Journal of Integrative Agriculture 2016, 15(0): Available online at ScienceDirect

Transcription

1 Journl of Integrtive Agriculture 2016, 15(0): Aville online t ScienceDirect RESEARCH ARTICLE Wnt gene expression in dult porcine longissimus dorsi nd its ssocition with muscle fier type, energy metolism, nd met qulity MEN Xio-ming, DENG Bo, TAO Xin, QI Ke-ke, XU Zi-wei Institute of Animl Husndry nd Veterinry Science, Zhejing Acdemy of Agriculturl Science, Hngzhou , P.R.Chin Astrct This study investigted the expression profiles of Wnt genes in dult porcine longissimus dorsi (LD) from different porcine genotypes nd their ssocitions with met qulity. The results showed tht Wnt5 gene expression levels were the highest in Jinhu (JHP) pigs, followed y Zhongi (ZBP), Duroc Zhongi (DZB), nd Duroc Yorkshire Lndrce (DYL) pigs, with significnt differences etween ZBP, DZB, nd DYL (P<0.05). This genotypic order ws reversed for Wnt7, Wnt10, nd Wnt11 expression, with JHP nd DYL hving the lowest nd highest expressive levels, respectively. Wnt5 expression ws negtively correlted with ph 45 min nd ΔpH (P<0.01), some glycolytic mrkers (P<0.05), nd positively correlted with met color (*), sher force (SF) vlue (P<0.05), myosion hevy chin (MyHC) I mrna proportion (P<0.01), turnover rtio of cretine phosphte (CP), nd cretine kinse (CK) ctivity (P<0.05). Opposite correltions were oserved for Wnt2, Wnt7, Wnt10, nd Wnt11. These results reveled tht Wnt5, Wnt7, Wnt10, nd Wnt11 gene expressions in dult porcine muscle contriuted to differences etween porcine genotypes nd ffected pork qulity. Wnt5 gene expression could e eneficil for the formtion of high qulity pork y regulting muscle fier types nd postmortem energy metolism. Keywords: pigs, met qulity, Wnt genes, muscle-fier type, energy metolism 1. Introduction Pork is one of the mjor niml husndry products. Its qulity is ffected y severl fctors including niml reed, ge, nutritionl sttus, pre-slughter stress, nd post-slughter processing conditions (Newmn nd Mgols- Received 25 Jnury, 2016 Accepted 25 July, 2016 MEN Xio-ming, E-mil: menxioming@126.com; Correspondence XU Zi-wei, Tel: , Fx: , E-mil: xzwfyz@sin.com 2016, CAAS. All rights reserved. Pulished y Elsevier Ltd. doi: /S (16)61451-X ki 2014). To dte, some tissue physicl nd iochemicl prmeters ssocited with pork qulity hve een confirmed including myofier chrcteristics, energy metolism, nd lipid deposition (Michel nd Bénédicte 2010). However, controlling met qulity is still significnt chllenge ecuse of multiple vriles nd the uncler moleculr mechnism (Dmon et l. 2013). Screening of key functionl genes or moleculr signling pthwys involved in pork qulity formtion is long-term tsk. Some of our unpulished dt indicted tht wingless-relted integrtion site (Wnt) signling pthwys mye relted to met qulity mong porcine vrieties. According to Mltzhn et l. (2012), myogenesis is dependent on the precise nd dynmic integrtion of multiple Wnt signls. Dysregultion in the Wnt signling pthwy cn contriute to severe developmentl defects

2 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): nd perturtion of muscle homeostsis. During emryonic development, Wnt signls control the expression of myogenic regultory fctors, which re essentil for myogenic linege progression (Brunelli et l. 2007; Gros et l. 2009; Hutcheson et l. 2009). In dult skeletl muscle, cnonicl Wnt signls regulte the differentition of muscle stem cells (stellite cells), wheres non-cnonicl Wnt signls medite the self-renewl of stellite stem cells nd the growth of muscle fiers (Brck et l. 2007; Brck et l. 2008; Hn et l. 2011). Emerging evidence hs reveled tht the cnonicl Wnt/β-ctenin signling pthwy in pigs medites ft development nd myofier differentition nd growth (Shi et l. 2012; Yng et l. 2012). Currently, there re more thn 11 Wnt genes expressed in niml tissues. Therefore, we hypothesized tht some Wnt genes ffected pork qulity development. The ojectives of this study were to investigte the expression profiles of Wnt genes in dult porcine muscle nd identify their ssocition with met qulity, myosin-hevy chin (MyHCs) mrna, nd energy metolism mrkers. 2. Mterils nd methods 2.1. Animls nd smpling All niml procedures were performed in ccordnce with the mngement of experimentl nimls in Zhejing Province of Chin nd frm niml welfre requirements in Chin (Zhi et l. 2014). Thirty-two mrket-weight rrows were used (Lvjiyun Livestock Industry, Zhejing, Chin), including eight Jinhu pigs (JHP, (70±2.0) kg, 200 d old), eight Zhongi pigs (ZBP, (95±2.5) kg, 180 d old), eight Duroc Zhongi pigs (DZB, (100±2.5) kg, 180 d old), nd eight Duroc Yorkshire Lndrce pigs (DYL, (100±2.5) kg, 180 d old). All pigs were selected from different sires. The JHP reed is common ntive reed in Chin. The ZBP reed is loclly produced cross-reed etween JHP, Yorkshire, nd Lndrce pigs, with 12.5% contriution from JHP. The DZB cross-reed is produced y crossing Duroc nd ZBP, with 6.25% contriution from JHP. The DYL reed is cross etween Duroc, Yorkshire, nd Lndrce reeds, with no contriution from JHP. All nimls were fed the sme corn-mel diet for 30 d nd were trnsferred to n ttoir in commercil truck (journey time ~2.5 h). Upon rrivl, the nimls were housed in rn nd hd d liitum ccess to drink without food for 16 h prior to slughter. A 5 g smple of the longissimus dorsi (LD) tissue ws immeditely otined, frozen in liquid nitrogen, nd stored t 80 C Totl RNA extrction nd reverse trnscription Totl RNA ws isolted from LD using n E.Z.N.A. HP Totl RNA Kit (Omeg Bio-Tek, Norcross, USA) nd ws reverse trnscried into cdna using revertr Ace qpcr RT Kit (Toyoo, Osk, Jpn) PCR nlysis of Wnt gene expression The doule-stndrd curve method of the reltive quntifiction rel-time PCR ws performed ccording to Xu et l. (2011). The primers for Wnt2, Wnt4, Wnt5, Wnt7, Wnt8, Wnt9, Wnt10, nd Wnt11, nd the reference gene 18S were designed nd synthesized ccording to their mrna sequence pulished in NCBI ( The primer sequences nd resultnt mplicon sizes re listed in Tle 1. The PCR products for ech gene were recovered fter purifiction, nd their sizes were consistent with the expected mplicon sizes. The recovered product of ech gene ws serilly diluted nd sujected to rel-time PCR. A reltive stndrd curve for ech gene ws generted from its dilution nd CT vlue. PCR ws performed with the SYBR qpcr Mix (Toyoo) using StepOne Plus Rel-Time PCR system (Life Technologies, Crlsd, CA, USA). The rection mixture (15 µl) consisted of 0.3 µl of ech primer (10 nmol L 1 ), 7.5 µl of SYBR qpcr mix, 0.3 µl of ROX reference dye, 2.0 µl of cdna templte, nd 4.6 µl of dilution uffer (Tkr Bio., Otsu, Shig, Jpn). The PCR progrm ws set to one cycle t 95 C for 20 s, followed y 40 cycles t 95 C for 5 s nd 60 C for 50 s. The melt curve progrm consisted of 95 C for 60 s, 60 C for 30 s, nd 95 C for 60 s. Three replictes were performed for ech rection. For the stndrd curve nlysis, the rection efficiencies of ll genes rnged etween 95 nd 105%, nd the CT vlues rnged etween 18 nd 33, with correltion coefficient vlue (R 2 ) > The reltive fold expression of ech gene (including 18s) ws clculted ccording to its CT vlue nd reltive stndrd curve. The reltive quntifiction of ech trget gene ws expressed s the rtio etween its reltive fold expression to tht of 18s Anlysis of myosin-hevy chin composition in LD The solute concentrtion of MyHC mrna in muscle ws mesured ccording to the method reported y Men et l. (2012). Briefly, the primer sets of the four dult types of MyHC (I, II, IIx, nd II) consisted of MyHC I, F: 5 -cc ttg ct gg gg cct ctg gt tc-3, 384 p; MyHC II F: 5 -gc ctc ttt ctt ctc cc ggg c ttc-3, 375 p; MyHC II F: 5 -ct ctg gt c t gg gt ct ct g-3, 398 p; MyHC IIx: 5 -ctt tcc tc t gc ttc g ttc tgc c-3, 429 p; nd MyHCs R: 5 -tc cg gct gcg t cgc tct ttg gg ttg t-3. The stn-

3 4 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): drd templtes for ech rection were prepred through electrophoretic identifiction y constructing recominnt plsmid, synthesizing RNA frgments, nd serilly diluting them to different concentrtions for use in the stndrd curve. The rection volume nd rel-time PCR progrm were similr to those forementioned. The reltive MyHC mrna composition ws expressed s the corresponding copy numer/mg of muscle smple divided y the sum of the copy numer for ech MyHC type, multiplied y 100. The resultnt vlue of reltive MyHC mrna expression ws expressed s percentge Anlysis of met qulity trits nd energy metolism sttus of LD The ph vlues t 45 min nd 24 h postmortem (oth in triplicte), wter holding cpcity (WHC, %), Wrner-Brtzler sher force, nd energy metolism indexes of LD were mesured s reported y Men et l. (2011). Met color of freshly cut cross-section of LD fter 30 min of looming t 4 C ws ssessed using CR-410 Minolt chrom meter (Konic-Minolt, Tokyo, Jpn). Hunter l*, *, *, nd C vlues were recorded. Intrmusculr ft (IMF) content of LD ws quntified using Soxhlet petroleum-ether extrction method. Cretine phosphte (CP) nd cretine (Cr) content of LD ws mesured using HPLC (Men et l. 2012). LD glycogen (Gly), glucose (Glu), glucose-6-phosphoric cid (G-6-P), nd lctic cid (LA) levels nd cretine kinse (CK) ctivity were mesured using stndrd commercil kits (Nnjing Jincheng Biochemicl Institute, Chin). Glycolytic potentil (GP) ws clculted y douling the sum of Gly, Glu, nd G-6-P levels nd y dding LA levels Sttisticl nlysis Sttisticl nlysis ws performed using SPSS 16.0 (SPSS Inc., Chicgo, IL, USA) s descried y Zhou nd Deng (2009). The difference etween genotypes ws ssessed using one-wy nlysis of vrince nd Duncn s test, with reed s the min fctor. The correltion etween different indices ws evluted using the Person ivrite nlysis with two-tiled test of significnce. 3. Results 3.1. Wnt gene expression in porcine LD from four different genotypes nd its ssocition with met qulity The expression profile of Wnt genes in LD from JHP, ZBP, DZB, nd DYL genotypes is shown in Fig. 1. Wnt2 expression ws the lowest in JHP (P<0.05), with no significnt differences mong the other three genotypes (P>0.05). Wnt4 nd Wnt9 expressions were not significntly different etween the four genotypes (P>0.05). In order of decresing Wnt5 expression, the genotypes were JHP, ZBP, DZB, nd DYL, with significnt differences etween ZBP nd DZP nd etween DZP nd DYL (P<0.05). This genotypic order ws reversed for Wnt7, Wnt10, nd Wnt11 expressions, with JHP nd DYL hving the lowest nd highest expressive levels, respectively. Wnt8 expression ws significntly higher in ZBP, with no significnt differences etween JHP, DZB nd DYL (P>0.05). There were significnt differences etween DLY nd DZP (P<0.05) in Wnt10 nd Wnt11 expressions, with no significnt differences etween JHP, ZBP, nd DZP (P>0.05). As shown in Tle 2, the expression levels of Wnt2, Wnt5, Wnt7, Wnt10, nd Wnt11 were significntly correlted with met qulity trits (P<0.05). Specificlly, Wnt5 expression ws negtively correlted with ph 45 min nd ΔpH (P<0.01) nd positively correlted with met color * nd SF vlues (P<0.05). The correltion etween Wnt2, Wnt7, Wnt10, nd Wnt11 expressions nd the ovementioned pork qulity trits ws opposite for Wnt5. Wnt8 expression ws significntly correlted with the IMF content (P<0.05, r= 0.486) Correltion etween Wnt gene expression nd MyHC composition in LD As shown in Tle 3, MyHC I mrna expression ws positively correlted with Wnt5 expression nd negtively correlted with Wnt2, Wnt7, Wnt10, nd Wnt11 expressions (P<0.01). Wnt8 ws significntly correlted with MyHC II (P<0.01, r= 0.579) nd MyHC II composition (P<0.05, r=0.435). Both Wnt10 nd Wnt11 were positively correlted with reltive MyHC IIx composition (P<0.01), nd Wnt11 ws negtively correlted with reltive MyHC II composition (P<0.01) Correltion etween Wnt gene expression nd energy metolism mrkers in LD As shown in Tle 4, Wnt2 gene expression ws positively correlted with G-6-P, LA, GP, nd CP (P<0.05) nd ws negtively correlted with Cr, CK, nd Cr/(Cr+CP) (P<0.05). Wnt4 nd Wnt9 genes hd no significnt correltion with energy metolic indices (P<0.05). Wnt5 expression ws negtively correlted with Gly, G-6-p, GP, nd CP (P<0.05) nd positively correlted with Cr/(Cr+CP) nd CK (P<0.05). Wnt7, Wnt10, nd Wnt11 gene expressions were positively correlted with glycolytic indices (Gly, Glu, G-6-P, LA, nd GP) nd were negtively correlted with CK nd Cr/ (Cr+CP) (P<0.05). Wnt8 gene expression ws positively

4 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): Tle 1 List of genes nd sequences of the primers for rel-time quntittive PCR Gene Primer Sequence (5 3 ) Product size (p) Gene no. reference Wnt2 Forwrd GTAGCCGGGAATCTGCCTTTGTGT TCCTGCCGGCTCTGTTGTTGTGAA 275 XM_ Wnt4 Forwrd AGCCGGGCCCTCATGAACCTCCAC GGGCTCCAAGTACACCAAGTCCT 284 GU Wnt5 Forwrd CGCCGCGGGGGTGGTCA CGGCCGGCCTCGTTGTTGTG 261 XM_ Wnt7 Forwrd CCGCGGCTACAACACCCACCAG ACAGGCGCCCCCACAGCAGAC 260 XM_ Wnt8 Forwrd TCCTAGTGCAGAAGCCGAGTTGA ACAGGCGCCCCCACAGCAGAC 298 XM_ Wnt9 Forwrd GATCTGCGAGCCCGTGTGGACTTC CCGGCCCCGTGGTGGTGAGATG 252 XM_ Wnt10 Forwrd GCCGCTTCCACTGGTGCTGCTACG GACTCCCCCTGACCCCCACCATCT 227 DQ Wnt11 Forwrd GGAACCGCTGGGGAGGATGTGC GGTAGCGGGTCTTGAGGTCTGAGG 273 XM_ S Forwrd CCCACGGAATCGAGAAAGAG TTGACGGAAGGGCACCA 122 AY Zou et l. (2012) c correlted with LA (P<0.05) nd ws negtively correlted with Cr nd CK (P<0.05). 4. Discussion JHP ZBP DZP DYL c c Wnt2 Wnt4 Wnt5 Wnt7 Wnt8 Wnt9 Wnt10 Wnt11 Fig. 1 Wnt gene (Wnt2, Wnt4, Wnt5, Wnt7, Wnt8, Wnt9, Wnt10, nd Wnt11) expression in porcine longissimus dorsi (LD) in four different genotypes: Jinhu (JHP), Zhongi (ZBP), Duroc Zhongi (DZB), nd Duroc Yorkshire Lndrce (DYL). The different letters indicte sttisticl significnce (P<0.05). The error rs in columns represent stndrd devition. The role of Wnt signling on emryonic muscle development, dult skeletl muscle regenertion, muscle fier hypertrophy, nd myofier type hve een previously reported (Mltzhn et l. 2012). However, to our knowledge, there is no informtion on the effect of Wnt signling on pork qulity. Our study investigted the mrna expression profiles of Wnt2, Wnt4, Wnt5, Wnt7, Wnt8, Wnt9, Wnt10, nd Wnt11 in the skeletl muscle of JHP, ZBP, DZB, nd DYL porcine reeds. JHP is ntive porcine reed with very high met qulity, ZBP originted from JHP, DZP is hyrid of Duroc ZBP, nd DYL is generl commercil hyridized pig reed. JHP, ZBP, DZB, nd DYL reeds contin 100, 12.5, 6.25, nd 0% of JHP loodline, respectively. In decresing order of pork qulity, the porcine reeds re JHP>ZBP>DZB>DYL (Men et l. 2011, 2012). Our results reveled tht Wnt5 expression correlted with JHP loodline content in different porcine genotypes. This ws different for the trends oserved in Wnt7, Wnt10, nd Wnt11 expressions. Further, Wnt5, Wnt7, Wnt10, nd Wnt11 expressions hd significnt correltion with postmortem ph decline nd red met color (* vlue). Therefore, Wnt genes nd relted signling pthwys contriuted to the understnding of interspecies differences in pork qulity nd could provide novel informtion for regulting pork qulity. IMF content ffects met tenderness, flvor, mrle grin, nd juiciness. The roles of Wnt signling on lipid deposition hve een confirmed y other reserchers. He et l. (2011) reported tht Wnt10 mrna expression in dipose tissue of Tongcheng pigs ws significntly higher thn tht in Lrge White pigs. β-ctenin, key fctor in the Wnt signling pthwy, my inhiit the differentition of pre-dipocytes, development of ft tissue, nd expression of relted genes in pigs (Kng et l. 2007; Luo et l. 2008; Chung et l. 2012; Mu et l. 2012). Our results reveled

5 6 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): Tle 2 Correltion etween Wnt gene expression nd pork qulity trits in porcine longissimus dorsi (LD) Item 1) Wnt2 Wnt4 Wnt5 Wnt7 Wnt8 Wnt9 Wnt10 Wnt11 ph 45 min ** ** ** ** ** ph 24 h ΔpH ** ** ** ** ** l* * ** * ** ** * * * C SF ** ** ** ** WHC IMF * ) l*, *, *, nd C, the met color prmeters representing light, red, yellow, nd sturtion, respectively. SF, sher force; WHC, wter holding cpcity; IMF, intrmusculr ft. *, P<0.05; **, P<0.01. The sme s elow. Tle 3 Correltion etween Wnt gene expression nd MyHCs mrna proportions in porcine LD Wnt2 Wnt4 Wnt5 Wnt7 Wnt8 Wnt9 Wnt10 Wnt11 MyHCI mrna (%) ** ** ** ** ** MyHCII mrna (%) ** MyHCII mrna (%) * ** MyHCIIx mrna (%) ** ** MyHC (II+IIx+II) (%) ** ** ** ** ** Tle 4 Correltion etween Wnt gene expression nd energy metolism indices in porcine LD Item 1) Wnt2 Wnt4 Wnt5 Wnt7 Wnt8 Wnt9 Wnt10 Wnt11 Glu (µmol g 1 ) * ** Gly (µmol g 1 ) * * * G-6-P (µmol g 1 ) * ** ** ** ** LA (µmol g 1 ) ** ** GP (mmol g 1 ) ** ** ** ** ** Cr (nmol g 1 ) ** * CP (nmol g 1 ) ** ** ** ** ** CK (U mg 1 pro) ** ** ** * ** ** Cr/(Cr+CP) ** ** ** ** ** 1) Glu, glucose; Gly, glycogen; G-6-P, glucose-6-phosphoric cid; LA, lctic cid; GP, glycolytic potentil; Cr, cretine; CP, cretine phosphte; CK, cretine kinse; Cr/(Cr+CP), conversion rte of CP into Cr. tht Wnt8 expression ws negtively correlted with IMF content. This could e ttriuted to the inducing effect of Wnt8 on β-ctenin ctivity (Wodrz nd Nusse 1998). Additionlly, JHP hd reltively high Wnt5 expression in muscle. Even though JHP ws reported to hve high IMF content (Zhou nd Zho 2007), this phenomenon ws not contrdictory ecuse Wnt5 medited the β-ctenin-independent signling pthwy (Wodrz nd Nusse 1998). The role of different Wnt signling pthwys on IMF deposition needs to e evluted in future studies. In dult mmml muscle, myosin hevy chin (MyHC) is composed of four different isoforms (i.e., type I, II, IIx, nd II). The composition rtio of MyHC isoforms reflects the myofier type chrcteristics, contrctile speed, nd metolic type. Muscle fier type is n importnt indictor of pork qulity (Lefucheur 2010). Yng et l. (2012) reported tht the expression of Wnt/β-ctenin signling pthwy-relted genes (i.e., β-ctenin, Fz3, nd GSK-3β) ws positively correlted with MyHC I nd negtively correlted with MyHC II in longissimus dorsi of Lrge White pigs during postntl growth. Wnt3 nd Wnt1 regulted MyoD nd myogenin (MyoG) expressions in skeletl muscle stellite cell differentition (Kim et l. 2008). MyoD nd MyoG were significntly expressed in fst-myofier nd in slow-myofier, respectively (Lis et l. 2007). Slow muscle myosin (i.e., MyHC I) expression in the muscle of four lims ws significntly decresed through inctivtion of β-ctenin in mouse emryo (Hutcheson et l. 2009). Kikuchi et l. (2009) found tht myosttin promoted the formtion of slow muscle fiers through Wnt/β-ctenin signling, nd Wnt5 promoted the increse of slow muscle fiers, while Wnt11 promoted the increse of fst muscle fiers. Additionlly, Ankwe et l. (2003) oserved this phenomenon in developing chicks. We confirmed the phenomenon in dult porcine muscle once

6 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): more. Wnt5 ws positively correlted with the proportion of MyHC I mrna, while Wnt11 ws positively correlted with MyHC (II+IIx+II). Becuse MyHC I mrna ws mjorly expressed in slow MyHC-positive myofier, While MyHC II, IIx nd II mrna were mjorly expressed in fst MyHC-positive myofier. As the ctivtors of Wnt/β-ctenint signling pthwy, Wnt2, Wnt7, nd Wnt10 exhiit negtive correltion with MyHC I mrna nd positive correltion with MyHC (II+IIx+II). Furthermore, Wnt5 nd Wnt11 were the ctivtors of the independent β-ctenint Wnt/C 2+ signling pthwy (De 2011). This indicted tht β-ctenint ws not the only moleculr regulting muscle fier type in the Wnt signling pthwy, nd the specific reltion etween the Wnt gene nd its signling pthwy ws not unique. Therefore, it cn e confirmed tht Wnt genes hve importnt nd complex roles during the formtion of muscle fier types. However, the specific role of the Wnt gene requires further studies. In postmortem muscle, the phosphgen energy supplying system (ATP-CP) nd glycolytic pthwys re the mjor energy-producing systems (Scheffler et l. 2011). Compred with the glycolytic pthwy, the ATP-CP pthwy ffects pork qulity (Men et l. 2011). In the present study, GP nd Cr/(Cr+CP) represent the cpcity of two different energy-providing systems. Wnt5 expression ws positively correlted with the ATP-CP pthwy nd ws negtively correlted with the glycolytic pthwy in our dt. Opposite results were otined for Wnt2, Wnt7, Wnt10, nd Wnt11 expressions. This ws consistent with the reltionship etween Wnt gene expression nd pork qulity trits. Some studies hve reported the effect of Wnt signling on skeletl muscle metolism. For exmple, it hs een reported tht Wnt modultes insulin resistnce in oese rts (Zhou et l. 2012) nd promotes insulin-independent glucose uptke into muscle (Zeve et l. 2012) s well s lipid oxidtion (Scrd et l. 2010). Our results showed tht different Wnt genes or their signling could differently ffect the energy metolism sttus of muscle. However, it ws not cler how different Wnt genes or signling pthwys regulted energy metolism of muscle. 5. Conclusion In this study, the expression levels of Wnt5, Wnt7, Wnt10, nd Wnt11 were significntly correlted with met qulity trits. Wnt5 gene expression positively correlted with high pork qulity formtion, nd the other three Wnt genes negtively ffected the pork qulity. Muscle fier type nd energy metolism could e importnt pthwys for Wnt genes nd their signling, which influences pork qulity trits. Acknowledgements This work ws supported y the Ntionl Nturl Science Foundtion of Chin ( ), the Modern Agro-Industry Technology Reserch System of Chin (CARS-36), nd the Science nd Technology Projects in Zhejing Province of Chin. References Ankwe K, Roson L, Hdley J, Buxton P, Church V, Allen S, Hrtmnn C, Hrfe B, Nohno T, Brown A M, Evns D J, Frncis-West P Wnt signlling regultes myogenic differentition in the developing vin wing. Development, 130, Bonneu M, Leret B Production systems nd influence on eting qulity of pork. Met Science, 84, Brck A S, Conoy I M, Conoy M J, Shen J, Rndo T A A temporl switch from notch to Wnt signling in muscle stem cells is necessry for norml dult myogenesis. Cell Stem Cell, 2, Brck A S, Conoy M J, Roy S, Lee M, Kuo C J, Keller C, Rndo T A Incresed Wnt signling during ging lters muscle stem cell fte nd increses firosis. Science, 317, Brunelli S, Relix F, Besso S, Buckinghm M, Cossu G Bet ctenin-independent ctivtion of MyoD in presomitic mesoderm requires PKC nd depends on Px3 trnscriptionl ctivity. Developmentl Biology, 304, Chung S S, Lee J S, Kim M, Ahn B Y, Jung H S, Lee H M, Kim J W, Prk K S Regultion of Wnt/β-ctenin signling y CCAAT/enhncer inding protein β during dipogenesis. Oesity, 20, Dmon M, Denieul K, Vincent A, Bonhomme N, Wyszynsk- Koko J, Leret B Associtions etween muscle gene expression pttern nd technologicl nd sensory met trits highlight new iomrkers for pork qulity ssessment. Met Science, 95, De A Wnt/C 2+ signling pthwy: A rief overview. Act BIochimicl et BIophysic Sinic, 43, Gros J, Serrlo O, Mrcelle C Wnt11 cts s directionl cue to orgnize the elongtion of erly muscle fires. Nture, 457, Hn X H, Jin Y R, Seto M, Yoon J K A WNT/et-ctenin signling ctivtor, Rspondin, plys positive regultory roles during skeletl myogenesis. Journl of Biologicl Chemistry, 286, He X P, Go H, Liu C X, Fn B, Liu B Cloning, chromosoml locliztion, expression profile nd ssocition nlysis of the porcine Wnt10 gene with ckft thickness. Moleculr Biology Reports, 38, Hutcheson D A, Zho J, Merrell A, Hldr M, Krdon G Emryonic nd fetl lim myogenic cells re derived from

7 8 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): developmentlly distinct progenitors nd hve different requirements for et-ctenin. Genes nd Development, 23, Kng S, Bennett C N, Gerin I, Rpp L A, Hnkenson K D, Mcdougld O A Wnt signling stimultes osteolstogenesis of mesenchyml precursors y suppressing CCAAT/enhncer inding protein lph nd peroxisome prolifertor-ctivted receptor gmm. Journl of Biology Chemistry, 282, Kikuchi A, Ymmoto H, Sto A Selective ctivtion mechnisms of Wnt signling pthwys. Trends Cell Biology, 19, Kim C H, Neiswender H, Bik E J, Xiong W C, Mei L β-ctenin intercts with MyoD nd regultes its trnscription ctivity. Moleculr nd Cellulr Biochemistry, 28, Lefucheur L A second look into fier typing - Reltion to met qulity. Met Science, 84, Lis M, Andrew J W, Biswjit P, Co Y, Tyler A, Moens C B, Tpscott S J Px homeodomin proteins direct Myod ctivity to promote fst-muscle differentition. Development, 134, Luo X, Li H X, Yng G S Sequentil expression of Wnt/β-ctenin signl pthwy relted genes nd dipocyte trnscription fctors during porcine dipose tissue development. Chinese Journl of Biotechnology, 24, (in Chinese) Mltzhn J V, Chng N C, Bentzinger C F, Rudnicki M A Wnt signling in myogenesis. Trends in Cell Biology, 22, Men X M, Deng B, Xu Z W, Liu M H, Qi K K Chrcteristics of ATP-CP system sttus in postmortem muscle nd their ssocitions with pork qulity trits. Scienti Agricultur Sinc, 44, (in Chinese) Men X M, Deng B, Xu Z W, To X Muscle-fire types in porcine longissimus muscle of different genotypes nd their ssocition with the sttus of energy metolism. Animl Production Science, 52, Mu H P, Lin S M, Ye Y Q, Zhng X Q, Li Y G Downregultion of Wnt-10/ctenin-Β nd TGF-Β 3 promotes ft deposition dwrf chicken muscle. In: Animl Antomy nd Emryology Brnch 17th Reserch Assocition of Chinese Assocition of Animl Science nd Veterinry Medicine. July 10th 13th, Tigu, Chin. pp (in Chinese) Newmn D, Mgolski J Qulity Mngement Frm Level: Pork Qulity. Encyclopedi of Met Sciences. 2nd ed. Elsevier Science, Amsterdm. pp Scrd A, Frnzin C, Miln G, Snn M, Dl Prà C, Pgno C, Boldrin L, Piccoli M, Trevellin E, Grnzotto M, Gm P, Federspil G, De Coppi P, Vettor R Incresed dipogenic conversion of muscle stellite cells in oese Zucker rts. Interntionl Journl of Oesity, 34, Scheffler T L, Prk S, Gerrrd D E Lessons to lern out postmortem metolism using the AMPKγ3R200Q muttion in the pig. Met Science, 89, Shi X E, Liu Y G, Yng Q M, Chen Z Z, Yng G S Role of wnt/β-ctenin in the differentition of stellite cells into muscle fiers. Scienti Agricultur Sinc, 45, (in Chinese) Wodrz A, Nusse R Mechnisms of Wnt signling in development. Annul Review of Cell nd Developmentl Biology, 14, Xu L H, Liu C L, Chng Y M, Ling L Q, Liu J L, Go G Q, Hn Q X Theory nd method of doule-stndrd curves method of reltive quntifiction PCR. Biotechnology Bulletin, 1, (in Chinese) Yng Q M, Liu Y G, Shen Q W, Shi X E, Yng G S Activtion cnonicl Wnt signling y LiCi induces porcine skeletl muscle stellite cells differentition into slow muscle. Chinese Journl of Animl Science, 48, (in Chinese) Zeve D, Seo J, Suh J M, Seo J, Suh J M, Stenesen D, Tng W, Berglund E D, Wn Y, Willims L J, Lim A, Mrtinez M J, McKy R M, Milly D P, Olson E N, Grff J M Wnt signling ctivtion in dipose progenitors promotes insulinindependent muscle glucose uptke. Cell Metolism, 15, Zhi H Q, Shen G Y, Wng P Z, Xi C L, Li N, Wng T Y, Feng X H, Chen R A, Zhou Z G, Gu X H, Wn X Q, E Y X, Shi S Y, Fn Z X, Wng B X CAS , Frm Animl Welfre Requirements: Pigs. Stndrds of Chin Assocition, Beijing. (in Chinese) Zhou D, Strkovsky R S, Zhng X Y, Pn Y X The skeletl muscle Wnt pthwy my modulte insulin resistnce nd muscle development in diet-induced oese rt model. Oesity, 20, Zhou G H, Zho G M Biochemicl chnges during processing of trditionl Jinhu hm. Met Science, 77, Zhou Y M, Deng W B SPSS 16.0 nd Sttisticl Dt Anlysis. Southwest University of Finnce nd Economics, Chengdu. (in Chinese) Zou H, Li R, Ji Y, Yng X, Ni Y, Cong R, Solowy P D, Zho R Breed-dependent trnscriptionl regultion of 5 -untrnslted GR (NR3C1) exon 1 mrna vrints in the liverof neworn piglets. PLoS ONE, 7, e (Mnging editor ZHANG Jun)