Conneting mirorna genes to the ore trnsriptionl regultory iruitry of emryoni stem ells. Cell, 5 5 (8). 8. Brreto, G. et l. Gdd5 promotes epigeneti gene tivtion y repir-medited DNA demethyltion. Nture 5, (7). 9. Hu, X.V. et l. Identifition of RING finger protein (RNF) s modultor of DNA demethyltion through funtionl genomis sreen. Pro. Ntl. Ad. Si. USA 7, ().. Skene, P.J. et l. Neuronl MeCP is expressed t ner histone-otmer levels nd glolly lters the hromtin stte. Mol. Cell 7, ().. Feng, J. et l. Dnmt nd Dnmt mintin DNA methyltion nd regulte synpti funtion in dult forerin neurons. Nt. Neurosi., ().. Ji, D., Jurkowsk, R.Z., Zhng, X., Jeltsh, A. & Cheng, X. Struture of Dnmt ound to DnmtL suggests model for de novo DNA methyltion. Nture 9, 8 5 (7).. Yu, M. et l. Bse-resolution nlysis of 5-hydroxymethylytosine in the mmmlin genome. Cell 9, 68 8 ().. Booth, M.J. et l. Quntittive sequening of 5-methylytosine nd 5-hydroxymethylytosine t single-se resolution. Siene 6, 9 97 (). 5. Mellén, M., Ayt, P., Dewell, S., Kriuionis, S. & Heintz, N. MeCP inds to 5hmC enrihed within tive genes nd essile hromtin in the nervous system. Cell 5, 7 (). 6. Suetke, I., Miyzki, J., Murkmi, C., Tkeshim, H. & Tjim, S. Distint enzymti properties of reominnt mouse DNA methyltrnsferses Dnmt nd Dnmt. J. Biohem., 77 7 (). 7. Gowher, H. & Jeltsh, A. Enzymti properties of reominnt Dnmt DNA methyltrnsferse from mouse: the enzyme modifies DNA in non-proessive mnner nd lso methyltes non-cpg [orretion of non-cpa] sites. J. Mol. Biol. 9, 8 (). 8. Wu, H. et l. Dnmt-dependent nonpromoter DNA methyltion filittes trnsription of neurogeni genes. Siene 9, 8 (). 9. LPlnt, Q. et l. Dnmt regultes emotionl ehvior nd spine plstiity in the nuleus umens. Nt. Neurosi., 7 (). 5. Lewis, J.D. et l. Purifition, sequene, nd ellulr loliztion of novel hromosoml protein tht inds to methylted DNA. Cell 69, 95 9 (99). VOLUME 7 NUMBER FEBRUARY nture neuroscience

9 npg Nture Ameri, In. All rights reserved. ONLINE METHODS Smple preprtion. Mie (E to yers old, mle, C57BL/6 kground, housed in vivrium with h light, h drk yle with no more thn five mie per ge) were used for nlysis in ordne with protools pproved y the Institutionl Animl Cre nd Use Committee of Johns Hopkins University Shool of Mediine. For P to -yer-old nimls, mirodissetion of dentte grnule ell lyers ws rpidly performed ilterlly from the hippompus. This preprtion ws highly enrihed for mture neurons, s shown y immunohistohemistry to ontin ~9% NeuN + neurons, most of whih were Prox + dentte grnule ells. Previous studies t seletive loi showed quntittively very similr CpG methyltion sttus with FACS-purified NeuN + mture neurons. The urrent study lso showed quntittively similr levels of CpG nd CpH methyltion t multiple loi exmined etween mirodisseted smples nd FACS-purified NeuN + neuronl smples (Fig. ). For E nd P studies, whole rin nd spleen were used. For erly postntl tissues (P P7) nd dult CMKIIα- CreøDnmt flox/flox Dnmt flox/flox Dnmt flox/flox mie, whole hippompi were used. For AAV-medited knokdown of endogenous Dnmt or Dnmt expression, engineered AAV oexpressing GFP under the Ui promoter nd shrna ginst mouse Dnmt or Dnmt or ontrol shrna under the U6 promoter were stereotxilly injeted into the dentte gyrus of dult wild-type mie s previously desried. The following shrna sequenes were used: GTTCAGATGTGCGGCGAGT (ontrol); GCTGACACTAAGCTGTTTGTA (Dnmt); nd CATCCACTGTGAATGATAA (Dnmt). We hve previously shown widespred expression ross the whole dentte gyrus using AAVmedited infetion. Dentte gyri were mirodisseted week lter for quntittive PCR nlysis of endogenous gene expression nd for DNA methyltion nlysis. Adult nd fetl humn rin, spleen nd hert genomi DNA smples were from BioChin. Hippompl neuron ultures were prepred from mouse E8 hippompus s previously desried 5. These ultures were highly enrihed with neurons (>99%) nd ontined very few other ell types. Genomi DNA ws extrted using DNesy (Qigen). Totl RNA ws extrted using RNesy (Qigen) with DNseI digestion. Bisulfite-Seq. Three mirogrms of genomi DNA spiked in with.5% unmethylted lmd DNA (Promeg) from eh smple ws frgmented to ~-p DNA frgments using the Covris Aousti System. Frgmented DNA were repired with T DNA polymerse, Klenow DNA polymerse nd T PNK to onvert the overhngs into phosphorylted lunt ends. Klenow Frgment ( to 5 exo minus) ws used to dd n lnine se to the end of the lunt phosphorylted DNA frgments. After ligtion of dptors (TruSeq index, indexes), isulfite onversion ws performed using n EZ DNA Methyltion-Diret kit (Zymo). PCR ws then used to enrih isulfiteonverted DNA frgments to otin the DNA lirry suitle for HiSeq sequening. Pired-end sequening reds ( p) were ligned to the in silio isulfite onverted mouse referene genome mm9 using Bismrk 5 in strnd-speifi mnner, not llowing ny mismthes or multiple lignments. In-house Perl sripts were used to summrize the methyltion levels of individul ytosines. Identifition of methylted ytosine loi. A onservtive inomil model ws used to estlish the threshold for methylted ytosine lling. Speifilly, t eh lous we rndomly generted the ytosine (methylted) nd threonine (unmethylted) red numers with the tul totl red numer t this lous using inomil distriution of P =.6 (the nononversion rte determined y spiked-in unmethylted lmd DNA results). For eh different threshold, we lulted the FDR using the rtio etween the numer of methylted ytosine loi lled from the null dt nd tht of the tul dt. We hose threshold of P < 5, under whih the FDR for ll three lsses of methylted ytosines re less thn %. We further vlidted this model y pplying it to the dt set from Lister et l., whih onfirmed previously pulished results. Snger isulfite sequening nd ChIP isulfite sequening. Strnd-speifi primers were designed for the isulfite-onverted genome sequene nd synthesized y Integrted DNA Tehnologies (Supplementry Tle,). Snger isulfite sequening ws rried out s previously desried. Briefly, µg genomi DNA for eh smple ws isulfite treted nd olumn purified (Zymo). Fifty nnogrms isulfite-onverted DNA ws used in eh PCR (Invitrogen). Amplions were gel purified nd TA loned into pcr. vetors (Invitrogen). Bteril olonies were sent for Snger sequening using the MR primer (Genewiz). Typilly, lones were exmined for eh smple. Notly, the primers designed for Snger isulfite sequening only voided CpGs nd would therefore preferentilly mplify those lleles with no or low levels of CpH methyltion in the priming regions. For DNMTA ChIP, freshly mirodisseted dentte gyri were ut into fine piees nd inuted in % methnol-free formldehyde (Piere) in Duleo s PBS (DPBS) for min with ontinuous roking. glyine (Cell Signling) ws dded to the solution nd inuted for 5 min. After wshing with ie-old DPBS, tissue piees were homogenized using Doune homogenizer (Kimle Chse) on ie. After entrifugtion, the pellet ws resuspended in ell lysis uffer (5 mm piperzine-n,n -is(-ethnesulfoni id), ph 8., 85 mm KCl nd.5% Igepl) nd rotted t C for min. After entrifugtion, the pellet ws resuspended with shering uffer (.% SDS, mm ethylenediminetetreti id (EDTA) nd mm Tris, ph 8.) nd sonited y Bioruptor plus (Digenode) for yles ( s on, 9 s off) t the high intensity setting. After entrifugtion, NCl (5 mm) nd Triton X- (%) were dded to the superntnt nd inuted with protein G Dyneds (Life Tehnologies) for min. After removing the eds, nti-dnmt (s-7, µg µl, :6, Snt Cruz) or rit IgG (79, µg µl, :, Cell Signling) ntiodies were dded nd inuted t C overnight. Next, protein G eds were dded to the smples nd inuted t C for h. The eds were wshed one with low-slt wsh uffer (.% SDS, % Triton X-, mm EDTA, mm Tris, ph 8., nd 5 mm NCl), one with high-slt wsh uffer (.% SDS, % Triton X-, mm EDTA, mm Tris, ph 8., nd 5 mm NCl), one with LiCl wsh uffer (% sodium deoxyholte, % Igepl, mm Tris, ph 8., mm EDTA nd 5 mm LiCl) nd twie with Tris + EDTA uffer. Freshly mde elution uffer (% SDS nd. M NHCO ) ws dded to the eds, nd hromtin ws eluted t 65 C in thermomixer for h. After removing eds, rosslinking ws reversed t 65 C overnight. Finlly, Proteinse K (NEB) ws dded to the derosslinked hromtin solution nd inuted for n dditionl h t 55 C. The eluted DNA frgments were purified using PCR purifition kit (Qigen), followed y quntittive PCR using region-speifi primers (Supplementry Tle e). For MeCP ChIP isulfite sequening nlyses, hippompi were mirodisseted from knokin mie in whih Flg tg ws fused to endogenous MeCP protein in frme (H.L. nd Q.C., unpulished dt). ChIP ws performed s desried ove using Flg ntiodies (F8, :, Sigm). Input nd ChIP DNA were susequently nlyzed y Snger isulfite sequening s desried ove. mrna-seq. For eh smple, poly(a)-ontining mrna ws purified from µg DNse-treted totl RNA. After purifition, the mrna ws frgmented into smll piees using divlent tions under elevted temperture. Reverse trnsriptse nd rndom primers were used to generte the first-strnd DNA. The seond-strnd DNA ws synthesized using DNA polymerse I nd RNseH. These DNA frgments went through n end-repir proess using T DNA polymerse, T PNK nd Klenow DNA polymerse nd the ddition of single lnine se using Klenow Frgment ( to 5 exo minus), followed y the ligtion of the Illumin PE dptors using T DNA ligse. An index (up to ) ws inserted into Illumin dptors so tht multiple smples ould e sequened in one lne of n eight-lne flow ell if neessry. These produts were then purified nd enrihed with PCR to rete the finl DNA lirry for Illumin HiSeq sequening. Pired reds (97 p) of DNA sequenes were ligned to mouse referene genome mm9 y TopHt 5 with referene gene nnottions. The reltive undnes of eh trnsript were estimted y Cufflinks 5 using Enseml gene nnottion (uild NCBIM7). Methylted reporter ssy. Two mirogrms of FUGW plsmids were used in eh in vitro methyltion retion with four units of methyltrnsferse (NEB) in their respetive uffer onditions (7 C, >8 h). After purifition y phenol extrtion nd ethnol preipittion,. µg mok-treted or methylted plsmids were trnsfeted in HEK9 ells using.5 µl X-tremeGENE HP (Rohe). After 8 h, ells were suspended, nd GFP + ells were quntified y FACSCliur flow ytometer (BD Biosienes) s desried previously. doi:.8/nn.67 nture NEUROSCIENCE

10 For experiments using primry neuronl ultures, µg of in vitro methylted GFP plsmids were trnsfeted y eletroportion with µg of unmethylted RFP ontrol plsmid. After 7 d, RFP + nd GFP + RFP + neurons were quntified. EMSA. Eh inding retion ws rried out s previously desried 55. A mixture of fmol of iotinylted doule-strnded DNA proe nd different mounts of reominnt MBD domin of humn MeCP (Digenode) were inuted in µl of inding uffer ( mm Tris-Cl t ph 7.5 with 5 mm KCl nd mm dithiothreitol) t room temperture for min. Retion produts were loded onto 6% Novex Tris + orte + EDTA polyrylmide gels (Invitrogen) nd run t ma for ~ min until the romophenol lue dye migrted hlfwy to the ottom of the gel. Nulei ids were trnsferred to nylon memrnes (Amershm) nd deteted with the LightShift EMSA Kit (Piere) ording to the mnufturer s protool. Sttistil nlyses. We performed two-sided Student s t tests for ompring two smple groups nd one-wy nlysis of vrine for ompring more thn two smple groups unless indited otherwise. The dt distriution ws ssumed to e norml, ut this ws not formlly tested. For ompring numers of methylted nd unmethylted ytosines from two smples, two-sided Fisher s ext tests were performed (Figs. 6 nd 8). For ompring lrge numers of inry outomes, χ tests were performed (Fig. d). 5. Song, H., Stevens, C.F. & Gge, F.H. Astrogli indue neurogenesis from dult neurl stem ells. Nture 7, 9 (). 5. Krueger, F. & Andrews, S.R. Bismrk: flexile ligner nd methyltion ller for Bisulfite-Seq pplitions. Bioinformtis 7, (). 5. Trpnell, C., Phter, L. & Slzerg, S.L. TopHt: disovering splie juntions with RNA-Seq. Bioinformtis 5, 5 (9). 5. Trpnell, C. et l. Trnsript ssemly nd quntifition y RNA-Seq revels unnnotted trnsripts nd isoform swithing during ell differentition. Nt. Biotehnol. 8, 5 55 (). 55. Hu, S. et l. DNA methyltion presents distint inding sites for humn trnsription ftors. Elife, e76 (). npg Nture Ameri, In. All rights reserved. nture NEUROSCIENCE doi:.8/nn.67