Journal of Integrative Agriculture 2016, 15(0): Available online at ScienceDirect
|
|
- Verity Singleton
- 6 years ago
- Views:
Transcription
1 Journl of Integrtive Agriculture 2016, 15(0): Aville online t ScienceDirect RESEARCH ARTICLE Wnt gene expression in dult porcine longissimus dorsi nd its ssocition with muscle fier type, energy metolism, nd met qulity MEN Xio-ming, DENG Bo, TAO Xin, QI Ke-ke, XU Zi-wei Institute of Animl Husndry nd Veterinry Science, Zhejing Acdemy of Agriculturl Science, Hngzhou , P.R.Chin Astrct This study investigted the expression profiles of Wnt genes in dult porcine longissimus dorsi (LD) from different porcine genotypes nd their ssocitions with met qulity. The results showed tht Wnt5 gene expression levels were the highest in Jinhu (JHP) pigs, followed y Zhongi (ZBP), Duroc Zhongi (DZB), nd Duroc Yorkshire Lndrce (DYL) pigs, with significnt differences etween ZBP, DZB, nd DYL (P<0.05). This genotypic order ws reversed for Wnt7, Wnt10, nd Wnt11 expression, with JHP nd DYL hving the lowest nd highest expressive levels, respectively. Wnt5 expression ws negtively correlted with ph 45 min nd ΔpH (P<0.01), some glycolytic mrkers (P<0.05), nd positively correlted with met color (*), sher force (SF) vlue (P<0.05), myosion hevy chin (MyHC) I mrna proportion (P<0.01), turnover rtio of cretine phosphte (CP), nd cretine kinse (CK) ctivity (P<0.05). Opposite correltions were oserved for Wnt2, Wnt7, Wnt10, nd Wnt11. These results reveled tht Wnt5, Wnt7, Wnt10, nd Wnt11 gene expressions in dult porcine muscle contriuted to differences etween porcine genotypes nd ffected pork qulity. Wnt5 gene expression could e eneficil for the formtion of high qulity pork y regulting muscle fier types nd postmortem energy metolism. Keywords: pigs, met qulity, Wnt genes, muscle-fier type, energy metolism 1. Introduction Pork is one of the mjor niml husndry products. Its qulity is ffected y severl fctors including niml reed, ge, nutritionl sttus, pre-slughter stress, nd post-slughter processing conditions (Newmn nd Mgols- Received 25 Jnury, 2016 Accepted 25 July, 2016 MEN Xio-ming, E-mil: menxioming@126.com; Correspondence XU Zi-wei, Tel: , Fx: , E-mil: xzwfyz@sin.com 2016, CAAS. All rights reserved. Pulished y Elsevier Ltd. doi: /S (16)61451-X ki 2014). To dte, some tissue physicl nd iochemicl prmeters ssocited with pork qulity hve een confirmed including myofier chrcteristics, energy metolism, nd lipid deposition (Michel nd Bénédicte 2010). However, controlling met qulity is still significnt chllenge ecuse of multiple vriles nd the uncler moleculr mechnism (Dmon et l. 2013). Screening of key functionl genes or moleculr signling pthwys involved in pork qulity formtion is long-term tsk. Some of our unpulished dt indicted tht wingless-relted integrtion site (Wnt) signling pthwys mye relted to met qulity mong porcine vrieties. According to Mltzhn et l. (2012), myogenesis is dependent on the precise nd dynmic integrtion of multiple Wnt signls. Dysregultion in the Wnt signling pthwy cn contriute to severe developmentl defects
2 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): nd perturtion of muscle homeostsis. During emryonic development, Wnt signls control the expression of myogenic regultory fctors, which re essentil for myogenic linege progression (Brunelli et l. 2007; Gros et l. 2009; Hutcheson et l. 2009). In dult skeletl muscle, cnonicl Wnt signls regulte the differentition of muscle stem cells (stellite cells), wheres non-cnonicl Wnt signls medite the self-renewl of stellite stem cells nd the growth of muscle fiers (Brck et l. 2007; Brck et l. 2008; Hn et l. 2011). Emerging evidence hs reveled tht the cnonicl Wnt/β-ctenin signling pthwy in pigs medites ft development nd myofier differentition nd growth (Shi et l. 2012; Yng et l. 2012). Currently, there re more thn 11 Wnt genes expressed in niml tissues. Therefore, we hypothesized tht some Wnt genes ffected pork qulity development. The ojectives of this study were to investigte the expression profiles of Wnt genes in dult porcine muscle nd identify their ssocition with met qulity, myosin-hevy chin (MyHCs) mrna, nd energy metolism mrkers. 2. Mterils nd methods 2.1. Animls nd smpling All niml procedures were performed in ccordnce with the mngement of experimentl nimls in Zhejing Province of Chin nd frm niml welfre requirements in Chin (Zhi et l. 2014). Thirty-two mrket-weight rrows were used (Lvjiyun Livestock Industry, Zhejing, Chin), including eight Jinhu pigs (JHP, (70±2.0) kg, 200 d old), eight Zhongi pigs (ZBP, (95±2.5) kg, 180 d old), eight Duroc Zhongi pigs (DZB, (100±2.5) kg, 180 d old), nd eight Duroc Yorkshire Lndrce pigs (DYL, (100±2.5) kg, 180 d old). All pigs were selected from different sires. The JHP reed is common ntive reed in Chin. The ZBP reed is loclly produced cross-reed etween JHP, Yorkshire, nd Lndrce pigs, with 12.5% contriution from JHP. The DZB cross-reed is produced y crossing Duroc nd ZBP, with 6.25% contriution from JHP. The DYL reed is cross etween Duroc, Yorkshire, nd Lndrce reeds, with no contriution from JHP. All nimls were fed the sme corn-mel diet for 30 d nd were trnsferred to n ttoir in commercil truck (journey time ~2.5 h). Upon rrivl, the nimls were housed in rn nd hd d liitum ccess to drink without food for 16 h prior to slughter. A 5 g smple of the longissimus dorsi (LD) tissue ws immeditely otined, frozen in liquid nitrogen, nd stored t 80 C Totl RNA extrction nd reverse trnscription Totl RNA ws isolted from LD using n E.Z.N.A. HP Totl RNA Kit (Omeg Bio-Tek, Norcross, USA) nd ws reverse trnscried into cdna using revertr Ace qpcr RT Kit (Toyoo, Osk, Jpn) PCR nlysis of Wnt gene expression The doule-stndrd curve method of the reltive quntifiction rel-time PCR ws performed ccording to Xu et l. (2011). The primers for Wnt2, Wnt4, Wnt5, Wnt7, Wnt8, Wnt9, Wnt10, nd Wnt11, nd the reference gene 18S were designed nd synthesized ccording to their mrna sequence pulished in NCBI ( The primer sequences nd resultnt mplicon sizes re listed in Tle 1. The PCR products for ech gene were recovered fter purifiction, nd their sizes were consistent with the expected mplicon sizes. The recovered product of ech gene ws serilly diluted nd sujected to rel-time PCR. A reltive stndrd curve for ech gene ws generted from its dilution nd CT vlue. PCR ws performed with the SYBR qpcr Mix (Toyoo) using StepOne Plus Rel-Time PCR system (Life Technologies, Crlsd, CA, USA). The rection mixture (15 µl) consisted of 0.3 µl of ech primer (10 nmol L 1 ), 7.5 µl of SYBR qpcr mix, 0.3 µl of ROX reference dye, 2.0 µl of cdna templte, nd 4.6 µl of dilution uffer (Tkr Bio., Otsu, Shig, Jpn). The PCR progrm ws set to one cycle t 95 C for 20 s, followed y 40 cycles t 95 C for 5 s nd 60 C for 50 s. The melt curve progrm consisted of 95 C for 60 s, 60 C for 30 s, nd 95 C for 60 s. Three replictes were performed for ech rection. For the stndrd curve nlysis, the rection efficiencies of ll genes rnged etween 95 nd 105%, nd the CT vlues rnged etween 18 nd 33, with correltion coefficient vlue (R 2 ) > The reltive fold expression of ech gene (including 18s) ws clculted ccording to its CT vlue nd reltive stndrd curve. The reltive quntifiction of ech trget gene ws expressed s the rtio etween its reltive fold expression to tht of 18s Anlysis of myosin-hevy chin composition in LD The solute concentrtion of MyHC mrna in muscle ws mesured ccording to the method reported y Men et l. (2012). Briefly, the primer sets of the four dult types of MyHC (I, II, IIx, nd II) consisted of MyHC I, F: 5 -cc ttg ct gg gg cct ctg gt tc-3, 384 p; MyHC II F: 5 -gc ctc ttt ctt ctc cc ggg c ttc-3, 375 p; MyHC II F: 5 -ct ctg gt c t gg gt ct ct g-3, 398 p; MyHC IIx: 5 -ctt tcc tc t gc ttc g ttc tgc c-3, 429 p; nd MyHCs R: 5 -tc cg gct gcg t cgc tct ttg gg ttg t-3. The stn-
3 4 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): drd templtes for ech rection were prepred through electrophoretic identifiction y constructing recominnt plsmid, synthesizing RNA frgments, nd serilly diluting them to different concentrtions for use in the stndrd curve. The rection volume nd rel-time PCR progrm were similr to those forementioned. The reltive MyHC mrna composition ws expressed s the corresponding copy numer/mg of muscle smple divided y the sum of the copy numer for ech MyHC type, multiplied y 100. The resultnt vlue of reltive MyHC mrna expression ws expressed s percentge Anlysis of met qulity trits nd energy metolism sttus of LD The ph vlues t 45 min nd 24 h postmortem (oth in triplicte), wter holding cpcity (WHC, %), Wrner-Brtzler sher force, nd energy metolism indexes of LD were mesured s reported y Men et l. (2011). Met color of freshly cut cross-section of LD fter 30 min of looming t 4 C ws ssessed using CR-410 Minolt chrom meter (Konic-Minolt, Tokyo, Jpn). Hunter l*, *, *, nd C vlues were recorded. Intrmusculr ft (IMF) content of LD ws quntified using Soxhlet petroleum-ether extrction method. Cretine phosphte (CP) nd cretine (Cr) content of LD ws mesured using HPLC (Men et l. 2012). LD glycogen (Gly), glucose (Glu), glucose-6-phosphoric cid (G-6-P), nd lctic cid (LA) levels nd cretine kinse (CK) ctivity were mesured using stndrd commercil kits (Nnjing Jincheng Biochemicl Institute, Chin). Glycolytic potentil (GP) ws clculted y douling the sum of Gly, Glu, nd G-6-P levels nd y dding LA levels Sttisticl nlysis Sttisticl nlysis ws performed using SPSS 16.0 (SPSS Inc., Chicgo, IL, USA) s descried y Zhou nd Deng (2009). The difference etween genotypes ws ssessed using one-wy nlysis of vrince nd Duncn s test, with reed s the min fctor. The correltion etween different indices ws evluted using the Person ivrite nlysis with two-tiled test of significnce. 3. Results 3.1. Wnt gene expression in porcine LD from four different genotypes nd its ssocition with met qulity The expression profile of Wnt genes in LD from JHP, ZBP, DZB, nd DYL genotypes is shown in Fig. 1. Wnt2 expression ws the lowest in JHP (P<0.05), with no significnt differences mong the other three genotypes (P>0.05). Wnt4 nd Wnt9 expressions were not significntly different etween the four genotypes (P>0.05). In order of decresing Wnt5 expression, the genotypes were JHP, ZBP, DZB, nd DYL, with significnt differences etween ZBP nd DZP nd etween DZP nd DYL (P<0.05). This genotypic order ws reversed for Wnt7, Wnt10, nd Wnt11 expressions, with JHP nd DYL hving the lowest nd highest expressive levels, respectively. Wnt8 expression ws significntly higher in ZBP, with no significnt differences etween JHP, DZB nd DYL (P>0.05). There were significnt differences etween DLY nd DZP (P<0.05) in Wnt10 nd Wnt11 expressions, with no significnt differences etween JHP, ZBP, nd DZP (P>0.05). As shown in Tle 2, the expression levels of Wnt2, Wnt5, Wnt7, Wnt10, nd Wnt11 were significntly correlted with met qulity trits (P<0.05). Specificlly, Wnt5 expression ws negtively correlted with ph 45 min nd ΔpH (P<0.01) nd positively correlted with met color * nd SF vlues (P<0.05). The correltion etween Wnt2, Wnt7, Wnt10, nd Wnt11 expressions nd the ovementioned pork qulity trits ws opposite for Wnt5. Wnt8 expression ws significntly correlted with the IMF content (P<0.05, r= 0.486) Correltion etween Wnt gene expression nd MyHC composition in LD As shown in Tle 3, MyHC I mrna expression ws positively correlted with Wnt5 expression nd negtively correlted with Wnt2, Wnt7, Wnt10, nd Wnt11 expressions (P<0.01). Wnt8 ws significntly correlted with MyHC II (P<0.01, r= 0.579) nd MyHC II composition (P<0.05, r=0.435). Both Wnt10 nd Wnt11 were positively correlted with reltive MyHC IIx composition (P<0.01), nd Wnt11 ws negtively correlted with reltive MyHC II composition (P<0.01) Correltion etween Wnt gene expression nd energy metolism mrkers in LD As shown in Tle 4, Wnt2 gene expression ws positively correlted with G-6-P, LA, GP, nd CP (P<0.05) nd ws negtively correlted with Cr, CK, nd Cr/(Cr+CP) (P<0.05). Wnt4 nd Wnt9 genes hd no significnt correltion with energy metolic indices (P<0.05). Wnt5 expression ws negtively correlted with Gly, G-6-p, GP, nd CP (P<0.05) nd positively correlted with Cr/(Cr+CP) nd CK (P<0.05). Wnt7, Wnt10, nd Wnt11 gene expressions were positively correlted with glycolytic indices (Gly, Glu, G-6-P, LA, nd GP) nd were negtively correlted with CK nd Cr/ (Cr+CP) (P<0.05). Wnt8 gene expression ws positively
4 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): Tle 1 List of genes nd sequences of the primers for rel-time quntittive PCR Gene Primer Sequence (5 3 ) Product size (p) Gene no. reference Wnt2 Forwrd GTAGCCGGGAATCTGCCTTTGTGT TCCTGCCGGCTCTGTTGTTGTGAA 275 XM_ Wnt4 Forwrd AGCCGGGCCCTCATGAACCTCCAC GGGCTCCAAGTACACCAAGTCCT 284 GU Wnt5 Forwrd CGCCGCGGGGGTGGTCA CGGCCGGCCTCGTTGTTGTG 261 XM_ Wnt7 Forwrd CCGCGGCTACAACACCCACCAG ACAGGCGCCCCCACAGCAGAC 260 XM_ Wnt8 Forwrd TCCTAGTGCAGAAGCCGAGTTGA ACAGGCGCCCCCACAGCAGAC 298 XM_ Wnt9 Forwrd GATCTGCGAGCCCGTGTGGACTTC CCGGCCCCGTGGTGGTGAGATG 252 XM_ Wnt10 Forwrd GCCGCTTCCACTGGTGCTGCTACG GACTCCCCCTGACCCCCACCATCT 227 DQ Wnt11 Forwrd GGAACCGCTGGGGAGGATGTGC GGTAGCGGGTCTTGAGGTCTGAGG 273 XM_ S Forwrd CCCACGGAATCGAGAAAGAG TTGACGGAAGGGCACCA 122 AY Zou et l. (2012) c correlted with LA (P<0.05) nd ws negtively correlted with Cr nd CK (P<0.05). 4. Discussion JHP ZBP DZP DYL c c Wnt2 Wnt4 Wnt5 Wnt7 Wnt8 Wnt9 Wnt10 Wnt11 Fig. 1 Wnt gene (Wnt2, Wnt4, Wnt5, Wnt7, Wnt8, Wnt9, Wnt10, nd Wnt11) expression in porcine longissimus dorsi (LD) in four different genotypes: Jinhu (JHP), Zhongi (ZBP), Duroc Zhongi (DZB), nd Duroc Yorkshire Lndrce (DYL). The different letters indicte sttisticl significnce (P<0.05). The error rs in columns represent stndrd devition. The role of Wnt signling on emryonic muscle development, dult skeletl muscle regenertion, muscle fier hypertrophy, nd myofier type hve een previously reported (Mltzhn et l. 2012). However, to our knowledge, there is no informtion on the effect of Wnt signling on pork qulity. Our study investigted the mrna expression profiles of Wnt2, Wnt4, Wnt5, Wnt7, Wnt8, Wnt9, Wnt10, nd Wnt11 in the skeletl muscle of JHP, ZBP, DZB, nd DYL porcine reeds. JHP is ntive porcine reed with very high met qulity, ZBP originted from JHP, DZP is hyrid of Duroc ZBP, nd DYL is generl commercil hyridized pig reed. JHP, ZBP, DZB, nd DYL reeds contin 100, 12.5, 6.25, nd 0% of JHP loodline, respectively. In decresing order of pork qulity, the porcine reeds re JHP>ZBP>DZB>DYL (Men et l. 2011, 2012). Our results reveled tht Wnt5 expression correlted with JHP loodline content in different porcine genotypes. This ws different for the trends oserved in Wnt7, Wnt10, nd Wnt11 expressions. Further, Wnt5, Wnt7, Wnt10, nd Wnt11 expressions hd significnt correltion with postmortem ph decline nd red met color (* vlue). Therefore, Wnt genes nd relted signling pthwys contriuted to the understnding of interspecies differences in pork qulity nd could provide novel informtion for regulting pork qulity. IMF content ffects met tenderness, flvor, mrle grin, nd juiciness. The roles of Wnt signling on lipid deposition hve een confirmed y other reserchers. He et l. (2011) reported tht Wnt10 mrna expression in dipose tissue of Tongcheng pigs ws significntly higher thn tht in Lrge White pigs. β-ctenin, key fctor in the Wnt signling pthwy, my inhiit the differentition of pre-dipocytes, development of ft tissue, nd expression of relted genes in pigs (Kng et l. 2007; Luo et l. 2008; Chung et l. 2012; Mu et l. 2012). Our results reveled
5 6 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): Tle 2 Correltion etween Wnt gene expression nd pork qulity trits in porcine longissimus dorsi (LD) Item 1) Wnt2 Wnt4 Wnt5 Wnt7 Wnt8 Wnt9 Wnt10 Wnt11 ph 45 min ** ** ** ** ** ph 24 h ΔpH ** ** ** ** ** l* * ** * ** ** * * * C SF ** ** ** ** WHC IMF * ) l*, *, *, nd C, the met color prmeters representing light, red, yellow, nd sturtion, respectively. SF, sher force; WHC, wter holding cpcity; IMF, intrmusculr ft. *, P<0.05; **, P<0.01. The sme s elow. Tle 3 Correltion etween Wnt gene expression nd MyHCs mrna proportions in porcine LD Wnt2 Wnt4 Wnt5 Wnt7 Wnt8 Wnt9 Wnt10 Wnt11 MyHCI mrna (%) ** ** ** ** ** MyHCII mrna (%) ** MyHCII mrna (%) * ** MyHCIIx mrna (%) ** ** MyHC (II+IIx+II) (%) ** ** ** ** ** Tle 4 Correltion etween Wnt gene expression nd energy metolism indices in porcine LD Item 1) Wnt2 Wnt4 Wnt5 Wnt7 Wnt8 Wnt9 Wnt10 Wnt11 Glu (µmol g 1 ) * ** Gly (µmol g 1 ) * * * G-6-P (µmol g 1 ) * ** ** ** ** LA (µmol g 1 ) ** ** GP (mmol g 1 ) ** ** ** ** ** Cr (nmol g 1 ) ** * CP (nmol g 1 ) ** ** ** ** ** CK (U mg 1 pro) ** ** ** * ** ** Cr/(Cr+CP) ** ** ** ** ** 1) Glu, glucose; Gly, glycogen; G-6-P, glucose-6-phosphoric cid; LA, lctic cid; GP, glycolytic potentil; Cr, cretine; CP, cretine phosphte; CK, cretine kinse; Cr/(Cr+CP), conversion rte of CP into Cr. tht Wnt8 expression ws negtively correlted with IMF content. This could e ttriuted to the inducing effect of Wnt8 on β-ctenin ctivity (Wodrz nd Nusse 1998). Additionlly, JHP hd reltively high Wnt5 expression in muscle. Even though JHP ws reported to hve high IMF content (Zhou nd Zho 2007), this phenomenon ws not contrdictory ecuse Wnt5 medited the β-ctenin-independent signling pthwy (Wodrz nd Nusse 1998). The role of different Wnt signling pthwys on IMF deposition needs to e evluted in future studies. In dult mmml muscle, myosin hevy chin (MyHC) is composed of four different isoforms (i.e., type I, II, IIx, nd II). The composition rtio of MyHC isoforms reflects the myofier type chrcteristics, contrctile speed, nd metolic type. Muscle fier type is n importnt indictor of pork qulity (Lefucheur 2010). Yng et l. (2012) reported tht the expression of Wnt/β-ctenin signling pthwy-relted genes (i.e., β-ctenin, Fz3, nd GSK-3β) ws positively correlted with MyHC I nd negtively correlted with MyHC II in longissimus dorsi of Lrge White pigs during postntl growth. Wnt3 nd Wnt1 regulted MyoD nd myogenin (MyoG) expressions in skeletl muscle stellite cell differentition (Kim et l. 2008). MyoD nd MyoG were significntly expressed in fst-myofier nd in slow-myofier, respectively (Lis et l. 2007). Slow muscle myosin (i.e., MyHC I) expression in the muscle of four lims ws significntly decresed through inctivtion of β-ctenin in mouse emryo (Hutcheson et l. 2009). Kikuchi et l. (2009) found tht myosttin promoted the formtion of slow muscle fiers through Wnt/β-ctenin signling, nd Wnt5 promoted the increse of slow muscle fiers, while Wnt11 promoted the increse of fst muscle fiers. Additionlly, Ankwe et l. (2003) oserved this phenomenon in developing chicks. We confirmed the phenomenon in dult porcine muscle once
6 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): more. Wnt5 ws positively correlted with the proportion of MyHC I mrna, while Wnt11 ws positively correlted with MyHC (II+IIx+II). Becuse MyHC I mrna ws mjorly expressed in slow MyHC-positive myofier, While MyHC II, IIx nd II mrna were mjorly expressed in fst MyHC-positive myofier. As the ctivtors of Wnt/β-ctenint signling pthwy, Wnt2, Wnt7, nd Wnt10 exhiit negtive correltion with MyHC I mrna nd positive correltion with MyHC (II+IIx+II). Furthermore, Wnt5 nd Wnt11 were the ctivtors of the independent β-ctenint Wnt/C 2+ signling pthwy (De 2011). This indicted tht β-ctenint ws not the only moleculr regulting muscle fier type in the Wnt signling pthwy, nd the specific reltion etween the Wnt gene nd its signling pthwy ws not unique. Therefore, it cn e confirmed tht Wnt genes hve importnt nd complex roles during the formtion of muscle fier types. However, the specific role of the Wnt gene requires further studies. In postmortem muscle, the phosphgen energy supplying system (ATP-CP) nd glycolytic pthwys re the mjor energy-producing systems (Scheffler et l. 2011). Compred with the glycolytic pthwy, the ATP-CP pthwy ffects pork qulity (Men et l. 2011). In the present study, GP nd Cr/(Cr+CP) represent the cpcity of two different energy-providing systems. Wnt5 expression ws positively correlted with the ATP-CP pthwy nd ws negtively correlted with the glycolytic pthwy in our dt. Opposite results were otined for Wnt2, Wnt7, Wnt10, nd Wnt11 expressions. This ws consistent with the reltionship etween Wnt gene expression nd pork qulity trits. Some studies hve reported the effect of Wnt signling on skeletl muscle metolism. For exmple, it hs een reported tht Wnt modultes insulin resistnce in oese rts (Zhou et l. 2012) nd promotes insulin-independent glucose uptke into muscle (Zeve et l. 2012) s well s lipid oxidtion (Scrd et l. 2010). Our results showed tht different Wnt genes or their signling could differently ffect the energy metolism sttus of muscle. However, it ws not cler how different Wnt genes or signling pthwys regulted energy metolism of muscle. 5. Conclusion In this study, the expression levels of Wnt5, Wnt7, Wnt10, nd Wnt11 were significntly correlted with met qulity trits. Wnt5 gene expression positively correlted with high pork qulity formtion, nd the other three Wnt genes negtively ffected the pork qulity. Muscle fier type nd energy metolism could e importnt pthwys for Wnt genes nd their signling, which influences pork qulity trits. Acknowledgements This work ws supported y the Ntionl Nturl Science Foundtion of Chin ( ), the Modern Agro-Industry Technology Reserch System of Chin (CARS-36), nd the Science nd Technology Projects in Zhejing Province of Chin. References Ankwe K, Roson L, Hdley J, Buxton P, Church V, Allen S, Hrtmnn C, Hrfe B, Nohno T, Brown A M, Evns D J, Frncis-West P Wnt signlling regultes myogenic differentition in the developing vin wing. Development, 130, Bonneu M, Leret B Production systems nd influence on eting qulity of pork. Met Science, 84, Brck A S, Conoy I M, Conoy M J, Shen J, Rndo T A A temporl switch from notch to Wnt signling in muscle stem cells is necessry for norml dult myogenesis. Cell Stem Cell, 2, Brck A S, Conoy M J, Roy S, Lee M, Kuo C J, Keller C, Rndo T A Incresed Wnt signling during ging lters muscle stem cell fte nd increses firosis. Science, 317, Brunelli S, Relix F, Besso S, Buckinghm M, Cossu G Bet ctenin-independent ctivtion of MyoD in presomitic mesoderm requires PKC nd depends on Px3 trnscriptionl ctivity. Developmentl Biology, 304, Chung S S, Lee J S, Kim M, Ahn B Y, Jung H S, Lee H M, Kim J W, Prk K S Regultion of Wnt/β-ctenin signling y CCAAT/enhncer inding protein β during dipogenesis. Oesity, 20, Dmon M, Denieul K, Vincent A, Bonhomme N, Wyszynsk- Koko J, Leret B Associtions etween muscle gene expression pttern nd technologicl nd sensory met trits highlight new iomrkers for pork qulity ssessment. Met Science, 95, De A Wnt/C 2+ signling pthwy: A rief overview. Act BIochimicl et BIophysic Sinic, 43, Gros J, Serrlo O, Mrcelle C Wnt11 cts s directionl cue to orgnize the elongtion of erly muscle fires. Nture, 457, Hn X H, Jin Y R, Seto M, Yoon J K A WNT/et-ctenin signling ctivtor, Rspondin, plys positive regultory roles during skeletl myogenesis. Journl of Biologicl Chemistry, 286, He X P, Go H, Liu C X, Fn B, Liu B Cloning, chromosoml locliztion, expression profile nd ssocition nlysis of the porcine Wnt10 gene with ckft thickness. Moleculr Biology Reports, 38, Hutcheson D A, Zho J, Merrell A, Hldr M, Krdon G Emryonic nd fetl lim myogenic cells re derived from
7 8 MEN Xio-ming et l. Journl of Integrtive Agriculture 2016, 15(0): developmentlly distinct progenitors nd hve different requirements for et-ctenin. Genes nd Development, 23, Kng S, Bennett C N, Gerin I, Rpp L A, Hnkenson K D, Mcdougld O A Wnt signling stimultes osteolstogenesis of mesenchyml precursors y suppressing CCAAT/enhncer inding protein lph nd peroxisome prolifertor-ctivted receptor gmm. Journl of Biology Chemistry, 282, Kikuchi A, Ymmoto H, Sto A Selective ctivtion mechnisms of Wnt signling pthwys. Trends Cell Biology, 19, Kim C H, Neiswender H, Bik E J, Xiong W C, Mei L β-ctenin intercts with MyoD nd regultes its trnscription ctivity. Moleculr nd Cellulr Biochemistry, 28, Lefucheur L A second look into fier typing - Reltion to met qulity. Met Science, 84, Lis M, Andrew J W, Biswjit P, Co Y, Tyler A, Moens C B, Tpscott S J Px homeodomin proteins direct Myod ctivity to promote fst-muscle differentition. Development, 134, Luo X, Li H X, Yng G S Sequentil expression of Wnt/β-ctenin signl pthwy relted genes nd dipocyte trnscription fctors during porcine dipose tissue development. Chinese Journl of Biotechnology, 24, (in Chinese) Mltzhn J V, Chng N C, Bentzinger C F, Rudnicki M A Wnt signling in myogenesis. Trends in Cell Biology, 22, Men X M, Deng B, Xu Z W, Liu M H, Qi K K Chrcteristics of ATP-CP system sttus in postmortem muscle nd their ssocitions with pork qulity trits. Scienti Agricultur Sinc, 44, (in Chinese) Men X M, Deng B, Xu Z W, To X Muscle-fire types in porcine longissimus muscle of different genotypes nd their ssocition with the sttus of energy metolism. Animl Production Science, 52, Mu H P, Lin S M, Ye Y Q, Zhng X Q, Li Y G Downregultion of Wnt-10/ctenin-Β nd TGF-Β 3 promotes ft deposition dwrf chicken muscle. In: Animl Antomy nd Emryology Brnch 17th Reserch Assocition of Chinese Assocition of Animl Science nd Veterinry Medicine. July 10th 13th, Tigu, Chin. pp (in Chinese) Newmn D, Mgolski J Qulity Mngement Frm Level: Pork Qulity. Encyclopedi of Met Sciences. 2nd ed. Elsevier Science, Amsterdm. pp Scrd A, Frnzin C, Miln G, Snn M, Dl Prà C, Pgno C, Boldrin L, Piccoli M, Trevellin E, Grnzotto M, Gm P, Federspil G, De Coppi P, Vettor R Incresed dipogenic conversion of muscle stellite cells in oese Zucker rts. Interntionl Journl of Oesity, 34, Scheffler T L, Prk S, Gerrrd D E Lessons to lern out postmortem metolism using the AMPKγ3R200Q muttion in the pig. Met Science, 89, Shi X E, Liu Y G, Yng Q M, Chen Z Z, Yng G S Role of wnt/β-ctenin in the differentition of stellite cells into muscle fiers. Scienti Agricultur Sinc, 45, (in Chinese) Wodrz A, Nusse R Mechnisms of Wnt signling in development. Annul Review of Cell nd Developmentl Biology, 14, Xu L H, Liu C L, Chng Y M, Ling L Q, Liu J L, Go G Q, Hn Q X Theory nd method of doule-stndrd curves method of reltive quntifiction PCR. Biotechnology Bulletin, 1, (in Chinese) Yng Q M, Liu Y G, Shen Q W, Shi X E, Yng G S Activtion cnonicl Wnt signling y LiCi induces porcine skeletl muscle stellite cells differentition into slow muscle. Chinese Journl of Animl Science, 48, (in Chinese) Zeve D, Seo J, Suh J M, Seo J, Suh J M, Stenesen D, Tng W, Berglund E D, Wn Y, Willims L J, Lim A, Mrtinez M J, McKy R M, Milly D P, Olson E N, Grff J M Wnt signling ctivtion in dipose progenitors promotes insulinindependent muscle glucose uptke. Cell Metolism, 15, Zhi H Q, Shen G Y, Wng P Z, Xi C L, Li N, Wng T Y, Feng X H, Chen R A, Zhou Z G, Gu X H, Wn X Q, E Y X, Shi S Y, Fn Z X, Wng B X CAS , Frm Animl Welfre Requirements: Pigs. Stndrds of Chin Assocition, Beijing. (in Chinese) Zhou D, Strkovsky R S, Zhng X Y, Pn Y X The skeletl muscle Wnt pthwy my modulte insulin resistnce nd muscle development in diet-induced oese rt model. Oesity, 20, Zhou G H, Zho G M Biochemicl chnges during processing of trditionl Jinhu hm. Met Science, 77, Zhou Y M, Deng W B SPSS 16.0 nd Sttisticl Dt Anlysis. Southwest University of Finnce nd Economics, Chengdu. (in Chinese) Zou H, Li R, Ji Y, Yng X, Ni Y, Cong R, Solowy P D, Zho R Breed-dependent trnscriptionl regultion of 5 -untrnslted GR (NR3C1) exon 1 mrna vrints in the liverof neworn piglets. PLoS ONE, 7, e (Mnging editor ZHANG Jun)
Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationNorthern blot analysis
Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C 5 2 4 1 um C 5 2 4 1 um Angus dipocytes expressed SCD higher thn Wgyu dipocyte
More informationEffects of Dietary Protein and Energy on Growth Performance and Carcass Characteristics of Betong Chickens (Gallus domesticus) During Growing Period
Interntionl Journl of Poultry Science 9 (5): 468-472, 2010 ISSN 1682-8356 Asin Network for Scientific Informtion, 2010 Effects of Dietry Protein nd Energy on Growth Performnce nd Crcss Chrcteristics of
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationLivestock Science 140 (2011) Contents lists available at ScienceDirect. Livestock Science. journal homepage:
Livestock Science 140 (2011) 111 116 Contents lists ville t ScienceDirect Livestock Science journl homepge: www.elsevier.com/locte/livsci Effects of dietry protein/crohydrte rtio on ft deposition nd gene
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationPaper-based skin patch for the diagnostic screening of cystic fibrosis
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 2015 Supplementry informtion Pper-bsed skin ptch for the dignostic screening of cystic fibrosis Xun Mu,*
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationAbstract. Introduction. V.I. Lushchak 1,*, T.V. Bagnyukova 1,*, J.M. Storey 2 and K.B. Storey 2
Brzilin Journl of Medicl nd Biologicl Reserch (2001) 34: 1055-1064 Effect of exercise on glycolytic enzymes in fish tissues ISSN 0100-879X 1055 Influence of exercise on the ctivity nd the distriution etween
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationSupporting information
Supporting informtion Multiple Univrite Dt Anlysis Revels the Inulin Effects on the High-ft-diet Induced Metolic Altertions in Rt Myocrdium nd Testicles in the Pre-oesity Stte Yixun Dun #, Ynpeng An #,
More informationGeographical influence on digit ratio (2D:4D): a case study of Andoni and Ikwerre ethnic groups in Niger delta, Nigeria.
Journl of Applied Biosciences 27: 1736-1741 ISSN 1997 5902 Geogrphicl influence on digit rtio (2D:4D): cse study of Andoni nd Ikwerre ethnic groups in Niger delt, Nigeri. Gwunirem, Isrel U 1 nd Ihemelndu,
More informationPerformance and Carcass Characteristics of Broiler Chickens Fed Diets Supplemented with Graded Levels of Roxazyme G
Interntionl Journl of Poultry Science 6 (5): 5-9, 2007 ISSN 1682-856 Asin Network for Scientific Informtion, 2007 Performnce nd Crcss Chrcteristics of Broiler Chickens Fed Diets Supplemented with Grded
More informationNicholas James Boddicker Iowa State University. Dorian J. Garrick Iowa State University, Raymond Rowland Kansas State University
Animl Science Pulictions Animl Science 2-2014 Vlidtion nd Further Chrcteriztion of Mjor Quntittive Trit Locus Associted with Host Response to Experimentl Infection with Porcine Reproductive nd Respirtory
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationBritish Journal of Nutrition
(11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationIbrahim, I. Hamid Animal Production Research Center-Khartoum North, Sudan
Interntionl Journl of Poultry Science 13 (8): 484-488, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 Investigtions into the Addition of Herl Methionine (Phytonin) As Sustitute of Synthetic
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationN. J. Boddicker*, D. J. Garrick*, R. R. R. Rowland, J. K. Lunney, J. M. Reecy* and J. C. M. Dekkers* Summary. Introduction. doi: /age.
Vlidtion nd further chrcteriztion of mjor quntittive trit locus ssocited with host response to experimentl infection with porcine reproductive nd respirtory syndrome virus N. J. Boddicker*, D. J. Grrick*,
More informationEffects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle
Effects of Recominnt Bovine Somtotropin Administrtion t Breeding on the Cow, Conceptus nd Susequent Offspring Performnce of Beef Cttle V. R. G. Mercdnte 1, F. M. Cirico 1, D. D. Henry 1, P. L. P. Fontes
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationCyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK
3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α
More informationThe Effects of Small Sized Rice Bowl on Carbohydrate Intake and Dietary Patterns in Women with Type 2 Diabetes
Originl Article doi: 10.4093/kdj.2010.34.3.166 pissn 1976-9180 eissn 2093-2650 The Effects of Smll Sized Rice Bowl on Crbohydrte Intke nd Dietry Ptterns in Women with Type 2 Dibetes Hee-Jung Ahn 1, *,
More informationEvidence for facilitated lactate uptake in lizard skeletal muscle
The Journl of Experimentl Biology 24, 499 46 (2) Printed in Gret Britin The Compny of Biologists Limited 2 JEB3537 499 Evidence for fcilitted lctte uptke in lizrd skeletl muscle E. R. Donovn* nd T. T.
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More informationEffect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens
Interntionl Journl of Poultry Science 7 (12): 1232-1236, 2008 ISSN 1682-8356 sin Network for Scientific Informtion, 2008 Effect of Different Dietry Energy Sources on Induction of Ftty Liver-Hemorrhgic
More informationThe β-globin nuclear compartment in development and erythroid differentiation
The β-gloin nucler comprtment in development nd erythroid differentition Roert-Jn Plstr 1,2, Bs Tolhuis 1,2, Erik Splinter 1, Rin Nijmeijer 1, Frnk Grosveld 1 & Wouter de Lt 1 Efficient trnscription of
More informationThe Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes
The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend
More informationNozzi Valentina, Graber Andreas, Mathis Alex, Schmautz Zala, Junge Ranka
Nozzi Vlentin, Grer ndres, Mthis lex, Schmutz Zl, Junge Rnk Interntionl conference quponics reserch mttes Ljuljn, 22-24 Mrch 216 Some nutrients from the quculture effluents re present in insufficient quntities
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationThe Acute Time Course of Concurrent Activation Potentiation
Mrquette University e-publictions@mrquette Exercise Science Fculty Reserch nd Publictions Exercise Science, Deprtment of 1-1-2010 The Acute Time Course of Concurrent Activtion Potentition Luke Grceu Mrquette
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationA. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5
Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationEffects of Different Sources and Levels of Selenium on Performance, Thyroid Function and Antioxidant Status in Stressed Broiler Chickens
Interntionl Journl of Poultry Science 8 (6): 583-587, 2009 ISSN 1682-8356 Asin Network for Scientific Informtion, 2009 Effects of Different Sources nd Levels of Selenium on Performnce, Thyroid Function
More informationSupplementation and Cooking of Pearl Millet: Changes in Protein Fractions and Sensory Quality
World Journl of Diry & Food Sciences 4 (1): 41-45, 29 ISSN 1817-38X IDOSI Pulictions, 29 Supplementtion nd Cooking of Perl Millet: Chnges in Protein Frctions nd Sensory Qulity Mh A.M. Ali, Adullhi H. El
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationJie Luo, 1 Feiruo Huang, 1 Chenglin Xiao, 1 Zhengfeng Fang, 1 Jian Peng, 1 and Siwen Jiang Introduction
BioMed Reserch Interntionl Volume 2013, Article ID 905918, 9 pges http://dx.doi.org/10.1155/2013/905918 Reserch Article Responses of Growth Performnce nd Proinflmmtory Cytokines Expression to Fish Oil
More informationFood Chemistry. Lijun You a, Mouming Zhao a, *, Joe M. Regenstein b, Jiaoyan Ren a. abstract. Contents lists available at ScienceDirect
Food Chemistry 124 (211) 188 194 Contents lists ville t ScienceDirect Food Chemistry journl homepge: www.elsevier.com/locte/foodchem In vitro ntioxidnt ctivity nd in vivo nti-ftigue effect of loch (Misgurnus
More informationInfluence of slaughter age and carcass suspension on meat quality in Angus heifers
Animl, pge 1 of 9 & The Animl Consortium 2012 doi:10.1017/s1751731112000109 niml Influence of slughter ge nd crcss suspension on met qulity in Angus heifers M. Lundesjö Ahnström 1, A. Hessle 2, L. Johnsson
More informationOptimizing Metam Sodium Fumigation in Fine-Textured Soils
Optimizing Metm Sodium Fumigtion in Fine-Textured Soils Neil C Gudmestd University Distinguished Professor & Endowed Chir of Potto Pthology Deprtment of Plnt Pthology North Dkot Stte University Erly Dying
More informationInfrared Image Edge Detection based on Morphology- Canny Fusion Algorithm
, pp.42-46 http://dx.doi.org/10.14257/stl.2016.137.08 Infrred Imge Edge Detection bsed on Morphology- Cnny Fusion Algorithm Tng Qingju 1, Bu Chiwu 2, Liu Yunlin 1, Zng Jinsuo 1, Li Dyong 1 1 School of
More informationHealth-Related Quality of Life and Symptoms of Depression in Extremely Obese Persons Seeking Bariatric Surgery
Oesity Surgery, 15, 3-39 Helth-Relted Qulity of Life nd Symptoms of Depression in Extremely Oese Persons Seeking Britric Surgery Anthony N. Frictore, PhD; Thoms A. Wdden, PhD; Dvid B. Srwer, PhD; Myles
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationApplication of the Prunus spp. cyanide seed defense system onto wheat: Reduced insect feeding and field growth tests
Appliction of the Prunus spp. cynide seed defense system onto whet: Reduced insect feeding nd field growth tests Supporting Informtion Crlos A. Mor 1, Jons G. Hlter 1,, Cornel Adler 2, Andres Hund 3, Heidrun
More informationEnhanced glutathione peroxidases (GPx) activity in young barley seedlings enriched with selenium
Africn Journl of Biotechnology Vol. 10(55), pp. 11483-11487, 21 Septemer, 2011 Aville online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB11.1480 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationEFFECT OF PHOTOPERIOD AND TRYPTOPHAN AMINO ACID SUPPLEMENTATION ON PINEAL GLAND HORMONE (MELATONIN) AND ITS RELATION TO PERFORMANCE IN LOCAL STRAIN.
Egypt. Poult. Sci. Vol (30) (IV): (927-960) EFFECT OF PHOTOPERIOD AND TRYPTOPHAN AMINO ACID SUPPLEMENTATION ON PINEAL GLAND HORMONE (MELATONIN) AND ITS RELATION TO PERFORMANCE IN LOCAL STRAIN. 1- EFFECT
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationAquatic Toxicology 162 (2015) Contents lists available at ScienceDirect. Aquatic Toxicology. journal homepage:
qutic Toxicology 162 (2015) 39 53 ontents lists ville t ScienceDirect qutic Toxicology journl homepge: www.elsevier.com/locte/qutox Trnscriptionl nd iochemicl mrkers in trnsplnted Perc flvescens to chrcterize
More informationDifferent Dietary Protein and PUFA Interventions Alter the Fatty Acid Concentrations, but Not the Meat Quality, of Porcine Muscle
Nutrients 2012, 4, 1237-1246; doi:10.3390/nu4091237 Article OPEN ACCESS nutrients ISSN 2072-6643 www.mdpi.com/journl/nutrients Different Dietry Protein nd PUFA Interventions Alter the Ftty Acid Concentrtions,
More informationThe Journal of Physiology
J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler
More informationRESEARCH ARTICLE. Wen Li 1, Jing Deng 2 *, Shuang-Shuang Wang 1, Liang Ma 1, Jiang Pei 1, Xiao-Xi Zeng 1, Jian-Xin Tang 1. Abstract.
DOI:http://dx.doi.org/10.7314/APJCP.2014.15.24.10937 Methyltion of the RAR-β Gene nd Cigrette Smoking in NSCLC in Southern-Centrl Chinese RESEARCH ARTICLE Assocition of Methyltion of the RAR-β Gene with
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationResponse of Commercial Egg-Type Pullets to Diets Varying in Protein and Energy Content in Arid Hot Climate
Interntionl Journl of Poultry Science 8 (9): 90-98, 2009 ISSN 682-8356 sin Network for Scientific Informtion, 2009 Response of Commercil Egg-Type Pullets to Diets Vrying in Protein nd Energy Content in
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationInterleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes
ISSN 6-2979, Biochemistry (Moscow), 21, Vol. 3, No. 5, pp. 49-56. Pleides Pulishing, Ltd., 21. Originl Russin Text I. S. Stfeev, S. S. Michurin,3, N. V. Podkuychenko, A. V. Vorotnikov, M. Yu. Menshikov,
More informationEffect of 1-Methylcyclopropene on the Physiology and Yield of Cotton. Derrick Oosterhuis Eduardo Kawakami and Dimitra Loka University of Arkansas
Effect of 1-Methylcyclopropene on the Physiology nd Yield of Cotton Derrick Oosterhuis Edurdo Kwkmi nd Dimitr Lok University of Arknss Cotton Crop Gossypium hirsutum Unique out cotton Perennil grown s
More informationDevelopmental programming of skeletal muscle phenotype/ metabolism
Animl (29), 3:7, pp 11 112 & The Animl Consortium 29 doi:1.117/s1751731194637 niml Developmentl progrmming of skeletl muscle phenotype/ metolism T. C. W. Mrkhm 1-, R. M. Ltorre 2, P. G. Lwlor 3, C. J.
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationToxicity of Silver Nanoparticles to Marine Microalgae Chlorella Vulgaris Xue-jiao ZHANG 1,2,*, Ting-wan ZHANG 1,2 and Romana MANZOOR 1,2
2017 Interntionl Conference on Energy, Power nd Environmentl Engineering (ICEPEE 2017) ISBN: 978-1-60595-456-1 Toxicity of Silver Nnoprticles to Mrine Microlge Chlorell Vulgris Xue-jio ZHANG 1,2,*, Ting-wn
More informationWnt signaling enhances the activation and survival of human hepatic stellate cells
FEBS Letters 581 (2007) 2954 2958 Wnt signling enhnces the ctivtion nd survivl of humn heptic stellte cells Sun Jung Myung, Jung-Hwn Yoon, *, Geum-Youn Gwk, Won Kim, Jeong-Hoon Lee, Kng Mo Kim, Chn Soo
More information