IMMUNE FUNCTION, GENE EXPRESSION, BLOOD INDICES AND PERFORMANCE IN TRANSITION DAIRY COWS AFFECTED BY DIET AND INFLAMMATION DANIEL E.

Transcription

1 IMMUNE FUNCTION, GENE EXPRESSION, BLOOD INDICES AND PERFORMANCE IN TRANSITION DAIRY COWS AFFECTED BY DIET AND INFLAMMATION BY DANIEL E. GRAUGNARD DISSERTATION Sumitted in prtil fulfillment of the requirements for the degree of Doctor of Philosophy in Animl Sciences in the Grdute College of the University of Illinois t Urn-Chmpign, 2011 Urn, Illinois Doctorl Committee: Associte Professor Jun J. Loor, Chir Associte Professor Jmes K. Drckley Associte Professor Wlter L. Hurley Professor Giuseppe Bertoni, Universit Cttolic del Scro Cuore, Picenz, Itly

2 ABSTRACT The trnsition period is ssocited with the pek incidence of production prolems, metolic disorders nd infectious diseses in diry cows. During this time the cow s immune system seems to e wekened; it is pprent tht metolic chllenges ssocited with the onset of lcttion re fctors cple of ffecting immune function. However, the resons for this stte re not entirely cler. The negtive energy lnce ssocited with prturition leds to extensive moiliztion of ftty cids stored in dipose tissue, thus, cusing mrked elevtions in lood nonesterified ftty cids (NEFA) nd β-hydroxyutyrte (BHBA) concentrtions. Preprtl level of dietry energy cn potentilly ffect dipose tissue deposition nd, thus, the mount of NEFA relesed into lood nd ville for metolism in liver. The current feeding prctices for pregnnt non-lctting cows hve een clled into question ecuse incresing mounts of moderte-to-high energy diets (i.e. those more similr to lcttion diets in the content of energy) during the lst 3 wk postprtum hve lrgely filed to overcome periprtl helth prolems, excessive ody condition loss fter clving, or declining fertility. Current preprtl feeding prctices cn led to elevted intkes of energy, which cn increse ft deposition in the viscer nd upon prturition led to compromised liver metolism. Our generl hypothesis ws tht overfeeding dietry energy during the dry period, ccompnied y the metolic chllenges ssocited with the onset of lcttion would render the cow s immune function less responsive erly postprtum. The chpters in this disserttion evluted neutrophil function, metolic nd inflmmtion indices nd gene expression ffected y the plne of dietry energy preprtum nd n erly post-prtum inflmmtory chllenge in diry cows. The diet effect in this experiment ws trnscendentl during the trnsition period nd potentilly during the entire lcttion. Chnges in energy lnce were oserved nd provided good model to study the chllenges ii

3 ssocited with the onset of lcttion. Overll the LPS model provided consistent response representing n inflmmtion incident; however the chnges in metolic indices were sudden nd hrd to detect in most of the cses during the dys following the chllenge. In generl overfeeding dietry energy during the dry period resulted in less responsive immune function during the erly postprtum. In other words, controlling the dietry energy preprtum hs more enefits for the diry cow during trnsition. iii

4 TABLE OF CONTENTS INTRODUCTION... 1 LITERATURE REVIEW... 2 CHAPTER 1: Blood Polymorphonucler Leukocyte Function nd Metolic nd Inflmmtion Indices in Periprtl Diry Cows Fed Two Levels of Dietry Energy Preprtum CHAPTER 2: The Effect of n E. coli Lipopolyscchride Intr-Mmmry Chllenge on Cow Performnce, Metolic nd Inflmmtion indices nd Immune Response of Diry Cttle during Erly-Lcttion CHAPTER 3: Immunometolic Indices nd Heptic Gene Expression re Altered y Level of Dietry Energy Preprtum nd Postprtum Inflmmtory Chllenge in Diry Cows CHAPTER 4: Liver nd Mmmry Glnd Trnscript Profiles Affected y Preprtum Dietry Energy nd Erly-Lcttion E. coli Lipopolyscchride Chllenge in Diry Cttle CHAPTER 5: Periprtl Bovine Blood Neutrophil Metolic, Antioxidnt nd Inflmmtory Gene Networks Affected y Preprtl Level of Dietry Energy SUMMARY AND CONCLUSIONS iv

5 INTRODUCTION The trnsition period is ssocited with the pek incidence of production prolems, metolic disorders nd infectious diseses in diry cows (Drckley, 1999). During this time the cow s immune system seems to e wekened; it is pprent tht metolic chllenges ssocited with the onset of lcttion re fctors cple of ffecting immune function. However, the resons for this stte re not entirely cler (Goff, 2006). The negtive energy lnce ssocited with prturition leds to extensive moiliztion of ftty cids stored in dipose tissue, thus, cusing mrked elevtions in lood non-esterified ftty cids (NEFA) nd β-hydroxyutyrte (BHBA) concentrtions (Drckley et l., 2001). Preprtl level of dietry energy cn potentilly ffect dipose tissue deposition nd, thus, the mount of NEFA relesed into lood nd ville for metolism in liver (Drckley et l., 2005). The current feeding prctices for pregnnt non-lctting cows hs een clled into question ecuse incresing mounts of moderte-to-high energy diets (i.e. those more similr to lcttion diets in the content of energy) during the lst 3 wk postprtum hve lrgely filed to overcome periprtl helth prolems, excessive ody condition loss fter clving, or declining fertility (Beever, 2006). Current preprtl feeding prctices cn led to elevted intkes of energy, which cn increse ft deposition in the viscer nd upon prturition led to compromised liver metolism (Beever, 2006, Drckley et l., 2005). Our generl hypothesis ws tht overfeeding dietry energy during the dry period, ccompnied y the metolic chllenges ssocited with the onset of lcttion would render the cow s immune function less responsive erly postprtum. The chpters in this disserttion evluted neutrophil function, metolic nd inflmmtion indices nd gene expression ffected y the plne of dietry energy preprtum nd n erly post-prtum inflmmtory chllenge in diry cows. 1

6 LITERATURE REVIEW The Trnsition Period The trnsition period is defined s the stge in the lcttion cycle where the cow undergoes trnsition from eing pregnnt nd non-lctting into the eginning of lcttion fter prturition (Drckley, 1999). The durtion of the dry period vries ccording to mngement strtegies nd hs een divided into the fr-off (generlly the first 4 to 6 wk fter dry off) nd the close-up (generlly the lst 3 wk efore expected prturition) (Dnn et l., 2006). The length of the trnsition period encompsses the lst 3 wk of the dry period (from the close-up) until 3 wk fter prturition (Drckley, 1999, Grummer, 1995). Nutrient demnds for support of fetl growth nd initition of milk synthesis re incresed during the trnsition period (Grummer, 1995). In contrst, this period is chrcterized y 30% reduction in dry mtter intke (Kedmi nd Peer) t 5 to 7 d preprtum followed y stedy increse from 0 to 21 (ut lso fter it) d postprtum (Bertics et l., 1992). Mrked chnges in endocrine sttus occur to prepre prturition nd lctogenesis (Grummer, 1995). Progesterone concentrtions during gesttion remin elevted to mintin pregnncy ut concentrtions decline rpidly pproximtely 2 d efore clving; in the sme fshion, estrogen increses in plsm during lte gesttion ut decreses immeditely t clving (Chew et l., 1979). Growth hormone increses grdully s the cow progresses from lte gesttion into erly lcttion; however, the pek occurs t prturition (Kunz et l., 1985). Plsm NEFA increse slightly round 2 wk efore prturition nd the concentrtion increses drmticlly round nd fter prturition (Grummer, 1995). Plsm thyroxine nd triiodothyronine concentrtions grdully increse during lte gesttion, decresing sustntilly t clving nd incresing once gin few weeks fter prturition (Kunz et l., 1985). Prolctin increses shortly efore 2

7 prturition (Frmer nd Petitclerc, 2003) nd Glucocorticoid nd prolctin concentrtions increse on the dy of clving nd return to ner preprtum concentrtions soon fter prturition (Edgerton nd Hfs, 1973). The increse in nutrient demnd, the drstic chnges in endocrine sttus nd the decrese in DMI during lte gesttion influence metolism; in prticulr the metolism of lipid (Grummer, 1995). Adipose tissue, liver, gut, nd mmmry glnd re key components of the dpttions tht diry cows experience to chieve the necessry lnce to dpt to the onset of lcttion (Drckley, 1999). The trnsition period is considered the most importnt phse during the lcttion cycle since successful trnsition cn effectively determine profitle lcttion (Drckley, 1999). However, immunosuppression during this period leds to incresed susceptiility to invding pthogens (Mllrd et l., 1998) nd the incidence of helth prolems during this time reltive to the rest of the lcttion cycle is significntly greter (Drckley, 1999). In ddition, the trnsition period is where the risk for mmmry infections, displced omsums, milk fever, ketosis, retined fetl memrnes nd metritis is t pek (Shver, 1997, Smith et l., 1985). Besides infectious diseses it is lso importnt to mention tht high susceptiility for metolic disorders occurs during this time (Drckley, 1999) nd these cn e lso responsile of proinflmmtory cytokine rise with consequent negtive effects (Bertoni et l., 2008). Controlling Energy during the Dry Period Energy consumption (or dry mtter intke) my e the determining fctor for the success of the trnsition period (Drckley, 1999). Conventionlly t dry-off, cows re fed high forge rtions with higher fier content compred to the lcttion diet; this chnge ffects the cteril popultion, the sorptive cpcity nd size of the rumen ppille nd consequently the 3

8 sorption cpcity of VFA in the rumen (Goff nd Horst, 1997). Cows remin on high fier diets until the close-up period when rtions of higher energy nd nutrient density re fed ( stem-up diets) in n effort to dpt the rumen microil popultion nd ppille to the highgrin diets fed fter clving (Grummer, 1995). Regrdless of the diet djustments during the dryoff nd close-up periods, there is evidence tht diry cows cn esily consume more energy thn required during these times (Dnn et l., 2006, Jnovick nd Drckley, 2010) except the fier, energy nd protein contents re specificlly nd well lnced (Bertoni nd Trevisi, 2008). Overll, reserch dt is unsuccessful demonstrting tht stem-up diets relily nd repetedly improve production, ody condition, or the immune sttus of the trnsition cow. Our group t the University of Illinois hs een doing extensive reserch whether controlling energy intke during the dry period might led to etter trnsition (Dnn et l., 2006, Dougls et l., 2006, Jnovick nd Drckley, 2010) The strtegy used is to formulte nd feed rtions with reltively low nd diluted energy density ( Mcl NE L /kg DM) during the entire dry period. The incorportion of low energy ingredients (strw or low qulity grss hys) is key in these types of rtions since they llow cows to consume d liitum without exceeding their dily energy requirements (Jnovick nd Drckley, 2010). Controlling energy intke, with high fier rtions, seems to improve DMI fter prturition voiding excessive dipose tissue moiliztion (Dougls et l., 2006). Milk production ppers to e similr to the yield otined with higher energy close-up progrms (Dougls et l., 2006, Jnovick nd Drckley, 2010). Some of the enefits of feeding low energy- high fier rtions include reduction in the incidence of displced omsum resulting from greter rumen fill tht is mintined for longer periods, thus, helping regulte feed intke. Body condition, reproductive success nd foot helth lso my e improved (Jnovick nd Drckley, 2010). From prcticl 4

9 stndpoint, feeding single low energy- high fier diet simplifies dry cow mngement voiding socil stress due to group chnges (Cook nd Nordlund, 2009) nd single group feeding insted of the two stge group pproch (Dnn et l., 2006). Finlly, in the mjority of the cses strw is redily ville nd likely the cost of the rtion will e similr or less expensive thn feeding fr-off nd close-up diets. Energy Blnce in the Periprturient Cow In generl, nimls ttempt to chieve energy equilirium regrdless of physiologicl nd environmentl circumstnces using the ville energy in the diet nd the tissue reserves (Bile nd Fores, 1974). In the cse of diry cows during trnsition, s mentioned efore, there is mrked decrese in DMI which in turn limits the consumption of dietry energy, nd hs negtive impct on the energy lnce equilirium (Bertics et l., 1992). At the sme time, nutrient demnds for fetus needs nd for mmmry glnd development s well s for initition of milk synthesis re incresed ggrvting the energy lnce sttus (Grummer, 1995). After prturition, s milk production increses, the energy needed for milk production increses resulting in stge of negtive energy lnce (NEB). To meet the energy requirements of this period, diry cttle rely on moiliztion of dipose nd muscle tissue (Drckley, 1999). This period of NEB lsts until the yield of milk strts to decline (6 10 wk fter prturition) nd the energy from the DMI ecomes sufficient to meet the cow s requirements (Roche et l., 2009). The degree of NEB tht cows experience most likely would e function of the milk yield since high producing diry cows would require greter mount of energy for lcttion (Detilleux et l., 1994). A period of severe NEB, where extended moiliztion of dipose tissue hs occurred, could result in the incidence of metolic disorders such s ketosis nd ftty liver (Drckley, 1999). 5

10 A centrl re in the iology of the trnsition cow is relted to the metolism of lipids. In the process of moiliztion of energy, the dipose, mmmry nd liver tissues re key components for the dpttions diry cows undergo. Briefly, high NEFA concentrtions in the loodstrem re consequence of hydrolyzed dipose tissue tricylglycerol y the ction of hormone sensitive lipse (Zmmit, 1984). At this point NEFA cn e utilized s n energy source y other tissues (Drckley, 1999). However, the liver is the most importnt site for removl of NEFA from circultion (Bell, 1979); NEFA tht rech the liver re extrcted in concentrtion-dependent mnner nd converted to cyl-coa y the enzyme cyl-coa synthethse. Crnitine plys n importnt role in the trnsport of cyl-coa into the mitochondri mtrix, where β-oxidtion will occur (Zmmit, 1984). In the mitochondri, cyl- CoA is oxidized through β-oxidtion into cetyl-coa nd cn e further oxidized for energy in the citric cid (TCA) cycle. However, if the mounts of cetyl-coa generted in ftty cid β- oxidtion chllenge the processing cpcity of the TCA cycle or if ctivity in the TCA cycle is low due to low mounts of intermedites such s oxlocette, cetyl-coa is then used for iosynthesis of ketone odies (Drckley, 1999). Prtilly oxidized cetyl-coa is converted into the ketone odies cetocette (ACAC), BHBA, nd cetone, which re relesed from the liver into the lood (Bell, 1979). Ketones cn e used s n lternte wter-solule fuel source y mny tissues (e.g., hert nd skeletl muscle) when glucose is limited (Leslie et l., 2000). However, if the rte of lipid moiliztion exceeds the rte of ketone ody utiliztion, then ketones ccumulte nd my dversely ffect the helth nd productivity of the cow (Ingvrtsen nd Andersen, 2000). 6

11 Ketosis nd Liver Lipidosis Ketosis is chrcterized y mrked increses in circulting ketones nd primrily occurs within few weeks fter prturition; this prolem is closely relted with the typicl decrese of DMI tht occurs efore prturition nd in mny cses is ggrvted when feed intke is significntly reduced fter clving (Ingvrtsen nd Andersen, 2000). Ketosis cn occur s either su-clinicl or clinicl condition. Su-clinicl ketosis is chrcterized y greter thn norml concentrtions of ketones in circultion ( µmol/l) with no dverse effects oserved (Duffield et l., 2009). Clinicl ketosis is chrcterized y even higher concentrtions of circulting BHBA long with physicl signs such s loss of ppetite (decresed DMI), decrese in lood ph nd drop in ody weight nd ody condition score. With the drop in DMI, there is commonly oserved drop in milk yield, nd n increse in susceptiility to infectious diseses (Gerloff, 2000). Constnt supervision nd tretment is necessry in the clinicl cses. In the worst cses culling or even deth occurs (Geishuser et l., 1998, Kremer et l., 1993). Nerly 50% of high-producing cows experience cse of su-clinicl ketosis nd pproximtely 6% of the su-clinicl cses proceed to clinicl ketosis in erly lcttion (Geishuser et l., 1998, Grohn et l., 1989). Another fte NEFA cn undergo in the liver is to e esterified nd exported s triglycerides within very low density lipoproteins (VLDL) to extr heptic tissues such s the mmmry glnd, where the ftty cids re incorported into milk ft TG (Smith et l., 1997). However, this lst outcome occurs to limited extent in diry cows nd when cows consume excess energy during the dry period it frequently results in the metolic disorder of ftty liver (Drckley, 1999). During the trnsition period the ility of the liver to utilize NEFA nd secrete triglycerides decreses s the durtion nd seriousness of NEB increses (Morrow, 1976). A 7

12 further cuse of lipidosis cn e lower synthesis of po-lipoproteins in cse of serious inflmmtions t clving time (Bertoni et l., 2004). Therefore, triglycerides tend to uild up in the liver, decresing liver function nd eventully cusing liver lipidosis (Drckley, 1999). When the mount of lipid infiltrtion in the liver ecomes severe diry cows re more susceptile to other pthologies nd t the sme time, when tretment is functionl the recovery period is prolonged (Herdt, 1988). Immune cells nd Mechnisms of Defense The immune system is integrted y diversity of cells nd molecules tht re cple of recognizing nd eliminting invding foreign microorgnisms in specific mnner (Bumnn nd Guldie, 1994). There re two mechnisms of defense: innte nd specific. Both mechnisms interct in order to recognize nd discriminte etween foreign sustnces nd the host s own molecules (Kehrli nd Hrp, 2001). Among the most common immune cells re the mcrophges; they re the first line of defense ginst invding microorgnisms nd ply key role in the innte immune response. Mcrophges evolve from monocytes. They re originted in the one mrrow during hemtopoiesis, nd then enter the lood where they differentite into mture monocytes. Within 8 h, circulting monocytes will enlrge nd migrte into tissues where they further differentite into tissue-specific mcrophges (Goldsy et l., 2000). They detect nd recognize non-specific foreign pthogens loclly nd produce cytokines tht initite the immedite sets of rections tht re known s the cute phse response (Bumnn nd Guldie, 1994). Also they recruit other immune cells to the site of infection nd re the ridge etween the innte nd specific immune responses through ntigen presenttion to prime T cells (Rinrd nd Riollet, 2006) 8

13 The neutrophils re known s polymorphonucler (PMN) leukocytes for their multiloed nucleus nd grnulted cytoplsm; these cells constitute up to 70% of the circulting white lood cells (Goldsy et l., 2000). After initition of the inflmmtory response, PMN ecome the predominnt cell type oserved during n infection. Like mcrophges, PMN re originted during hemtopoiesis in one mrrow, which tkes pproximtely 10 to 14 d for PMN to mture (Binton et l., 1971). In circultion, the hlf-life of PMN is short (8.9 h), nd once in tissues, PMN function for only 1 to 2 d (Ppe et l., 2002). The life spn of PMN is tightly regulted ecuse these cells cn cuse tissue nd lood vessel dmge through the production of rective oxygen metolites during respirtory urst, s well s grnulr secretion of ntimicroil proteins. Therefore, PMN undergo poptosis once they re relesed from the one mrrow to minimize host tissue dmge (Cpuco et l., 1986). During n infection, PMN migrte from lood to the tissue in response to chemottrctnts secreted from either mcrophges or the epithelil cells within the tissue (Goldsy et l., 2000). During dipedesis (migrtion from lood into the tissue), chemottrctnts stimulte endothelil cells to express specific molecules (i.e., E-selectin nd P-selectin) tht llow the PMN to dhere to the endothelil cell surfce. Lymphocytes re produced in one mrrow y white lood cells through hemtopoiesis nd ecome ctivted due to response to locl ntigenic stimultion (Asi et l., 1998). They proliferte nd recognize foreign ntigens through memrne receptors. Lymphocytes consist of T nd B lymphocytes. The T cells cn e su divided into T-helper nd T-cytotoxic (CTL) lymphocytes. The T-helper cells produce cytokines, such s interleukin- 2 (IL-2) nd interferons (IFN), which re crucil for n effective cell medited immune response. The B lymphocytes differentite to produce proteins clled ntiodies or immunogloulins (Ig) nd effector B cells, or plsm cells (Sordillo et l., 1997). Plsm cells re importnt for the specific immunity; one 9

14 of the min functions is the production of ntiodies. Immunogloulins, such s IgG 1, IgG 2, nd IgM, re the primry defense mechnisms for specific immunity (Pgnelli et l., 1984). The Acute Phse Response In the presence of injury, trum or infection the host orgnism in n effort of preventing further dmge, executes series of vsculr rections tht cuse inflmmtion. The eginning of this cscde of events is prt of the innte immunity nd is commonly ssocited with tissue mcrophges. Activted mcrophges relese rod spectrum of meditors in which cytokines interleukin-1 (IL-1) nd tumor necrosis fctor (TNF) ply n importnt role recruiting immune cells (Bumnn nd Guldie, 1994). These cytokines perform different functions loclly nd systemiclly. Loclly they ct on stroml cells cusing relese of secondry wve of cytokines; some of these cytokines might hve een relesed erlier y the mcrophges, however, it is this secondry wve the one tht increses the homeosttic signl tht initites the cute phse response (APR). The secondry wve of cytokines relesed y the locl tissues includes interleukin-8 (IL-8) nd monocyte chemottrctnt protein (MCP). These chemokines (cytokines with chemotctic cpcity), pper to control the migrtion of immune cells. Migrtion from the lood to the ffected tissue tkes plce y dipedesis (Suriysthporn et l., 1999). The min cells tht respond to the innte response re PMN nd monocytes tht will control in specific mnner ny invding microorgnisms (Ppe et l., 1991). During the progressing APR, leukocytes lso synthesize nd relese their own prticulr set of cytokines within the tissue. At this point there is n ltertion of the temperture set point in the hypothlmus generting ferile response tht will inhiit the growth of pthogens (Bumnn 10

15 nd Guldie, 1994). If the infection persists, t this point the specific immunity, lso known s humorl or cquired immunity, tkes control (Mllrd et l., 1998). Phgocytosis Some of the immune cells in the innte nd specific system perform phgocytosis. This process consists in the ingestion of microorgnisms y phgocytic cells (Ppe et l., 1979). Phgocytosis first requires the dherence nd tgging for ingestion nd destruction (opsoniztion) of mcrophges or PMN to the cell wll of cteri. Cell surfce receptors found on phgocytic cells tht re specific for certin opsonins, such s certin clsses of ntiodies nd components of complement, lso cn enhnce dherence nd phgocytosis (Goldsy et l., 2000). Once the microorgnism is completely surrounded nd enclosed y the pseudopodi, it then enters the cytosol s memrne-ound structure clled phgosome. The phgosome then fuses with lysosome, which contins enzymes tht digest engulfed mteril, to form phgolysosome. During this process, urst of oxidtive metolism clled the respirtory urst occurs in ctivted phgocytes vi the ctivtion of memrne-ssocited nicotinmide denine dinucleotide phosphte (NADPH) linked oxidse tht ctlyzes the reduction of oxygen to superoxide nion (O - 2 ). After the respirtory urst, the digested contents of the microorgnism re eliminted y exocytosis (Burvenich et l., 2004). The Liver Systemic Response to Inflmmtion The liver is centrl orgn during n inflmmtory response in the orgnism. It is responsile for determining the level of essentil metolites during the criticl stges of stress. In ddition, the liver synthesizes the necessry components for immedite defense t the site of 11

16 tissue dmge (Bumnn nd Guldie, 1994). During n ongoing APR the liver synthesizes certin plsm proteins known s cute phse proteins (APP) (Koj et l., 1988). The cute phse proteins posses pthogen pttern recognition cpcity nd their min role is the ctivtion of the complement system cscde tht concludes in pthogen destruction (Goldsy et l., 2000). The concentrtion of most of the APP increse during inflmmtion (positive APP); this group includes fririnogen (FBG), α1-cid glycoprotein (AGP), hptogloin (HP), α1-proteinse inhiitor (API), α1-ntichymotrypsin (ACT), C-rective protein (CRP), C3 complement (C3C), serum myloid A protein (SAA), α2-mcrogloulin (A2M) nd α1-cysteine proteinse inhiitor (CPI). Conversely, the concentrtion of some APP decrese (negtive APP) during inflmmtion; these proteins include lumin (BSA) nd trnsferrin (Koj et l., 1988). However the physiologicl function of mny APP is still not completely understood ut some of these proteins re prt of the innte immune system (Goldsy et l., 2000). In cttle, the most sensitive cute phse proteins re HP nd SAA; the concentrtion of which in serum cn increse over 100-fold showing sustntil rise in the response to cute inflmmtion. Also, moderte APP in cttle is AGP, which hs lower reltive rise indicting chronic conditions (Pyorl, 2003). Regultion of APP synthesis in the liver is ccomplished in prllel with the recruitment of immune cells y inflmmtory meditors. The meditors fll into four mjor ctegories: Interleukin-6 (IL-6) type cytokines, IL-1 type cytokines, glucocorticoids nd growth fctors (Bumnn nd Guldie, 1994). Interleukin-6 type cytokines include IL-6, interleukin-11, leukemi inhiitor fctor (LIF), oncosttin M (OSM) nd ciliry neutrophic fctor (CNTF); this group of cytokines, especilly IL-6, hs een recognized to e the principl regultor of most APP including HP, FBG, API nd A2M (Mckiewicz, 1992). IL-1 type cytokines include IL-1α, IL-1β, TNFα nd TNFβ. These cytokines regulte AGP, SAA nd CRP (Bumnn nd Guldie, 12

17 1994). Glucocorticoids stimulte the expression of APP directly (AGP) nd indirectly y enhncing the effect of the IL-1 nd IL-6 types (Syers et l., 1990). Finlly the growth fctors include insulin-like growth fctor (IGF), insulin, heptocyte growth fctor (HGF), firolst growth fctor (FGF) nd trnsforming growth fctor-β1 (TGF-β1). These meditors re le to suppress IL-1 nd IL-6 type cytokines, hving n indirect impct on the APP (Mckiewicz et l., 1990). Mstitis Mstitis is defined s mmmry glnd (MG) inflmmtion; it is frequently ssocited with the presence of pthogen (Brdley, 2002).The decrese in profit tht results from mstitis is ssocited with the loss in milk production, tretment costs, removl of milk from the ulk tnk fter tretment ws dministered, veterinry costs, incresed lor, premture culling, nd sometimes even deth of the niml (Miller et l., 1993). Mstitis cn e clssified into suclinicl nd clinicl depending on severity nd durtion of the inflmmtion. During su-clinicl mstitis, there re no visul signs of n infection, somtic cell counts (SCC) in milk re usully elevted, nd milk production is decresed (Sordillo et l., 1997). Clinicl mstitis is chrcterized y n elevted SCC in milk nd visul signs of n infection cn e oserved such s clumpy, wtery, loody nd/or yellowish colored milk. In ddition, clinicl mstitis cuses decrese in milk production nd feed intke, swelling of the udder, nd, in extreme cses, septicemi cused y mstitis cn cuse deth (Constle nd Morin, 2003). Milk composition cn lso e ffected, including ltered slinity, electricl conductivity, cidity, ppernce, nd flvor, s well s incresed SCC nd decresed csein nd ft content (Gill et l., 1990). 13

18 A high proportion of intr-mmmry infections occur during the first wk of the dry period when milk flow ceses nd cteri invde from the strek cnl efore the glnd is fully involuted (Sordillo et l., 1997). However, mmmry infections t this time often do not result in clinicl mstitis. Although mny of the pthogens re eliminted y the immune cells during the dry period, some re simply held in check until the eginning of the next lcttion. Clinicl mstitis is most likely to occur during the first mo of lcttion (Oviedo-Boyso et l., 2007) nd in mny cses results from n infection estlished during the dry period or during erly lcttion (Goff nd Horst, 1997). Once pthogen is detected y the receptors in the epithelil cells of the MG the APR response egins, the immune system is ctivted to eliminte the pthogen. This defense mechnism includes ntomicl, cellulr, nd solule fctors tht ct in coordintion nd re crucil to the modultion of the MG resistnce nd susceptiility to infection (Oviedo-Boyso et l., 2007). The pthogens ssocited with mstitis cn cuse significnt nd irreversile dmge to the MG. In most of the cses the pthogens consist primrily of cteri ut, in rre cses, yests cn cuse infection. Mstitis pthogens cn e environmentl or contgious (Anderson et l., 1982). Environmentl pthogens re commonly found in the environment such s mnure, soil, nd edding. These orgnisms enter the MG, proliferte, nd trigger host immune response tht kills the invding cteri in most cses. The mjor environmentl cteri re coliforms such s Escherichi coli, Klesiell species, nd environmentl Streptococcus nd Enterococcus; however, Streptococcus ueris cn persist nd ecome chronic infection (Sordillo et l., 1997). One of the most importnt environmentl cteri tht cuse ovine mstitis is Escherichi coli. Mstitis cused y E. coli cn e resolved in few dys nd it is chrcterized y pin, inflmmtion of one or ll MG qurters, fever, nd milk with clots nd norml ppernce 14

19 (Burvenich et l., 2003). Apprently, the severity of mstitis depends on the cteril strin tht infects the MG, nd the speed with which neutrophils move from the loodstrem to the MG depends on the severity of mstitis. Neutrophil recruitment to n MG infected with E. coli occurs with dely of 16 h post-infection (Oviedo-Boyso et l., 2007). Contgious mstitis is trnsferred y orgnisms tht live nd proliferte on or within the host nd generlly do not survive outside of the niml s ody. They re primrily spred t or round the time of milking from one cow to nother. The mjor contgious pthogens tht colonize the MG re Stphylococcus ureus, Streptococcus dysglctie, Mycoplsm nd Streptococcus glctie (Dinsmore, 2002). Recognition of Lipopolyscchride When mstitis occurs, the first detection event of the immune response occurs when the invding pthogen intercts with memrne receptors of the host cple of precisely discriminting etween self nd non-self. These moleculr sensors (e.g. Toll like receptors, CD14) re known s pthogen recognition receptors nd re cple of distinguishing structures tht re prt of microil species nd in prticulr recognize moleculr ptterns. When such ptterns re found on pthogens, they re clled pthogen ssocited moleculr pttern (PAMP) (Goldsy et l., 2000). Pthogens tht cuse mstitis hve cell wll structures tht re recognized y the host moleculr sensors. These structures re lipopolyscchride (Smll et l., 2000), peptidoglycn (PGN), nd lipoteichoic cid (LTA), which constitute the PAMP (Bnnermn et l., 2004). These PAMP re recognized y Toll like receptors (TLR). It is now known tht TLR4 recognizes the LPS of Grm-negtive cteri (e.g. E. coli) nd molecules such s firinogen, 15

20 het shock proteins, nd polypeptides, wheres TLR2 is implicted in recognition of LTA nd PGN from Grm-positive cteri (e.g. S. ureus) (Tkeuchi et l., 2000). In cute mstitis cused y coliforms, recognition of LPS is fundmentl to the MG immune response. LPS nd other cteril cell wll structurl components re recognized y the TLR4 nd the plsm memrne CD14 receptors. CD14 is glycoprotein expressed on the surfce of monocytes, mcrophges, nd neutrophils (Rietschel et l., 1998). CD14 hs een ssigned functionl role, serving s receptor for LPS in ssocition with the lipopolyscchride-inding protein (LBP) (Wright et l., 1990). LPS-inding protein is n cutephse rectnt produced y the liver. In the presence of LBP, CD14 hs een implicted s high-ffinity LPS receptor, fcilitting LPS-induced mcrophge ctivtion. In ddition, severl lternte LPS receptors hve een descried which my prticipte in the host response to endotoxin (e.g. CD18 nd p73) (Rietschel et l., 1998). Severl studies hve used LPS to evlute the effect of the APR in production vriles s well on immune response (e.g. leukocyte function). There is evidence tht the LPS model genertes locl nd systemic ction involving immune cells nd the liver (Mehrzd et l., 2001). Findings indicte tht the liver produces inflmmtory cytokines nd SAA nd HP fter mstitis induced with LPS (Vels et l., 2009). Gene Expression Technology New moleculr iology pproches cn e used to understnd the sics of the models used in diry cttle reserch with promising prospects for the future (Drckley et l., 2006). The technique rodly known s microrry llows direct nd simultneous comprison of multiple smples (Ling et l., 2002) so tht reltive chnges in gene expression etween nd within 16

21 individuls cn redily e identified. Microrry sed technologies for gene expression re widely populr in the scientific community nd provide severl dvntges over other techniques (Schen et l., 1995). In prticulr, they llow the glol ssessment of gene expression. It is therefore possile to sses not only the expression sttus of prticulr gene, ut lso the expression pttern of tht gene reltive to others, which clerly represents n useful pproch for understnding polygenic regultion of complex processes. There re vriety of microrry pltforms tht hve een developed (Cummings nd Relmn, 2000). Bsiclly glss slide or memrne is spotted or rryed with DNA frgments or oligonucleotides tht represent specific coding regions of genes. Construction of microrrys is generlly dependent on informtion gined from genome sequencing or EST (expressed sequence tg) projects tht provide lrge sets of nnotted clones nd sequences (Rimm et l., 2001). The construction of cdna microrry slides is sed on frgments of cndidte genes provided y the investigtor. PCR products or oligonucleotides re directly spotted or printed onto glss slides to develop microrry (Kurniemi et l., 2001). Oligonucleotides cn e designed nd purchsed from numer of commercil providers. Purified RNA is then fluorescently or rdioctively leled nd hyridized to the slide/memrne. In some cses, hyridiztion is done simultneously with reference RNA to fcilitte comprison of dt cross multiple experiments. Signl intensity dt for ech spot on microrry is otined y lser scnning or utordiogrphic imging. At this point, the dt my then e entered into dtse nd nlyzed. The University of Illinois hs developed 13,257 oligonucleotide ovine microrry, which essentilly represented n expnsion of the 7,000 cdna microrry pltform developed originlly (Everts et l., 2005). Detils of the development of the microrry pltform used cn e found in the Supplementry Mterils nd Methods from (Loor et l., 2007). Briefly, n 17

22 emryonic ovine cdna lirry nd 38,732 high-qulity expressed sequence tg (EST) sequences sed on the cttle 7,872 cdna rry (Everts et l., 2005) were filtered for repets s well s sequences of virl, cteril, or mitochondril origin using RepetMsker (Smit nd Green, 1999). Susequently, seventy-se long (i.e., 70-mers) oligos from the unique cluster nd singlet sequences were designed. Sequence lignments of designed oligos (Tle 1) were done y BLASTN similrity serches ginst humn RefSeq, mouse RefSeq, ovine RefSeq, humn UniGene, mouse UniGene, ovine UniGene, ovine TIGR nd the ovine genome using n E- vlue cut-off of E e -5 nd scoring threshold of 40 p (Everts et l., 2005). Best hits were used to nnotte the cttle sequences. NCBI UniGene nd Gene dtses were used for functionl nnottion (e.g., gene symol, gene nme, function, OMIM numer, PuMed identifiction numers) nd Gene Ontology (GO) nnottion (Everts et l., 2005). This microrry contins c. 97% unique elements. Different studies hve explored nd linked lrge-scle liver (Loor et l., 2005, Loor et l., 2006, Loor et l., 2007) nd mmmry (Moyes et l., 2010, Pintoni et l., 2010) tissue gene expression dt with typicl lood metolite, performnce nd liver composition dt to study tissue function under different physiologicl conditions. The integrtion of functionl genomics technology with mesurements of metolism otined y conventionl methods is prticulrly promising to find new nswers (Drckley et l., 2006). Findings of the experiments previously mentioned hve reveled genes tht could ply key roles in heptic metolic dpttions to negtive energy lnce. Coupling metolic nd performnce dt with gene expression llowed the development of n integrtive model of liver function during ketosis (Loor et l., 2007). In the mmmry glnd, gene expression results hve provided novel informtion out the erly signling nd ctivtion of pro-inflmmtory pthwys ssocited with the innte 18

23 immune response to infection. These pthwys hve een ssocited with the inhiition of lipid synthesis nd PPAR signling tht could prtilly explin the inverse reltionship etween immune response nd milk ft synthesis (Moyes et l., 2010). In this thesis proposl, the use of the current microrry technology is pplied to ctul prolems of diry cttle iology in order to uncover nswers tht could serve to improve the diry industry. Summry The trnsition period is considered the most importnt phse during the lcttion cycle (Drckley, 1999). The increse in nutrients demnd, the drstic chnges in endocrine sttus nd the decrese in DMI during lte gesttion influence metolism rendering diry cows to stte of immunosuppression tht leds to incresed susceptiility to mmmry infections (Mllrd et l., 1998) nd metolic disorders (Drckley, 1999). Energy consumption my e determinnt fctor for the success of the trnsition period; regrdless of the diet djustments during the dryoff nd close-up, there is evidence tht diry cows cn esily consume more energy thn required during these periods (Dnn et l., 2006). During NEB the cow relies on dipose tissue moiliztion leding to greter incidence of metolic disorders like ketosis nd ftty liver (Drckley, 1999). The incorportion of low energy ingredients (strw or low qulity grss hy) is key in the formultion of dry period rtions since it llows the cows to consume d liitum without exceeding their dily energy requirements. Controlling energy with high fier rtions seems to improve DMI fter prturition voiding excessive dipose tissue moiliztion. Milk production ppers to e similr to the yield otined with higher energy close-up progrms (Jnovick nd Drckley, 2010). It lso simplifies the dry cow mngement voiding socil stress due to group chnges (Cook nd Nordlund, 2009). 19

24 The trnsition period lso represents n enormous opportunity to study the cute phse response nd the mechnisms of defense of the immune system. The LPS model hs een used extensively to study the immune system response. Recognition of LPS is fundmentl to the MG immune response. LPS is recognized y the toll-like receptor 4 nd the plsm memrne CD14 receptors tht work in concert with cute proteins synthesized in the liver (LPS-inding protein) in order to ctivte monocytes, mcrophges, nd neutrophils (Rietschel et l., 1998). However our group is prticulrly interested in finding reltionships etween the intensity of lipid moiliztion, plsm NEFA, nd ovine immune cell function through the use of microrrys developed t the University of Illinois. This resource hs een used in different studies of liver (Loor et l., 2005, Loor et l., 2006, Loor et l., 2007) nd mmmry (Moyes et l., 2010, Pintoni et l., 2010). Dt hve een linked with typicl lood metolite, performnce nd liver composition to etter understnd the fundmentl chnges occurring in the niml. 20

25 Tle 1. Annottion of the ovine microrry using Ter-BLAST. Blst serches were nonredundnt. Annottion ws sed on E < e -5 nd/or n extension threshold of 40 (Loor et l., 2007) Dtse serch No. of hits No. of unique hits Humn RefSeq, Mrch ,655 9,332 Mouse RefSeq, Mrch Bovine RefSeq, Mrch Humn UniGene Mouse UniGene ovine UniGene 83 1,460 1,411 ovine TIGR Bovine genome No hit (puttive novels) Totl no. of sequences 13,257 12,845 1 Includes 5 control sequences (soyen MSG, CAB, RBS, nd scrmled control oligos 1 nd 2). 21

26 REFERENCES Anderson, K. L., A. R. Smith, B. K. Gustfsson, S. L. Sphr, nd H. L. Whitmore Dignosis nd tretment of cute mstitis in lrge diry herd. J Am Vet Med Assoc 181: Asi, K., K. Ki, H. Rikiishi, S. Sugwr, Y. Mruym, T. Ymguchi, M. Oht, nd K. Kumgi Vrition in CD4+ T nd CD8+ T lymphocyte supopultions in ovine mmmry glnd secretions during lctting nd non-lctting periods. Vet Immunol Immunopthol 65: Bile, C. A. nd J. M. Fores Control of feed intke nd regultion of energy lnce in ruminnts. Physiol Rev 54: Binton, D. F., J. L. Ullyot, nd M. G. Frquhr The development of neutrophilic polymorphonucler leukocytes in humn one mrrow. J Exp Med 134: Bnnermn, D. D., M. J. Ppe, J. W. Lee, X. Zho, J. C. Hope, nd P. Rinrd Escherichi coli nd Stphylococcus ureus elicit differentil innte immune responses following intrmmmry infection. Clin Dign L Immunol 11: Bumnn, H. nd J. Guldie The cute phse response. Immunol Tody 15(2): Beever, D. E The impct of controlled nutrition during the dry period on diry cow helth, fertility nd performnce. Anim Reprod Sci 96: Bell, A. W Lipid metolism in liver nd selected tissues nd in the whole ody of ruminnt nimls. Progress in Lipid Reserch 18: Bertics, S. J., R. R. Grummer, C. Cdornig-Vlino, nd E. E. Stoddrd Effect of preprtum dry mtter intke on liver triglyceride concentrtion nd erly lcttion. J Diry Sci 75: Bertoni nd Trevisi Diet-helth reltionship in the trnsition period: consequences on energy lnce nd efficiency. Vol. 14. EAAP Book of strcts. Wgeningen Acdemic Pulishers. Bertoni, G., E. Trevisi, nd F. Piccioli-Cppelli Effects of cetyl-slicylte used in postclving of diry cows. Vet Res Commun 28 Suppl 1: Bertoni, G., E. Trevisi, X. Hn, nd M. Bionz Effects of inflmmtory conditions on liver ctivity in puerperium period nd consequences for performnce in diry cows. J Diry Sci 91: Brdley, A Bovine mstitis: n evolving disese. Vet J 164:

27 Burvenich, C., E. Monfrdini, J. Mehrzd, A. V. Cpuco, nd M. J. Ppe Role of neutrophil polymorphonucler leukocytes during ovine coliform mstitis: physiology or pthology? Verh K Acd Geneeskd Belg 66:97-150; discussion Burvenich, C., V. Vn Merris, J. Mehrzd, A. Diez-Frile, nd L. Duchteu Severity of E. coli mstitis is minly determined y cow fctors. Vet Res 34: Cpuco, A. V., M. J. Ppe, nd S. C. Nickerson In vitro study of polymorphonucler leukocyte dmge to mmmry tissues of lctting cows. Am J Vet Res 47: Chew, B. P., R. E. Er, J. F. Fessler, C. J. Cllhn, nd P. V. Mlven Effects of ovriectomy during pregnncy nd of premturely induced prturition on progesterone, estrogens, nd clving trits. J Diry Sci 62: Constle, P. D. nd D. E. Morin Tretment of clinicl mstitis. Using ntimicroil susceptiility profiles for tretment decisions. Vet Clin North Am Food Anim Prct 19: Cook, N. B. nd K. V. Nordlund The influence of the environment on diry cow ehvior, clw helth nd herd lmeness dynmics. Vet J 179: Cummings, C. A. nd D. A. Relmn Using DNA microrrys to study host-microe interctions. Emerg Infect Dis 6: Dnn, H. M., N. B. Litherlnd, J. P. Underwood, M. Bionz, A. D'Angelo, J. W. McFdden, nd J. K. Drckley Diets during fr-off nd close-up dry periods ffect periprturient metolism nd lcttion in multiprous cows. J Diry Sci 89: Detilleux, J. C., Y. T. Grohn, nd R. L. Qus Effects of clinicl ketosis on test dy milk yields in Finnish Ayrshire cttle. J Diry Sci 77: Dinsmore, R. P Biosecurity for mmmry diseses in diry cttle. Vet Clin North Am Food Anim Prct 18: Dougls, G. N., T. R. Overton, H. G. Btemn, 2nd, H. M. Dnn, nd J. K. Drckley Preprtl plne of nutrition, regrdless of dietry energy source, ffects periprturient metolism nd dry mtter intke in Holstein cows. J Diry Sci 89: Drckley, J. K ADSA Foundtion Scholr Awrd. Biology of diry cows during the trnsition period: the finl frontier? J Diry Sci 82: Drckley, J. K., A. D. Beulieu, nd J. P. Elliott Responses of milk ft composition to dietry ft or nonstructurl crohydrtes in Holstein nd Jersey cows. J Diry Sci 84:

28 Drckley, J. K., H. M. Dnn, G. N. Dougls, N. A. J. Guretzky, N. B. Litherlnd, J. P. Underwood, nd J. J. Loor Physiologicl nd pthologicl dpttions in diry cows tht my increse susceptiility to periprturient diseses nd disorders. Itlin Journl of Animl Science 4: Drckley, J. K., S. S. Donkin, nd C. K. Reynolds Mjor dvnces in fundmentl diry cttle nutrition. J Diry Sci 89: Duffield, T. F., K. D. Lissemore, B. W. McBride, nd K. E. Leslie Impct of hyperketonemi in erly lcttion diry cows on helth nd production. J Diry Sci 92: Edgerton, L. A. nd H. D. Hfs Serum luteinizing hormone, prolctin, glucocorticoid, nd progestin in diry cows from clving to gesttion. J Diry Sci 56: Everts, R. E., M. R. Bnd, Z. L. Liu, C. G. Kumr, L. Liu, J. J. Loor, R. Oliveir, nd H. A. Lewin A 7872 cdna microrry nd its use in ovine functionl genomics. Vet Immunol Immunopthol 105: Frmer, C. nd D. Petitclerc Specific window of prolctin inhiition in lte gesttion decreses mmmry prenchyml tissue development in gilts. J Anim Sci 81: Geishuser, T., K. Leslie, D. Kelton, nd T. Duffield Evlution of five cowside tests for use with milk to detect suclinicl ketosis in diry cows. J Diry Sci 81: Gerloff, B. J Dry cow mngement for the prevention of ketosis nd ftty liver in diry cows. Vet Clin North Am Food Anim Prct 16: Gill, R., W. H. Howrd, K. E. Leslie, nd K. Lissemore Economics of mstitis control. J Diry Sci 73: Goff, J. P Mjor dvnces in our understnding of nutritionl influences on ovine helth. J Diry Sci 89: Goff, J. P. nd R. L. Horst Physiologicl chnges t prturition nd their reltionship to metolic disorders. J Diry Sci 80: Goldsy, R. A., R. J. Kindt, nd B. A. Osorne Kuy Immunology. Grohn, Y. T., H. N. Er, C. E. McCulloch, nd H. S. Sloniemi Epidemiology of metolic disorders in diry cttle: ssocition mong host chrcteristics, disese, nd production. J Diry Sci 72: Grummer, R. R Impct of chnges in orgnic nutrient metolism on feeding the trnsition diry cow. J Anim Sci 73: Herdt, T. H Ftty liver in diry cows. Vet Clin North Am Food Anim Prct 4:

29 Ingvrtsen, K. L. nd J. B. Andersen Integrtion of metolism nd intke regultion: review focusing on periprturient nimls. J Diry Sci 83: Jnovick, N. A. nd J. K. Drckley Preprtum dietry mngement of energy intke ffects postprtum intke nd lcttion performnce y primiprous nd multiprous Holstein cows. J Diry Sci 93: Kurniemi, P., M. Brlund, O. Monni, nd A. Kllioniemi New mplified nd highly expressed genes discovered in the ERBB2 mplicon in rest cncer y cdna microrrys. Cncer Res 61: Kedmi, R. nd D. Peer RNAi nnoprticles in the service of personlized medicine. Nnomedicine 4: Kehrli, M. E., Jr. nd J. A. Hrp Immunity in the mmmry glnd. Vet Clin North Am Food Anim Prct 17: , vi. Koj, A., D. Mgielsk-Zero, J. Beret, A. Kurdowsk, H. Rokit, nd J. Guldie The cscde of inflmmtory cytokines regulting synthesis of cute phse proteins. Toki J Exp Clin Med 13: Kremer, W. D., E. N. Noordhuizen-Stssen, F. J. Grommers, Y. H. Schukken, R. Heering, A. Brnd, nd C. Burvenich Severity of experimentl Escherichi coli mstitis in ketonemic nd nonketonemic diry cows. J Diry Sci 76: Kunz, P. L., J. W. Blum, I. C. Hrt, H. Bickel, nd J. Lndis Effects of different energy intkes efore nd fter clving on food-intke, performnce nd lood hormones nd metolites in diry-cows. Animl Production 40: Leslie, A., A. J. Jones, nd P. R. Goddrd The influence of clinicl informtion on the reporting of CT y rdiologists. Br J Rdiol 73: Ling, F. T., F. K. Nelson, nd E. Fikrig DNA microrry ssessment of puttive Borreli urgdorferi lipoprotein genes. Infect Immun 70: Loor, J. J., H. M. Dnn, R. E. Everts, R. Oliveir, C. A. Green, N. A. Guretzky, S. L. Rodriguez- Zs, H. A. Lewin, nd J. K. Drckley Temporl gene expression profiling of liver from periprturient diry cows revels complex dptive mechnisms in heptic function. Physiol Genomics 23: Loor, J. J., H. M. Dnn, N. A. Guretzky, R. E. Everts, R. Oliveir, C. A. Green, N. B. Litherlnd, S. L. Rodriguez-Zs, H. A. Lewin, nd J. K. Drckley Plne of nutrition preprtum lters heptic gene expression nd function in diry cows s ssessed y longitudinl trnscript nd metolic profiling. Physiol Genomics 27:

30 Loor, J. J., R. E. Everts, M. Bionz, H. M. Dnn, D. E. Morin, R. Oliveir, S. L. Rodriguez-Zs, J. K. Drckley, nd H. A. Lewin Nutrition-induced ketosis lters metolic nd signling gene networks in liver of periprturient diry cows. Physiol Genomics 32: Mckiewicz, A Cytokine, cytokine receptors nd glucocorticoid network controlling N- glycosyltion of cute phse proteins in vitro. Foli Histochem Cytoiol 30: Mckiewicz, A., M. K. Gnpthi, D. Schultz, A. Brenec, J. Weinstein, M. F. Kelley, nd I. Kushner Trnsforming growth fctor et 1 regultes production of cute-phse proteins. Proc Ntl Acd Sci U S A 87: Mllrd, B. A., J. C. Dekkers, M. J. Irelnd, K. E. Leslie, S. Shrif, C. L. Vnkmpen, L. Wgter, nd B. N. Wilkie Altertion in immune responsiveness during the periprtum period nd its rmifiction on diry cow nd clf helth. J Diry Sci 81: Mehrzd, J., H. Dosogne, E. Meyer, nd C. Burvenich Locl nd systemic effects of endotoxin mstitis on the chemiluminescence of milk nd lood neutrophils in diry cows. Vet Res 32: Miller, G. Y., P. C. Brtlett, S. E. Lnce, J. Anderson, nd L. E. Heider Costs of clinicl mstitis nd mstitis prevention in diry herds. J Am Vet Med Assoc 202: Morrow, D. A Ft cow syndrome. J Diry Sci 59: Moyes, K. M., J. K. Drckley, D. E. Morin, S. L. Rodriguez-Zs, R. E. Everts, H. A. Lewin, nd J. J. Loor Mmmry gene expression profiles during n intrmmmry chllenge revel potentil mechnisms linking negtive energy lnce with impired immune response. Physiol Genomics 41: Oviedo-Boyso, J., J. J. Vldez-Alrcon, M. Cjero-Jurez, A. Ocho-Zrzos, J. E. Lopez-Mez, A. Brvo-Ptino, nd V. M. Bizl-Aguirre Innte immune response of ovine mmmry glnd to pthogenic cteri responsile for mstitis. J Infect 54: Ppe, M., J. Mehrzd, X. Zho, J. Detilleux, nd C. Burvenich Defense of the ovine mmmry glnd y polymorphonucler neutrophil leukocytes. J Mmmry Glnd Biol Neoplsi 7: Ppe, M. J., R. H. Miller, nd G. Ziv Phrmcologic enhncement or suppression of phgocytosis y ovine neutrophils. Am J Vet Res 52: Ppe, M. J., W. P. Wergin, A. J. Guidry, nd R. E. Person Leukocytes--second line of defense ginst invding mstitis pthogens. J Diry Sci 62: Pgnelli, R., P. M. Mtricrdi, nd F. Aiuti Interctions of food ntigens, ntiodies, nd ntigen-ntiody complexes in helth nd disese. Clin Rev Allergy 2:

31 Pintoni, P., M. Bionz, D. Grugnrd, K. Dniels, R. Everts, S. Rodriguez-Zs, H. Lewin, H. Hurley, M. Akers, nd J. Loor Functionl nd gene network nlyses of trnscriptionl signtures chrcterizing pre-wened ovine mmmry prenchym or ft pd uncovered novel inter-tissue signling networks during development BMC Genomics 11: Pyorl, S Indictors of inflmmtion in the dignosis of mstitis. Vet Res 34: Rinrd, P. nd C. Riollet Innte immunity of the ovine mmmry glnd. Vet Res 37: Rietschel, E. T., J. Schletter, B. Weidemnn, V. El-Smlouti, T. Mttern, U. Zhringer, U. Seydel, H. Brde, H. D. Fld, S. Kusumoto, D. Gupt, R. Dzirski, nd A. J. Ulmer Lipopolyscchride nd peptidoglycn: CD14-dependent cteril inducers of inflmmtion. Micro Drug Resist 4: Rimm, D. L., R. L. Cmp, L. A. Chrette, J. Cost, D. A. Olsen, nd M. Reiss Tissue microrry: new technology for mplifiction of tissue resources. Cncer J 7: Roche, J. R., N. C. Friggens, J. K. Ky, M. W. Fisher, K. J. Stfford, nd D. P. Berry Invited review: Body condition score nd its ssocition with diry cow productivity, helth, nd welfre. J Diry Sci 92: Syers, T. J., L. H. Mson, nd T. A. Wiltrout Trfficking nd ctivtion of murine nturl killer cells: differing roles for IFN-gmm nd IL-2. Cell Immunol 127: Schen, M., D. Shlon, R. W. Dvis, nd P. O. Brown Quntittive monitoring of gene expression ptterns with complementry DNA microrry. Science 270: Shver, R. D Nutritionl risk fctors in the etiology of left displced omsum in diry cows: review. J Diry Sci 80: Smll, G. W., L. M. Ercoli, D. H. Silvermn, S. C. Hung, S. Komo, S. Y. Bookheimer, H. Lvretsky, K. Miller, P. Siddrth, N. L. Rsgon, J. C. Mzziott, S. Sxen, H. M. Wu, M. S. Meg, J. L. Cummings, A. M. Sunders, M. A. Perick-Vnce, A. D. Roses, J. R. Brrio, nd M. E. Phelps Cererl metolic nd cognitive decline in persons t genetic risk for Alzheimer's disese. Proc Ntl Acd Sci U S A 97: Smit, A. F. A. nd P. Green Repetmsker t Smith, K. L., D. A. Todhunter, nd P. S. Schoenerger Environmentl mstitis: cuse, prevlence, prevention. J Diry Sci 68: Smith, T. R., A. R. Hippen, D. C. Beitz, nd J. W. Young Metolic chrcteristics of induced ketosis in norml nd oese diry cows. J Diry Sci 80(8): Sordillo, L. M., K. Shfer-Wever, nd D. DeRos Immunoiology of the mmmry glnd. J Diry Sci 80:

32 Suriysthporn, W., A. J. Demen, E. N. Noordhuizen-Stssen, S. J. Dielemn, M. Nielen, nd Y. H. Schukken Bet-hydroxyutyrte levels in peripherl lood nd ketone odies supplemented in culture medi ffect the in vitro chemotxis of ovine leukocytes. Vet Immunol Immunopthol 68: Tkeuchi, O., K. Hoshino, nd S. Akir Cutting edge: TLR2-deficient nd MyD88- deficient mice re highly susceptile to Stphylococcus ureus infection. J Immunol 165: Vels, L., C. M. Rontved, M. Bjerring, nd K. L. Ingvrtsen Cytokine nd cute phse protein gene expression in repeted liver iopsies of diry cows with lipopolyscchrideinduced mstitis. J Diry Sci 92: Wright, S. D., R. A. Rmos, P. S. Tois, R. J. Ulevitch, nd J. C. Mthison CD14, receptor for complexes of lipopolyscchride (LPS) nd LPS inding protein. Science 249: Zmmit, V. A Mechnisms of regultion of the prtition of ftty cids etween oxidtion nd esterifiction in the liver. Prog Lipid Res 23:

33 CHAPTER 1: Blood Polymorphonucler Leukocyte Function nd Metolic nd Inflmmtion Indices in Periprtl Diry Cows Fed Two Levels of Dietry Energy Preprtum D. E. Grugnrd,* M. Bionz,* E. Trevisi, # K. M. Moyes,* J. L. Slk-Johnson, R. L. Wllce, J. K. Drckley, G. Bertoni, # nd J. J. Loor* *Mmmlin NutriPhysioGenomics, Deprtment of Animl Sciences, College of Veterinry Medicine, nd Division of Nutritionl Sciences, University of Illinois, Urn, IL 61801; nd #Istituto di Zootecnic, Fcolt di Agrri, Universit Cttolic del Scro Cuore, Picenz, Itly 29

34 INTRODUCTION Periprtl cows experience some degree of negtive energy lnce (NEB) nd immunosuppression (Goff, 2006). The ltter is chrcterized y n impirment of neutrophil trfficking, phgocytosis, nd killing cpcity (Kehrli et l., 1989). Lymphocyte numers decrese round prturition s function of reduced prolifertion (Kehrli et l., 1989). In ddition, the cytokine nd hormonl chnges round prturition re closely relted to neutrophil development nd immunity-relted ctivities, lthough these chnges re poorly understood (Burton et l., 2005). It is not entirely cler why most cows experience immunosuppression round the time of clving, ut it is pprent tht metolic chllenges ssocited with the onset of lcttion re fctors cple of ffecting immune function (Goff, 2006). The NEB ssocited with prturition leds to extensive moiliztion of ftty cids stored in dipose tissue, thus, cusing mrked elevtions in lood NEFA nd BHBA concentrtions (Drckley et l., 2001). Preprtl dietry energy intke cn potentilly ffect dipose tissue deposition nd, thus, the mount of NEFA relesed into lood nd ville for metolism in liver (Drckley et l., 2005). Elevted lood NEFA nd BHBA s well s reduced concentrtions of ntigen-inding ntiodies (vn Knegsel et l., 2007) during periprtl NEB ll cn contriute to immunosuppression (Goff, 2006). Ketone ody concentrtions similr to those oserved round prturition impir the phgocytic nd ctericidl cpcity of polymorphonucler leukocytes or neutrophils (PMN) in vitro (Suriysthporn et l., 1999). Similrly, high concentrtions of NEFA negtively ffect ovine PMN in vitro (Scli et l., 2006). High ketone odies or NEFA might reduce udder defense mechnisms ginst mstitis pthogens. 30

35 The efficcy of current NRC (NRC, 2001) feeding prctices for pregnnt non-lctting cows hs een clled into question ecuse incresing mounts of moderte- to high-energy diets (i.e., those more similr to lcttion diets in the content of energy) during the lst 3 wk postprtum hve lrgely filed to overcome periprtl helth prolems, excessive ody condition loss fter clving, or declining fertility (Beever, 2006). Current preprtl feeding prctices cn led to elevted intkes of energy, which cn increse ft deposition in the viscer nd upon prturition led to compromised liver metolism (Beever, 2006, Drckley et l., 2005). In ddition, preprtl feeding prctices cn ffect indices of metolism nd inflmmtion which cn potentilly influence immture immune cells in the peripherl circultion (Lceter et l., 2005). During the first wk of lcttion there is significnt risk for development of new mstitis infections in the udder nd new cses of clinicl mstitis (Hogn et l., 1989). Our generl hypothesis is tht overfeeding dietry energy during the dry period, ccompnied y the metolic chllenges ssocited with the onset of lcttion, would render immune function less responsive erly postprtum. The min ojective of this study ws to evlute the effect of level of dietry energy preprtum on periprtl PMN phgocytosis, chemotxis, nd lood indices of metolism nd inflmmtion during the first wk fter prturition. MATERIALS AND METHODS Animls nd Diets All procedures were conducted under protocols pproved y the University of Illinois Institutionl Animl Cre nd Use Committee (protocol # 06145). Twenty Holstein cows entering their second or greter lcttion were enrolled in the study. The verge composite SCC 31

36 ws ~128,000 ± 108,000 during the previous lcttion. Cows were ssigned rndomly (n = 10/diet) to control diet (controlled energy, high fier), which ws fed for d liitum intke to provide pproximtely 100% of clculted NE L (1.34 Mcl/kg diet DM, Control group), or were fed diet to provide t lest 150% of clculted NE L requirements (Overfed group, 1.62 Mcl/kg DM) during the entire 45-d dry period (NRC, 2001). Ingredient composition of the diets is reported in Tle 2. Smples of feed ingredients nd TMR were otined weekly nd nlyzed for DM content to mintin desired ingredient rtios. Weekly smples of individul ingredients were frozen t 20 C nd were composited monthly. Composite smples were sent to commercil lortory (Diry One, Ithc, NY, USA) for nlysis of DM, CP, NDF, ADF, C, P, Mg, nd K (Tle 2). Diets were fed s TMR once dily (0600 h) using n individul gte feeding system (Americn Cln, Northwood, NH, USA). Cows were housed in ventilted enclosed rn during the dry period (Photoperiod 8 h light:16 h drk) nd hd ccess to snd-edded free stlls until 5 d efore expected clving dte, when they were moved to n individul mternity pen edded with strw. After prturition, cows were moved to tie-stll rn nd were fed common lcttion diet (NE L = 1.69 Mcl/kg DM) s TMR once dily (0600 h). Cows were milked twice dily (0400 nd 1600 h). Diets were mixed in Keenn Klssik 140 mixer wgon (Richrd Keenn & Co., Ltd., Borris, County Crlow, Irelnd) equipped with knives nd serrted pddles; strw in lrge squre les ws chopped directly y the mixer without preprocessing. Body weight ws mesured for ech cow wkly. Milk weights were recorded dily nd smples were otined from consecutive.m. nd p.m. milkings. Milk smples were composited in proportion to milk yield t ech smpling nd preserved (800 Brod Spectrum Mirots II; D&F Control Systems, Inc., Sn Rmon, CA, USA). Composite smples were nlyzed for ft, 32

37 protein, lctose, ure N, nd SCC using midinfrred procedures (AOAC., 1995) t commercil lortory (Diry One, Ithc, NY, USA). Energy Blnce Clcultions nd Estimtes Energy lnce ws clculted individully for ech cow using equtions descried previously (NRC, 2001). Briefly, net energy intke (NE I ; Mcl/d) ws determined y multiplying DMI y the clculted men NE L density of the diet. The NE L vlue of ech individul feed, provided y Diry One ws used to clculte the men NE L content of the diet. The net energy required for mintennce (NE M ) ws clculted s BW Net energy requirement for pregnncy (NE P ; Mcl/d) ws clculted s [( dy of gesttion ) (clf irth weight/45)]/ Milk net energy requirement (NE MILK ; Mcl/kg) ws clculted s ( ft% protein% lctose %) milk yield. The eqution used to clculte preprtum energy lnce (EB PRE ; Mcl/kg) ws EB PRE = NE I (NE M + NE P ). The eqution used to clculte postprtl energy lnce (EB POST ; Mcl/d) ws EB POST = NE I (NE M + NE MILK ). Blood Metolites Blood ws smpled from the coccygel vein or rtery t -14 (± 3 d) nd 7 d reltive to prturition. Smples were collected t 1200 h into evcuted tues (Becton Dickinson Vcutiner Systems, Frnklin Lkes, NJ, USA) contining either ethylenediminetetr cetic cid (EDTA) or lithium heprin for plsm nd clot ctivtor for serum. After lood collection, tues with EDTA nd lithium heprin were plced on ice while tues with clot ctivtor were kept t room temperture until centrifugtion (~30 min). Serum nd plsm were otined y centrifugtion t 33

38 1,900 g for 15 min. Aliquots of serum nd plsm were frozen (-20 C) until further nlysis. Mesurements of NEFA nd BHBA were performed using commercil kits in n uto-nlyzer t the University of Illinois Veterinry Dignostic Lortory (Urn, IL, USA). Other prmeters were mesured in lithium heprin smples t the Istituto di Zootecnic t the Università Cttolic del Scro Cuore in Picenz (Itly). Glucose, lumin, cholesterol, iliruin, cretinine, ure, nd glutmic-oxlcetic trnsminse (GOT) were determined using kits purchsed from Instrumenttion Lortory (IL Test) following the procedures previously descried y Bionz et l. (Bionz et l., 2007) in clinicl uto-nlyzer (ILAB 600, Instrumenttion Lortory, Lexington, MA, USA). Tricylglycerol (TAG) ws mesured using commercil kit (LAssy TM Triglyceride, Wko Chemicls Inc., USA). Hptogloin nd ceruloplsmin were nlyzed using methods descried y Bertoni et l. (Bertoni et l., 2008) dpted to the ILAB 600 conditions. Plsm vitmin A, vitmin E, nd β-crotene were extrcted with hexne nd nlyzed y reverse-phse HPLC using Allsphere ODS-2 3µm in mm column (Grce Dvison Discovery Science, Deerfield, IL, USA), UV detector set t 325 nm (for vitmin A), 290 nm (for vitmin E), or 460 nm (for β-crotene), nd 80:20 methnol:tetrhydrofurne s the moile phse. Totl plsm rective oxygen metolites (ROM) were mesured using the nlyticl method ptented y Dicron Interntionl s.r.l. (Grosseto, Itly). Plsm insulin concentrtions were mesured y doule ntiody rdioimmunossy, using kit for humn insulin following the procedures from the vendor (Dignostic Systems Lortories, Inc., Wester, TX, USA). The detection limit of the ssy ws 1.3 mu/ml; the coefficients of vrition verged 7.5% within ssy nd 9.5 % etween ssys. 34

39 Liver Tissue Composition Liver ws smpled vi puncture iopsy (Dnn et l., 2006) from cows under locl nesthesi t pproximtely 0730 h on d 14 (± 3) nd 7 reltive to prturition. Liver ws frozen immeditely in liquid nitrogen nd stored until further nlysis for contents of totl lipids nd TAG (Dnn et l., 2006). Polymorphonucler Leukocyte Isoltion Smples of lood (20 ml/tue) were collected t ~0700 h from the coccygel vein or rtery in evcuted tues contining EDTA for chemotxis nd sodium heprin for phgocytosis t -14 (± 3 d) nd 7 d reltive to prturition. After lood collection, tues were plced on ice (~30 min) until isoltion (Auchtung et l., 2004, Moyes et l., 2009, Slk et l., 1993). Smples were centrifuged t 600 g for 15 min t 4 C. The uffy cot nd pproximtely one-fourth of red lood cells were removed nd discrded. The remining smple ws poured into 50-mL tue. Twenty milliliters of deionized wter t 4 C were dded to lyse red lood cells followed y ddition of 5 ml 5X PBS t 4 C to restore n iso-osmotic environment. Smples were centrifuged t 200 g for 10 min t 4 C. Three susequent wshings using 1X PBS t 4 C were performed with smples centrifuged t 500 g for 3 min t 4 C. Isolted PMN were resuspended in 1 ml 1X PBS t 4 C nd kept on ice. Cells were counted using Beckmn Coulter Counter fter ddition of Zp-OGloin II Lytic Regent (ct. #13020, Beckmn Coulter) to lyse ny remining red lood cells. A totl of 3 x 10 6 cells/ml of Roswell Prk Memoril Institute (RPMI) 1640 medi with 5% FBS were used for chemotxis nd 2 x 10 6 cells/ml for phgocytosis. 35

40 Chemotxis Chemotxis ws ssessed using method previously descried (Auchtung et l., 2004, Slk et l., 1993) with modifictions (Moyes et l., 2009). The ssy ws conducted in 48- well Micro AP48 Chemotxis Chmer (P48AP30, Neuro Proe, USA). Thirty microliters of 100 ng/ml RPMI 1640 (without FBS) contining humn interleukin-8 (I1645, Sigm, USA), 10 8 M of humn complement C5 (C5788, Sigm, USA) in RPMI 1640 (without FBS), or RPMI 1640 (without FBS, control) were dded to ech of 4 wells per smple (qudruplicte). A PVP-free filter (5 µm pore size, mm; ct# , Neuro Proe, USA) ws mounted in ech chmer. The chmer ws incuted in 5% CO 2 : 95% humidity t 37 C for 10 min for equilirtion. Fifty microliters of cells/ml were dded in ech chmer nd incuted in qudruplicte in 5% CO 2 : 95% humidity t 37 C for 1 h. The memrne ws then removed using forceps. To remove not migrted cells the side of the memrne in contct with the originl cell suspension ws crefully dipped in PBS solution (i.e., the other surfce ws not llow to get in contct with the PBS) nd the cells removed y scrping ginst shrp plstic surfce. The removl of non-migrting cells ws repeted 3 times. After clening, the memrne ws llowed to dry nd then ws fixed with Hem 3 Hemtology Stining Solution II ( , Fisher Scientific, USA). The numer of cells in ech well ws counted using n inverted microscope. Cell counts were corrected sed on viility (see elow) nd ckground (i.e., control or cell migrted with only RPMI). Phgocytosis Phgocytosis ws conducted in qudruplicte in 1 ml RPMI 1640 medi following ddition of 1:10 rtio of Fluoresrite ltex Croxy Yellow-Green 1.75 μm Microspheres 36

41 (2.5%, #17687, Polysciences, Inc., USA). Smples were then incuted for 2 h in 5% CO 2 : 95% humidity t 37 C. A control smple ws incuted for 2 h t 4 C. After incution, cells were rinsed twice with 1X PBS (vi centrifugtion t 1000 g for 5 min t 4 C), fixed with 150 μl 4% prformldehyde (P6148, Sigm, USA), nd preserved t 4 C until reding using flow cytometry. Cell Viility nd Differentil Counts Aliquots (20 μl) of the cell suspension from ech smple for chemotxis nd phgocytosis ssys ws used to determine viility using Burke chmer fter 2 min incution with solution of Trypn lue. The verge percentge of vile PMN ws 71.7 ± 7.8; viility dt were used to correct dt on chemotxis nd phgocytosis. Aliquots (50 μl) of cell suspension from the smples used for the chemotxis ssy were fixed in microscope slide to determine cell differentils; overll, the verge percentge of PMN in the differentil ws 56.0 ± 5.5. Sttisticl Anlysis Ech vrile of interest ws evluted for norml distriution using the Shpiro-Wilk test (SAS Inst. Inc.) nd normlized y logrithmic trnsformtion when necessry prior to sttisticl nlysis. After nlysis log-trnsformed dt were ck-trnsformed to e included in the tles. The MIXED procedure of SAS (SAS Institute, Inc., Cry, NC, USA) ws used for sttisticl nlysis. The fixed effects included diet (control or overfed energy), time (-14 nd 7 d reltive to prturition), nd the interction of diet time. The rndom effect ws cow within 37

42 diet. A repeted mesures nlysis using n AR(1) structure ws used. All mens were compred using the PDIFF sttement of SAS (SAS Institute, Inc., Cry, NC, USA). RESULTS AND DISCUSSION The immune sttus of diry cows during the first wk of lcttion is of importnce during the trnsition period ecuse there is significnt risk for development of new mstitis infections in the udder nd new cses of clinicl mstitis (Hogn et l., 1989). Diry cows during the trnsition period normlly experience mrked decrese in DMI some dys efore prturition, which in turn limits the consumption of dietry energy nd hs negtive impct on the energy lnce equilirium (Bertics et l., 1992). At the sme time, nutrient demnds for initition of milk synthesis re incresed, which ggrvtes the energy lnce sttus (Grummer, 1995). After prturition, s milk production increses the energy needed for milk production lso increses resulting in stte of NEB. Tle 3 reports the DMI, milk yield nd milk composition. We oserved higher (diet P = 0.07) DMI from d -14 to the dy of prturition in overfed compred to control cows. As designed, DMI in the overfed group exceeded energy requirements during the preprtl period (- 4 to -1 wk reltive to prturition) resulting in significntly higher (diet P < 0.01) energy lnce when compred to the control group (Tle 3). However, oth groups were in NEB during wk 1 fter clving with lrger drop (expressed percentge of clculted requirements) oserved in the overfed group (from ~159% preprtum to ~83% postprtum, Tle 3). These dt confirmed previous study from our group (Jnovick et l., 2010) where cows fed to meet or exceed (100% or 150% of NE L ) preprtl energy requirements experienced drstic decrese in energy lnce from 160% of requirements t wk 3 reltive to prturition to less thn 72% during the first wk 38

43 of lcttion. Tht study lso oserved similr DMI nd milk yield during wk 1 to 3 postprtum etween overfed nd control cows. Previous dt from our lortory suggested tht over-consumption of energy during the dry period cn result in poorer trnsitions, including lower post-prtum DMI nd slower strts in milk production (Dnn et l., 2005, 2006). Cows fed diets to meet c. 80% of NE L requirements throughout the dry period were le to dpt etter fter prturition nd were in more positive energy lnce thn cows fed to exceed c. 150% of NE L requirements (Dnn et l., 2006). Milk yield nd DMI during the first wk postprtum lso were greter in preprtl energy-restricted cows. Another study compring diets to meet 80%, 100%, or 150% NE L requirements during the dry period reveled tht cows fed 80% or 100% of NE L requirements during the first 30 d of the dry period hd greter DMI nd improved energy lnce coupled with lower serum NEFA nd BHBA during the first 10 d postprtum compred with overfed cows (Dnn et l., 2005). Our dt, lthough limited to the first wk fter prturition, prtly support previous oservtions suggesting tht cows overfed during the dry period re more likely to e in greter NEB postprtum. To meet the energy requirements during the period of NEB, diry cttle rely on moiliztion of dipose TAG nd muscle tissue (Drckley, 1999). Concentrtions of NEFA in the lood re consequence of hydrolyzed dipose tissue TAG nd cn e tken up y liver nd oxidized to produce ketone odies (e.g. BHBA) (Zmmit, 1984). In our study, despite differences in energy lnce ut consistent with the comprle milk production nd similr DMI (Tle 3), there were no sttisticl differences in NEFA nd BHBA concentrtions etween diets (Tle 4). Furthermore, the oserved concentrtions of NEFA were within nonpthologicl rnge (Bertoni et l., 2008). The lood NEFA pttern round prturition is dynmic nd it is likely, sed on previous dt with similr dietry tretments (Dnn et l., 2006; 39

44 Jnovick et l., 2011), tht tretment differences would hve een more pprent if dditionl times would hve een smpled. The numericlly greter NEFA postprtum in overfed cows grees with the more severe NEB in those cows; nevertheless the solute vlues of NEFA nd BHBA do not suggest ketotic stte. Although NEFA concentrtions preprtum were not different due to diet, lood insulin concentrtion ws mrkedly greter (diet time P < 0.01) preprtum in cows overfed energy ut decresed shrply y wk 1 postprtum in this group (Tle 4). In ddition, lood glucose prend postprtum ws greter (P < 0.04) in the overfed cows (Tle 4). Together, the preprtl dt re consistent with greter potentil for insulin-driven dipose lipid deposition. Our group hs recently shown tht overfeeding dry non-pregnnt cows with similr energy density s in the present study (i.e., NE L 1.61 Mcl/kg DM) for 8 wk incresed the deposition of viscerl ft y c. 70% compred with cows fed controlled-energy/high-fier diet similr to the present study (Nikkhh et l., 2008). Ure concentrtion ws significntly lower (diet time P < 0.01) in overfed cows efore prturition (Tle 4). Considering tht overfed cows te more nd received diet with higher protein content (Tle 3), tht mens more crude protein intke thn control cows, it is possile to explin the different plsm ure concentrtion etween groups with difference in the diet fermentility. Thus, the difference in plsm ure concentrtion is likely not indictive of decresed heptic functionlity, s lso confirmed y the low level of TAG in the liver (Tle 4). The level of cretinine preprtum ws lower (diet time P < 0.01) in overfed compred to control cows, ut the postprtum pttern ws opposite etween the two groups, i.e. incresed in overfed nd decresed in control cows (Tle 4). (Reynolds nd Kristensen, 2008). The very high insulin concentrtions oserved in overfed cows efore clving might hve ffected 40

45 skeletl muscle protein turnover (Bolster et l., 2004) with consequent reduction of protein ctolism. Therefore, the increse in serum cretinine postprtum, n index of muscle mss, indictes enhnced muscle synthesis in overfed cows occurring efore clving (Bxmnn et l., 2008). As for ure nd cretinine, overfed cows hd lower plsm TAG preprtum, ut in control cows there ws decrese in TAG postprtum while in overfed cows there ws numericl increse (Tle 4). Although specultive given tht we hve dt t single time point, the lower lood TAG preprtum in overfed cows might hve een consequence of the high insulin levels cusing chylomicron-tag hydrolysis nd NEFA uptke y the dipose tissue or my hve een consequence of lower rtes of very low density lipoproteins (VLDL) export from liver. Interestingly, serum glucose concentrtion, which is the min source of energy for lymphocytes (Pithon-Curi et l., 2004) ws higher in overfed cows during the whole study. Prmeters of liver function (i.e. serum iliruin, lumin nd cholesterol), cute-phse proteins (i.e., ceruloplsmin, hptogloin), oxidtive stress (i.e. ROM), nd GOT were not different etween groups. Furthermore, ll those prmeters indicted norml nd stisfctory liver ctivity during the periprtl period (Bertoni et l., 2008). Among mesured vitmins, vitmin A ws significntly higher (diet time P = 0.02) preprtum in overfed vs. control cows (Tle 4). The greter concentrtion of vitmin A together with other indices of liver ctivity (see ove) indicted tht overfeeding cows did not result in significnt impirment of liver function preprtum nd t lest through the first wk postprtum. Vitmin E is n importnt ntioxidnt tht inds free rdicls nd prevents lipid peroxidtion, which my hve importnce to the immune response (Bendich, 1993). In our study we oserved tht vitmin E concentrtion ws greter (diet P = 0.09) in the overfed cows oth pre- nd post-clving. Higher vitmin E 41

46 concentrtion in lood hs een ssocited with lower incidence of clinicl mstitis during the first wk of lcttion (Weiss et l., 1997), nd lower concentrtions seem to hmper immune function (Grsso et l., 1990). However, neutrophil phgocytosis cpcity ppers independent of lood vitmin E concentrtion (Hogn et l., 1990), which seems to gree with results from our study. The trnsition period is ccompnied y reduced immunologicl cpcity from 2 to 3 wk efore prturition (Goff, 2006, Mllrd et l., 1998). After prturition, drmtic chnges in ptterns of leukocyte trfficking occur including incresed cell counts nd n incresed numer of immture cells; t the sme time chemotxis nd the oxidtive urst re impired (Burvenich et l., 2003). These chnges led to impirment of numer of immunologicl prmeters round prturition (Wller, 2000). In our study no significnt differences in chemotxis were oserved etween preprtl tretments. However, significnt decrese (time P = 0.02) in chemotxis ws oserved fter prturition regrdless of diet (Tle 5). Phgocytosis cpcity of PMN ws greter (diet time, P < 0.01) preprtum in the control group thn in the overfed group; fter prturition phgocytosis cpcity in the control group remined constnt while in the overfed group phgocytosis incresed to levels similr to the control. In helthy cows PMN function (e.g., phgocytosis, superoxide nion genertion, chemotxis) declines grdully s prturition pproches. Lowest function is often reched soon fter prturition nd continues through 15 d postprtum (Gilert et l., 1993, Kimur et l., 2002), fter which PMN function increses through t lest 6 wk postprtum (Gilert et l., 1993, Moy et l., 2008). The increse in phgocytosis cpcity in the overfed group from -14 to 7 d might e explined y the higher overll glucose concentrtion. Glucose rther thn mino cids, ketone odies, or ftty cids hs een shown to e the preferred metolic fuel for immune 42

47 cells (Pithon-Curi et l., 2004). However, t -14 d the concentrtions of glucose nd insulin were greter in the overfed group ut the phgocytosis cpcity ws lower compred to control cows. Bsed on humn experiments we speculte tht the high insulin concentrtion preprtum coupled with higher glucose in overfed cows were indictive of insulin insensitivity, thus reducing the ility of immune cells to fully utilize glucose in order to execute the immune response (Siepour et l., 2006). CONCLUSION Overll, our dt indicted tht the more positive energy sttus preprtum nd the ensuing surge of insulin hd trnsient ut significnt effect on metolism. We otined evidence tht the greter insulin concentrtion decresed muscle protein turnover nd perhps incresed the circulting TAG uptke y dipose tissue prior to prturition. However, elevted insulin concentrtion lso could hve impired phgocytic cpcity of the PMN prior to clving. The underlying mechnisms for insulin s impirment of PMN function is not evident nd wrrnts further studies. At lest through the first wk postprtum, our lood dt showed some indictions of negtive crry over effects of overfeeding energy to the point of clving, i.e. concentrtions of hptogloin, iliruin, nd ROM were incresed. In tht context, the more severe NEB oserved during the first wk postprtum could potentilly render cows more susceptile to immunosuppression nd infectious diseses s well s metolic disorders (Goff, 2006). The effect of overfeeding dietry energy preprtum might e more noticele in the long-term s the demnds for milk production nd relince on dipose moiliztion continue to increse. 43

48 REFERENCES AOAC Officil Methods of Anlysis. Vol. I. 15th Ed. Assocition of Officil Anlyticl Chemists, Arlington, VA. Auchtung, T. L., J. L. Slk-Johnson, D. E. Morin, C. C. Mllrd, nd G. E. Dhl Effects of photoperiod during the dry period on cellulr immune function of diry cows. J Diry Sci 87: Bxmnn, A. C., M. S. Ahmed, N. C. Mrques, V. B. Menon, A. B. Pereir, G. M. Kirsztjn, nd I. P. Heilerg Influence of muscle mss nd physicl ctivity on serum nd urinry cretinine nd serum cysttin C. Clin J Am Soc Nephrol 3: Beever, D. E The impct of controlled nutrition during the dry period on diry cow helth, fertility nd performnce. Anim Reprod Sci 96: Bendich, A Physiologicl role of ntioxidnts in the immune system. J Diry Sci 76: Bertics, S. J., R. R. Grummer, C. Cdornig-Vlino, nd E. E. Stoddrd Effect of preprtum dry mtter intke on liver triglyceride concentrtion nd erly lcttion. J Diry Sci 75: Bertoni, G., E. Trevisi, X. Hn, nd M. Bionz Effects of inflmmtory conditions on liver ctivity in puerperium period nd consequences for performnce in diry cows. J Diry Sci 91: Bionz, M., E. Trevisi, L. Clmri, F. Lirndi, A. Ferrri, nd G. Bertoni Plsm proxonse, helth, inflmmtory conditions, nd liver function in trnsition diry cows. J Diry Sci 90: Bolster, D. R., L. S. Jefferson, nd S. R. Kimll Regultion of protein synthesis ssocited with skeletl muscle hypertrophy y insulin-, mino cid- nd exercise-induced signlling. Proc Nutr Soc 63: Burton, J. L., S. A. Mdsen, L. C. Chng, P. S. Weer, K. R. Buckhm, R. vn Dorp, M. C. Hickey, nd B. Erley Gene expression signtures in neutrophils exposed to glucocorticoids: new prdigm to help explin "neutrophil dysfunction" in prturient diry cows. Vet Immunol Immunopthol 105: Burvenich, C., V. Vn Merris, J. Mehrzd, A. Diez-Frile, nd L. Duchteu Severity of E. coli mstitis is minly determined y cow fctors. Vet Res 34:

49 Dnn, H. M., N. B. Litherlnd, J. P. Underwood, M. Bionz, A. D'Angelo, J. W. McFdden, nd J. K. Drckley Diets during fr-off nd close-up dry periods ffect periprturient metolism nd lcttion in multiprous cows. J Diry Sci 89: Dnn, H. M., D. E. Morin, G. A. Bollero, M. R. Murphy, nd J. K. Drckley Preprtum intke, postprtum induction of ketosis, nd periprturient disorders ffect the metolic sttus of diry cows. J Diry Sci 88: Drckley, J. K ADSA Foundtion Scholr Awrd. Biology of diry cows during the trnsition period: the finl frontier? J Diry Sci 82: Drckley, J. K., A. D. Beulieu, nd J. P. Elliott Responses of milk ft composition to dietry ft or nonstructurl crohydrtes in Holstein nd Jersey cows. J Diry Sci 84: Drckley, J. K., H. M. Dnn, G. N. Dougls, N. A. J. Guretzky, N. B. Litherlnd, J. P. Underwood, nd J. J. Loor Physiologicl nd pthologicl dpttions in diry cows tht my increse susceptiility to periprturient diseses nd disorders. Itl J Anim Sci 4: Gilert, R. O., Y. T. Grohn, P. M. Miller, nd D. J. Hoffmn Effect of prity on periprturient neutrophil function in diry cows. Vet Immunol Immunopthol 36: Goff, J. P Mjor dvnces in our understnding of nutritionl influences on ovine helth. J Diry Sci 89: Grsso, P. J., R. W. Scholz, R. J. Erskine, nd R. J. Eerhrt Phgocytosis, ctericidl ctivity, nd oxidtive metolism of milk neutrophils from diry cows fed seleniumsupplemented nd selenium-deficient diets. Am J Vet Res 51: Grummer, R. R Impct of chnges in orgnic nutrient metolism on feeding the trnsition diry cow. J Anim Sci 73: Hogn, J. S., K. L. Smith, K. H. Holet, P. S. Schoenerger, D. A. Todhunter, W. D. Hueston, D. E. Pritchrd, G. L. Bowmn, L. E. Heider, B. L. Brockett, nd et l Field survey of clinicl mstitis in low somtic cell count herds. J Diry Sci 72: Hogn, J. S., K. L. Smith, W. P. Weiss, D. A. Todhunter, nd W. L. Schockey Reltionships mong vitmin E, selenium, nd ovine lood neutrophils. J Diry Sci 73: Kehrli, M. E., Jr., B. J. Nonnecke, nd J. A. Roth Altertions in ovine neutrophil function during the periprturient period. Am J Vet Res 50:

50 Kimur, K., J. P. Goff, M. E. Kehrli, Jr., nd T. A. Reinhrdt Decresed neutrophil function s cuse of retined plcent in diry cttle. J Diry Sci 85: Lceter, N., D. Scli, U. Bernucci, B. Ronchi, D. Pirzzi, nd A. Nrdone Lymphocyte functions in overconditioned cows round prturition. J Diry Sci 88: Mllrd, B. A., J. C. Dekkers, M. J. Irelnd, K. E. Leslie, S. Shrif, C. L. Vnkmpen, L. Wgter, nd B. N. Wilkie Altertion in immune responsiveness during the periprtum period nd its rmifiction on diry cow nd clf helth. J Diry Sci 81: Moy, S. L., M. A. Gomez, L. A. Boyle, J. F. Mee, B. O'Brien, nd S. Arkins Effects of milking frequency on phgocytosis nd oxidtive urst ctivity of phgocytes from primiprous nd multiprous diry cows during erly lcttion. J Diry Sci 91: Moyes, K. M., J. K. Drckley, J. L. Slk-Johnson, D. E. Morin, J. C. Hope, nd J. J. Loor Dietry-induced negtive energy lnce hs miniml effects on innte immunity during Streptococcus ueris mstitis chllenge in diry cows during midlcttion. J Diry Sci 92: Nikkhh, A., J. J. Loor, R. J. Wllce, D. E. Grugnrd, J. Vsquez, B. Richrds, nd J. K. Drckley Moderte excesses of dietry energy mrkedly increse viscerl dipose tissue mss in non-lctting diry cows. J Diry Sci 91:LB4. Nutrient Requirements of Diry Cttle th rev. ed. Ntl. Acd. Sci., Wshington, DC. Pithon-Curi, T. C., M. P. De Melo, nd R. Curi Glucose nd glutmine utiliztion y rt lymphocytes, monocytes nd neutrophils in culture: comprtive study. Cell Biochem Funct 22: Reynolds, C. K. nd N. B. Kristensen Nitrogen recycling through the gut nd the nitrogen economy of ruminnts: n synchronous symiosis. J Anim Sci 86:E Siepour, D., J. Sehlin, nd P. A. Oldenorg Insulin inhiits phgocytosis in norml humn neutrophils vi PKClph/et-dependent priming of F-ctin ssemly. Inflmm Res 55: Slk, J. L., J. J. McGlone, nd M. Lyte Effects of in vitro drenocorticotrophic hormone, cortisol nd humn recominnt interleukin-2 on porcine neutrophil migrtion nd luminoldependent chemiluminescence. Vet Immunol Immunopthol 39: Scli, D., N. Lceter, U. Bernucci, K. Demeyere, L. Duchteu, nd C. Burvenich In vitro effects of nonesterified ftty cids on ovine neutrophils oxidtive urst nd viility. J Diry Sci 89:

51 Suriysthporn, W., A. J. Demen, E. N. Noordhuizen-Stssen, S. J. Dielemn, M. Nielen, nd Y. H. Schukken Bet-hydroxyutyrte levels in peripherl lood nd ketone odies supplemented in culture medi ffect the in vitro chemotxis of ovine leukocytes. Vet Immunol Immunopthol 68: vn Knegsel, A. T., G. de Vries Reilingh, S. Meulenerg, H. vn den Brnd, J. Dijkstr, B. Kemp, nd H. K. Prmentier Nturl ntiodies relted to energy lnce in erly lcttion diry cows. J Diry Sci 90: Wller, K. P Mmmry glnd immunology round prturition. Influence of stress, nutrition nd genetics. Adv Exp Med Biol 480: Weiss, W. P., J. S. Hogn, D. A. Todhunter, nd K. L. Smith Effect of vitmin E supplementtion in diets with low concentrtion of selenium on mmmry glnd helth of diry cows. J Diry Sci 80: Zmmit, V. A Mechnisms of regultion of the prtition of ftty cids etween oxidtion nd esterifiction in the liver. Prog Lipid Res 23:

52 Tle 2. Ingredients nd chemicl composition of experimentl diets. Preprtum Overfed Control Lcttion Ingredients, % of DM Whet strw Corn silge Alflf silge Soyen mel Ground shelled corn Alflf hy Mgnesium sulfte Mgnesium oxide Vitmin E Minerl nd vitmin mix Mgnesium chloride Ure Slt Sodium phosphte Vitmin A Vitmin D Whole cottonseed Clcium cronte Corn ground Wet rewer s grin Soyen hulls Sodium icronte Diclcium phosphte Vitmin H Chemicl composition DM, % NE L, Mcl/kg DM CP, % DM AP, % DM ADICP, % DM NDF, % DM ADF, % DM C, % DM P, % DM Mg, % DM K, % DM S %DM N % DM Fe, ppm Zn, ppm Cu, ppm Mn, ppm Minerl nd vitmin mix: zinc = 60 ppm, copper = 15 ppm, mngnese = 60 ppm, selenium 0.3 ppm, iodine = 0.6 ppm, iron = 50 ppm, nd colt = 0.2 ppm. Rumensin:360mg/dy in the lcttion diet. 48

53 Tle 3. Intke of DM nd energy lnce preprtum (-28 d to clving) nd erly postprtum (7 d) nd milk production nd composition postprtum in cows fed control diet (n = 10; 1.34 Mcl/kg DM) or overfed diet (n = 9; 1.62 Mcl/kg DM) during the entire dry period. Preprtl energy P-vlue Overfed Control SEM 1 Diet Time Diet time DMI % BW -28 to -14 DIM to 0 DIM to 0 DIM to 7 DIM kg/d -28 to -14 DIM to 0 DIM to 0 DIM to 7 DIM Milk yield, kg 1 to 7 d Ft, % wk Protein, % wk Lctose, % wk Energy lnce Preprtum, -4 to -1 wk Mcl/d % requirements Postprtum, wk 1 Mcl/d % requirements Lrgest SEM is shown. 2 Dt were log-trnsformed prior to sttistics nd ck-trnsformed for inclusion in tles. 49

54 Tle 4. Preprtum (-14 d) nd erly postprtum (7 d) lood nd liver prmeters in cows fed control diet (1.34 Mcl/kg DM) or overfed energy diet (1.62 Mcl/kg DM) during the entire dry period Preprtl energy Overfed Control P-vlue Diet time Item SEM 1 Diet Time n = Metolism NEFA, meq/l BHBA, mmol/l Glucose, mmol/l Insulin, µiu/ml c d Glucose:insulin c Ure, mmol/l Cretinine, µmol/l Tricylglycerol, mg/dl Liver function Biliruin, µmol/l Alumin, g/l Cholesterol, mmol/l Acute-phse proteins Ceruloplsmin, µmol/l Hptogloin, g/l Oxidtive stress ROM 3, mg H 2 O 2 /100 ml Liver injury GOT 4, U/L Antioxidnts-ntiinflmmtion Vitmin A, µg/100 ml Vitmin E, µg/ml β-crotene, mg/100 ml Liver tissue, % wet weight Lipid Tricylglycerol d Mens within row with different superscripts differ (Diet Time P < 0.05). 1 Lrgest SEM is shown. 2 Dt were log-trnsformed prior to sttistics nd ck-trnsformed for inclusion in tles. 3 Rective oxygen metolites. 4 Glutmic-oxlcetic trnsminse. 50

55 Tle 5. Preprtum (-14 d) nd erly postprtum (7 d) polymorphonucler leukocytes (PMN) chemotxis nd phgocytosis in cows fed control diet (1.34 Mcl/kg DM) or overfed energy diet (1.62 Mcl/kg DM) during the entire dry period Preprtl energy Overfed Control P-vlue Item SEM 1 Diet Time Diet time n = Chemotxis, cells/cm² Complement C Interleukin Phgocytosis, % Mens within row with different superscripts differ (Diet Time P < 0.05). 1 Lrgest SEM is shown. 2 Dt were log-trnsformed prior to sttistics nd ck-trnsformed for inclusion in tles. 51

56 CHAPTER 2: The Effect of n E. coli Lipopolyscchride Intr-Mmmry Chllenge on Cow Performnce, Metolic nd Inflmmtion indices nd Immune Response of Diry Cttle during Erly- Lcttion D. E. Grugnrd*, M. Bionz*, E. Trevisi#, M. Mukesh*, M. Ordonez*, K. M. Moyes*, J. L. Slk-Johnson, R. L. Wllce, J. K. Drckley, G. Bertoni#, nd J. J. Loor*. *Mmmlin NutriPhysioGenomics, Deprtment of Animl Sciences, College of Veterinry Medicine, nd Division of Nutritionl Sciences, University of Illinois, Urn, IL 61801; nd #Istituto di Zootecnic, Fcolt di Agrri, Universit Cttolic del Scro Cuore, Picenz, Itly 52

57 INTRODUCTION The trnsition period is considered the most importnt phse during the lcttion cycle since success trnsition, cn effectively determine profitle lcttion (Drckley, 1999). However, immunosuppression during the this period leds to incresed susceptiility (Mllrd et l., 1998) nd the incidence of helth prolems during this time is significntly elevted reltive to the rest of the lcttion cycle (Drckley, 1999). Is the mjor risk period for mmmry infections (Shver, 1997, Smith et l., 1985). A high proportion of the intr-mmmry infections occur during first mo of lcttion (Oviedo-Boyso et l., 2007) nd in mny cses results from n infection estlished during the dry period or during erly lcttion (Goff nd Horst, 1997). Once pthogen is detected y the receptors in the epithelil cells of the mmmry glnd the cute phse response egins, the immune system is ctivted to eliminte the pthogen. Lipopolyscchride (LPS) is mjor component in the outer memrne of grm-negtive cteri; it cts s n endotoxin eliciting strong cute phse immune response in mmmls (Smll et l., 2000). The LPS is recognized y Toll like receptor-4 (TLR4), which is locted on the intrcellulr memrnes (Rosenerger nd Finly, 2003). Severl studies hve used LPS to evlute the effect of the cute phse response in production vriles s well on immune response (e.g. leukocyte function). There is evidence tht the LPS model genertes locl nd systemic ction involving immune cells nd the liver (Mehrzd et l., 2001). In ddition the effect of LPS chllenge hs een investigted during erly nd lte lcttion. Dt indictes tht the LPS chllenge generte more severe response during erly lcttion; immune cells function seems to e decresed nd impired during erly lcttion compred the lte lcttion LPS chllenge (Lehtolinen et l., 2003). Using nd LPS chllenge during erly lcttion represents common sitution diry cows undergo when mstitis occur. This model llows us to study in 53

58 controlled mnner the effect of the cute phse response on the performnce of diry cows tht re lredy under the immunosuppression stte due to trnsition. OBJECTIVE The min ojective of this study ws to evlute the effect of n erly-lcttion E. coli lipopolyscchride intr-mmmry chllenge on performnce, metolic nd inflmmtion indices nd immune function of diry cttle. MATERIALS AND METHODS Animls nd Diets All procedures were conducted under protocols pproved y the University of Illinois Institutionl Animl Cre nd Use Committee (protocol # 06145). Twenty Holstein cows entering their second or greter lcttion were enrolled in the study. Cows verged composite somtic cell count (SCC) of ~128,000 ± 108,000 during the previous lcttion. Cows were fed diet providing ~159% clculted NE L requirements (Overfed diet, 1.62 Mcl/kg DM) during the entire 45-d dry period. The diet ws fed s TMR once dily (0600 h) using n individul gte feeding system (Americn Cln, Northwood, NH, USA). Cows were housed in ventilted enclosed rn during the dry period nd hd ccess to snd-edded free stlls until 5 d efore expected clving dte, when they were moved to n individul mternity pen edded with strw. After prturition, cows were moved to tie-stll rn nd were fed lcttion diet (NE L = 1.69 Mcl/kg DM) s TMR once dily (0600 h) nd milked twice dily (0400 nd 1600 h). The diet ws mixed in Keenn Klssik 140 mixer wgon (Richrd Keenn & Co., Ltd., Borris, County Crlow, Irelnd) equipped with knives nd serrted pddles. 54

59 Smples of feed ingredients nd TMR were otined weekly nd nlyzed for DM content to mintin desired ingredient rtios. Weekly smples of individul ingredients were frozen t -20 C nd were composited monthly. Composite smples were nlyzed for contents of DM, CP, NDF, ADF, C, P, Mg, nd K using wet chemistry methods (Diry One, Ithc, NY, USA). Body weight ws mesured for ech cow weekly. Milk weights were recorded dily nd smples were otined from consecutive.m. nd p.m. milkings. Milk smples were composited in proportion to milk yield t ech smpling nd preserved (800 Brod Spectrum Mirots II; D&F Control Systems, Inc., Sn Rmon, CA, USA). Composite smples were nlyzed for ft, protein, lctose, ure-n, nd SCC using midinfrred procedures (AOAC Interntionl., 1995) t commercil lortory (Diry One, Ithc, NY, USA). Energy Blnce Clcultions nd Estimtes Energy lnce ws clculted individully for ech cow using equtions descried previously (NRC, 2001). Net energy intke (NE I ; Mcl/d) ws determined y multiplying DMI y the clculted men NE L density of the diet. The NE L vlue of ech individul feed (Diry One, Ithc, NY, USA) ws used to clculte the men NE L content of the diet. The NE M ws clculted s BW Milk net energy requirement (NE MILK ; Mcl/kg) ws clculted s ( ft% protein% lctose %) milk yield. The eqution used to clculte postprtl energy lnce (EB POST ; Mcl/d) ws EB POST = NE I (NE M + NE MILK ). Lipopolyscchride Chllenge At ~7 DIM, cows (10/tretment) were ssigned to receive n intr-mmmry E. coli lipopolyscchride (LPS) chllenge (200 μg, strin 0111:B4, ct. # L2630, Sigm Aldrich, St. 55

60 Louis, MO) or to serve s controls (Non-LPS, these cows did not receive ny control infusion). Prior to LPS chllenge (~2 dys), foremilk smples from ll qurters of ech cow were cultured nd confirmed to e cteriologiclly negtive. LPS ws dissolved in 20 ml of 0.09% sterile physiologicl sline (Hospir, Lke Forest, IL). Immeditely fter milking (0530 h), one rer mmmry qurter ws disinfected with cotton wool pre-soked in 70% ethnol nd the LPS ws infused vi sterile disposle syringe fitted with sterile tet cnnul using the full insertion infusion method. The qurter ws thoroughly mssged. Blood Metolites Blood ws smpled from the coccygel vein or rtery t 2, 7, 10, 14, nd 21 d reltive to prturition. Smples were collected t 1200 h, except during d 7 when smples were collected efore receiving the LPS chllenge. Blood ws collected into evcuted tues (Becton Dickinson Vcutiner Systems, Frnklin Lkes, NJ, USA) contining either EDTA or lithium heprin for plsm nd clot ctivtor for serum. After lood collection, tues with EDTA nd lithium heprin were plced on ice while tues with clot ctivtor were kept t room temperture until centrifugtion (~30 min). Serum nd plsm were otined y centrifugtion t 1,900 g for 15 min. Aliquots of serum nd plsm were frozen (-20 C) until further nlysis. Mesurements of NEFA nd BHBA were performed using commercil kits in n uto-nlyzer t the University of Illinois Veterinry Dignostic Lortory (Urn, IL, USA). Other prmeters were mesured t the Istituto di Zootecnic t the Università Cttolic del Scro Cuore in Picenz (Itly). Glucose, lumin, β-crotene, cholesterol, iliruin, cretinine, ure, nd glutmic-oxlcetic trnsminse (GOT) were determined using kits purchsed from Instrumenttion Lortory (IL Test) following the procedures previously descried y Bionz et l. (Bionz et l., 2007) in 56

61 clinicl uto-nlyzer (ILAB 600, Instrumenttion Lortory, Lexington, MA, USA). Tricylglycerol (TAG) ws mesured using commercil kit (LAssy TM Triglyceride, Wko Chemicls Inc.). Hptogloin nd ceruloplsmin were nlyzed using methods descried y Bertoni et l. (Bertoni et l., 2008) dpted to the ILAB 600 conditions. Plsm vitmin A, vitmin E nd β-crotene were extrcted with hexne nd nlyzed y reverse-phse HPLC using Allsphere ODS-2 3µm in mm column (Grce Dvison Discovery Science, Deerfield, IL, USA); UV detector set t 325 nm (for vitmin A) or 290 nm (for vitmin E) or 460 nm (for β-crotene); nd 80:20 methnol:tetrhydrofurne s the moile phse. Totl plsm rective oxygen metolites (ROM) were mesured using the nlyticl method ptented y Dicron Interntionl s.r.l. (Grosseto, Itly). Plsm insulin concentrtions were mesured y doule ntiody rdioimmunossy, using kit for humn insulin (Dignostic Systems Lortories, Inc., Wester, TX, USA). The detection limit of the ssy ws 1.3 mu/ml; the coefficients of vrition verged 7.5% within ssy nd 9.5 % etween ssy; prllelism etween stndrd curve nd sclr dilution of ovine plsm did not show significnt differences. Liver Tissue Composition Liver ws smpled vi puncture iopsy (Dnn et l., 2006) from cows under locl nesthesi t pproximtely 0730 h on d 14 (± 3), 7, 14 nd 30 reltive to prturition. During d 7 the liver smple ws collected ~2.5 h fter LPS chllenge. Liver ws frozen immeditely in liquid nitrogen nd stored until further nlysis for contents of totl lipids nd TAG (Dnn et l., 2006). 57

62 Neutrophil Isoltion Smples of of lood (20 ml/tue) were collected from the coccygel vein or rtery in vcutiner tues contining EDTA for chemotxis nd sodium heprin for phgocytosis t -14 (± 3), 7, 14, 30, 60 nd 120 d reltive to prturition. Smples were collected t ~0700 h, except during d 7 when smples were collected efore receiving the LPS chllenge. After lood collection, tues were plced on ice (~30 min) until isoltion (Auchtung et l., 2004, Moyes et l., 2009, Slk et l., 1993). Smples were centrifuged t 600 g for 15 min t 4 C. The uffy cot nd pproximtely one-fourth of red lood cells were removed nd discrded. The remining smple ws poured into 50 ml tue. Twenty milliliters of deionized wter t 4 C were dded to lyse red lood cells followed y ddition of 5 ml 5X PBS t 4 C to restore n iso-osmotic environment. Smples were centrifuged t 200 g for 10 min t 4 C. Three susequent wshings using 1X PBS t 4 C were performed with smples centrifuged t 500 g for 3 min t 4 C. Isolted neutrophils were resuspended in 1 ml 1X PBS t 4 C nd kept on ice. Cells were counted using Beckmn Coulter Counter fter ddition of Zp-OGloin II Lytic Regent (ct. #13020, Beckmn Coulter) to lyse ny remining red lood cells. A totl of 3 x 10 6 cells/ml of RPMI 1640 medi with 5% FBS were used for chemotxis nd 2 x 10 6 cells/ml for phgocytosis. Chemotxis Chemotxis ws ssessed using method previously descried (Auchtung et l., 2004, Slk et l., 1993) with modifictions (Moyes et l., 2009). The ssy ws conducted in 48- well Micro AP48 Chemotxis Chmer (P48AP30, Neuro Proe, USA). Thirty microliters of 100 ng/ml RPMI 1640 (without FBS) contining humn interleukin-8 (I1645, Sigm, USA), 10-58

63 8 M of humn complement C5 (C5788, Sigm, USA) in RPMI 1640 (without FBS), or RPMI 1640 (without FBS, control) were dded to ech of 4 wells per smple (qudruplicte). A PVPfree filter (5 µm pore size, mm; ct# , Neuro Proe, USA) ws mounted in ech chmer. The chmer ws incuted in 5% CO 2 : 95% humidity t 37 C for 10 min for equilirtion. Fifty microliters of cells/ml from ech incuted in qudruplicte in 5% CO 2 : 95% humidity t 37 C for 1 h. The memrne ws then removed using forceps. To remove not migrted cells the side of the memrne in contct with the originl cell suspension ws crefully dipped in PBS solution (i.e., the other surfce ws not llow to get in contct with the PBS) nd the cell removed y scrpping ginst shrp plstic surfce. The removl of nonmigrting cells ws repeted 3 times. After clening, the memrne ws let dry nd fixed with Hem 3 Hemtology Stining Solution II ( , Fisher Scientific, USA). The numer of cells in ech well ws counted using n inverted microscope. Cell counts were corrected sed on viility nd ckground (i.e., control or cell migrted with only RPMI). Phgocytosis Phgocytosis ws conducted in qudruplicte in 1 ml RPMI 1640 medi following ddition of 1:10 rtio of Fluoresrite ltex Croxy Yellow-Green 1.75 μm Microspheres (2.5%, #17687, Polysciences, Inc., USA). Smples were then incuted for 2 h in 55% CO 2 : 95% humidity t 37 C. A control smple ws incuted for 2 h t 4 C. After incution, cells were rinsed twice with 1X PBS (vi centrifugtion t 1000 g for 5 min t 4 C), fixed with 150 μl 4% prformldehyde (P6148, Sigm, USA), nd preserved t 4 C until reding using flow cytometry. 59

64 Cell Viility nd Differentil Counts Aliquots (20 μl) of the cell suspension from ech smple for chemotxis nd phgocytosis ssys ws used to determine viility using Burke chmer fter 2 min incution with solution of Trypn lue. The verge percentge of vile neutrophils ws 71.7 ± 7.8; viility dt were used to correct dt on chemotxis nd phgocytosis. Aliquots (50 μl) of cell suspension from the smples used for the chemotxis ssy were fixed in microscope slide to determine cell differentils; overll, the verge percentge of neutrophils in the differentil ws 56.0 ± 5.5. Sttisticl Anlysis Ech vrile of interest ws evluted for norml distriution using the Shpiro-Wilk test (SAS Inst. Inc.) nd normlized y logrithmic trnsformtion when necessry prior to sttisticl nlysis. The MIXED procedure of SAS (SAS Institute, Inc., Cry, NC, USA) ws used for sttisticl nlysis. The fixed effects included tretment (LPS or non-lps), time, nd interction tretment time. The rndom effect ws cow within tretment. A repeted mesures nlysis using n AR(1) structure ws used. All mens were compred using the PDIFF sttement of SAS (SAS Institute, Inc.). RESULTS AND DISCUSSION It hs een well-known tht periprtl cows re immunosuppressed nd it ppers tht the metolic chnges ssocited with the eginning of lcttion re cple of ffecting immune function (Goff, 2006). During n intr-mmmry infection, the host defense mechnism in themmmry glnd immune system is ctivted to eliminte the pthogen or toxin (Oviedo- 60

65 Boyso et l., 2007). This defense mechnisms include ntomicl, cellulr, nd solule fctors tht ct in coordintion nd re crucil to the modultion of mmmry glnd resistnce nd susceptiility to infection (Chneton et l., 2008). The pek in systemic signs, including elevted rectl temperture nd hert rte, loss of ppetite, nd discomfort during n induced LPS chllenge occurs etween 4 nd 8 h postchllenge regrdless of whether the niml is chllenged soon fter prturition (Wldron et l., 2006) or t erly- or mid-lcttion (Wldron et l., 2006); systemic signs strt to decrese nd re lmost t seline levels y 24 h fter the LPS chllenge (Lehtolinen et l., 2003). We performed n intr-mmmry cteril LPS chllenge with higher dose (200 vs. 100 µg) thn used previously (Wldron et l., 2006) in order to etter understnd the systemic response tht nimls might experience due to environmentl or pthogenic microorgnisms in the mmmry glnd. Tle 7 shows the effect of LPS chllenge (i.e. LPS or Non-LPS) t 7 DIM on DMI, milk production, nd energy lnce in cows fed moderte energy diet (1.62 Mcl/kg DM) during the entire dry period. Regrdless of LPS chllenge, DMI incresed (time P < 0.05; % BW nd kg/d) etween the time of chllenge through 41 DIM. However, verge DMI s % BW from 7 to 41 DIM ws greter (diet P < 0.05) for the Non-LPS cows thn LPS cows. Milk yield incresed (time P < 0.05) from 7 to 41 DIM with no differences oserved etween tretments. Milk composition ws not mrkedly ffected y LPS chllenge. Estimted EBAL efore (week 1) s well s during the first 6 weeks postprtum ws not different due to tretment or tretment time. It is noteworthy, however, tht cows chllenged with LPS ppered to e in more severe NEB during the 5 weeks fter chllenge. Over time, oth groups of cows were le to improve EBAL. We present evidence tht LPS chllenge erly postprtum hd long-term crry over effects on DMI nd potentilly energy lnce, i.e., LPS-chllenged cows consumed less DM s 61

66 proportion of their ody weight nd ppered to e in more negtive EBAL for the first 6 weeks postprtum (Tle 7). Figure 1shows liver lipid nd TAG concentrtion in the liver. In oth prmeters greter concentrtions were oserved in the LPS chllenged group t d 7 (tretment time P < 0.08 nd P < 0.05 for lipid nd TAG respectively). At 14 d greter concentrtions of TAG were oserved in the LPS chllenged group (tretment time P < 0.05). Figure 2 shows concentrtions of lood NEFA, BHBA, glucose nd insulin. After LPS chllenge dy NEFA concentrtions were lower (tretment time P < 0.05) in the Non-LPS group (10 nd 14 d) when compred to the LPS group tht mintined the concentrtion similr to the chllenge dy. In contrst to NEFA, lood BHBA nd glucose did not differ due to LPS chllenge. However Insulin concentrtion ws higher (P = 0.06) in the control group t 10 nd 21 DIM when compred to chllenged cows. Other studies showed tht during the very erly stges (2 to 4 h) of n intr-mmmry LPS-chllenge in periprtl cows, estimted glucose production, plsm glucose concentrtion, nd plsm insulin concentrtion were incresed ut plsm NEFA nd BHBA were unchnged despite miniml DMI during this period (Wldron et l., 2006). Except for plsm insulin, vlues returned to pre-chllenge levels y 6-8 h post-lps chllenge, which my explin why we oserved no chnges in glucose concentrtion during the 14 d fter LPS chllenge (Figure 2). Contrry to results from Wldron et l. (2006), we oserved differences in lood NEFA during the dys following the LPS chllenge. Figure 3 shows concentrtions of hptogloin, iliruin, ure, ceruloplsmin, lumin nd GOT. The concentrtion of iliruin decresed (time P < 0.05) consistently through from 2 to 21 DIM. An overll tretment difference ws oserved in plsm ure concentrtion (tretment P = 0.07), however the difference ws oserved efore LPS tretment. Regrdless of 62

67 LPS chllenge, the concentrtion of ure decresed y 10 DIM nd then ws stle through 21 DIM. An interction of tretment time (P < 0.05) ws oserved for lumin concentrtion due to greter concentrtion t 14 DIM in cows chllenged with LPS, response rought out y decrese in lumin etween 7 nd 14 DIM in Non-LPS cows. Ceruloplsmin incresed over time regrdless of the LPS chllenge from 2 to 21 d (P < 0.05). However, the concentrtions of hptogloin nd GOT incresed from 2 through 7 (GOT) nd 10 d (hptogloin) DIM then decresed consistently through 21 DIM regrdless of tretment. In recent study, orl dosing with interferon (IFN)-α to induce pro-inflmmtory response during the periprtl period resulted in similr concentrtions of NEFA ut greter BHBA soon fter prturition (Trevisi et l., 2009). We oserved tht NEFA remined higher y 10 nd 14 DIM in cows chllenged with LPS t 7 DIM nd experienced numericl decrese (diet time P = 0.17) in lood BHBA over time (Figure 1). In nother study where cows were chllenged with LPS during erly nd lte lcttion, lood ure concentrtion ws lower in the chllenged cows in erly lcttion (Lehtolinen et l., 2003). In our study, the group chllenged with LPS hd lower ure concentrtion during the first 21 DIM, thus, confirming previous reltionships. In two studies (Trevisi et l., 2009) where cows were treted with low doses (i.e., 0.5 or 10 IU /kg ody weight) of IFN-α from the lst 2 weeks preprtum through prturition or 5 DIM, it ws reported tht lood hptogloin nd ceruloplsmin incresed more mrkedly ut lumin, cholesterol, nd vitmin A concentrtions (i.e., negtive cute-phse proteins) incresed less rpidly in LPS chllenged vs. Non-LPS cows. However, treted cows mintined numericlly higher ROM in lood through 21 DIM when vlues were greter (c. 15 vs. 12 mg H 2 O 2 /100 ml) compred with Non-LPS. 63

68 Figure 4 shows temporl concentrtions of ROM, cholesterol, vitmin A, vitmin E, β- crotene nd cretinine. An interction tretment time (P < 0.05) ws oserved for vitmin A concentrtion due to greter concentrtion in cows receiving the LPS chllenge t 21 DIM. Concentrtion of ROM incresed (time P < 0.05) through 10 DIM, nd then it remined reltively stle through 21 DIM. This indicted tht preprtl energy overfeeding per se rendered these cows more susceptile to oxidtive stress. Cholesterol concentrtion ws constnt from 2 to 7 DIM; therefter, grdul increse (time P < 0.05) ws oserved through 21 DIM. Concentrtion of vitmin E ws constnt from 2 to 7 DIM, susequently n increse over time (P < 0.05) ws oserved until 10 DIM nd ws followed y nother increse from 14 through 21 DIM. β-crotene concentrtion ws constnt from 2 to 14 DIM, fter which concentrtion incresed (P < 0.05) y 21 DIM. Cretinine concentrtion decresed grdully over time from 2 to 21 DIM (time P < 0.05). These temporl responses nd the ctul concentrtions resemled more those oserved in cows receiving the inflmmtory chllenge with IFN-α, i.e., in our study other fctors esides LPS proly were responsile for the sustined oxidtive stress. As suggested y others (Trevisi et l., 2009), the concomitnt increse in ROM nd hptogloin, regrdless of LPS, might e the consequence of inflmmtory utomplifiction through nucler fctor kpp B ctivtion induced potentilly y ROM relesed during inflmmtion itself. Although the ove inflmmtion indices did not entirely reflect the profiles of positive nd negtive cute-phse proteins, glol comprison with dt from Trevisi et l. (2009) suggest tht cows fed moderte energy were under sustined inflmmtory stte during the first 10 DIM regrdless of LPS. We speculte tht excessive dipose tissue deposition during erly lcttion proly induced mild ut chronic inflmmtory stte s commonly oserved in overweighed/oese humn sujects. Together with DMI nd energy 64

69 lnce dt, the lood NEFA dt from cows chllenged with LPS re suggestive of longerterm metolic dpttions cused y the inflmmtory chllenge soon fter prturition. Chemotxis ws not ffected y LPS chllenge in cows fed moderte energy preprtum (Figures 5A nd 5B). Overll, significnt (tretment time P < 0.05) difference ws oserved for totl neutrophil phgocytosis due to greter responses t 14 DIM in control vs. LPSchllenged cows (Figure 5C). The neutrophils ply n importnt role in the intr-mmmry defense ginst n invding pthogen (Burvenich et l., 1994). High neutrophils counts nd function in lood (Dosogne et l., 1997) s well s high somtic cell count (SCC) in milk (Shuster et l., 1996) nd lower levels of lymphocytes in lood (Mehrzd et l., 2008) correlte positively with the severity of infection. Phgocytic cpility of lood neutrophils nd monocytes typiclly increse etween erly postprtum nd pek lcttion to vlues tht re greter thn preprtum (Moy et l., 2008). In previous study, sl mounts of lood neutrophils nd lymphocytes in lood were not different in cows during erly ( /ml; 6 to 15 DIM) or mid-lcttion ( /ml; 137 to 77 d efore next prturition) (Lehtolinen et l., 2003). However, following n LPS chllenge it ws reported tht lood neutrophil counts incresed to greter extent in erly lcttion compred with lte lcttion (Lehtolinen et l., 2003). They lso reported numericlly-greter PMN phgocytosis nd respirtory urst ctivity (y 8-h post LPS chllenge) nd lower numers of lymphocytes (12 through 24 h post LPS chllenge) in lte-lcttion vs. erly-lcttion cows. Those prmeters returned to pre-lps chllenge levels y 32 (phgocytosis) to 72 h (lood neutophils) post-lps regrdless of stge of lcttion (Lehtolinen et l., 2003). Similr results were oserved in cows tht were chllenged with LPS t DIM (Mehrzd et l., 2001). Unlike cows t 20 to 35 DIM (Mehrzd et l., 65

70 2001), the decrese in totl neutrophil phgocytosis etween 7 nd 14 DIM in our study might hve een ssocited with the hormonl nd metolic environment chrcteristic of this period, e.g., lood NEFA, BHBA, cortisol, pro-inflmmtory cytokines, nd glucose ll of which could ffect immune function in some fshion (Burvenich et l., 2007). In fct, lood NEFA incresed nerly two-fold fter LPS chllenge in erly lcttion (Lehtolinen et l., 2003) nd in our study NEFA remined higher through 14 DIM in LPS-chllenged cows (Figure 2). Judging from work with non-ruminnt lymphocytes, the energy needs of immune cells seem to rely lmost exclusively on glucose vilility (Fox et l., 2005) suggesting tht ny shortflls in glucose vilility etween 7 to 14 DIM might hve compromised neutrophil function. Blood glucose ws not ffected y LPS chllenge ut it remins to e determined if insulin sensitivity is ffected y inflmmtory conditions fter prturition. The contrsting temporl ptterns for the totl percentge of neutrophils phgocytosing (Figure 5A) prticulrly in LPS-chllenged cows ws indictive of sustntil recovery of phgocytic cpcity s cows moved from the periprtl period through pek nd mid-lcttion. This type of response lso is suggestive of more precrious nd stressful sitution for cows undergoing pro-inflmmtory chllenge erly postprtum (Bertoni et l., 2008) in terms of their ility to fight invding pthogens. It lso ws evident tht neutrophils from cows undergoing the LPS chllenge might not hve een le to recover their full iologicl ctivity for severl weeks, underscoring the need for dequte mngement during the recovery phse. The presence of n intr-mmmry E. coli LPS chllenge during erly lcttion represent rpid chnges in metolic indices tht cn ffect the diry cow nd might represent dpttions in longer term tht cn negtively ffect performnce. In our study the chnges cused y the 66

71 LPS chllenge seemed to hppen fst however cusing importnt chnges in immune function during the dys following. 67

72 REFERENCES AOAC Interntionl Officil methods of nlysis of AOAC Interntionl. Pges v. (looselef). AOAC Interntionl, Arlington, V. Auchtung, T. L., J. L. Slk-Johnson, D. E. Morin, C. C. Mllrd, nd G. E. Dhl Effects of photoperiod during the dry period on cellulr immune function of diry cows. J Diry Sci 87: Bertoni, G., E. Trevisi, X. Hn, nd M. Bionz Effects of inflmmtory conditions on liver ctivity in puerperium period nd consequences for performnce in diry cows. J Diry Sci 91: Bionz, M., E. Trevisi, L. Clmri, F. Lirndi, A. Ferrri, nd G. Bertoni Plsm proxonse, helth, inflmmtory conditions, nd liver function in trnsition diry cows. J Diry Sci 90: Burvenich, C., D. D. Bnnermn, J. D. Lippolis, L. Peelmn, B. J. Nonnecke, M. E. Kehrli, nd M. J. Ppe Cumultive physiologicl events influence the inflmmtory response of the ovine udder to Escherichi coli infections during the trnsition period. Journl of Diry Science 90:E39-E54. Burvenich, C., M. J. Ppe, A. W. Hill, A. J. Guidry, R. H. Miller, R. Heynemn, W. D. Kremer, nd A. Brnd Role of the neutrophil leucocyte in the locl nd systemic rections during experimentlly induced E. coli mstitis in cows immeditely fter clving. Vet Q 16: Chneton, L., L. Tirnte, J. Mito, J. Chves, nd L. E. Bussmnn Reltionship etween milk lctoferrin nd etiologicl gent in the mstitic ovine mmmry glnd. J Diry Sci 91: Dnn, H. M., N. B. Litherlnd, J. P. Underwood, M. Bionz, A. D'Angelo, J. W. McFdden, nd J. K. Drckley Diets during fr-off nd close-up dry periods ffect periprturient metolism nd lcttion in multiprous cows. J Diry Sci 89: Dnn, H. M., D. E. Morin, G. A. Bollero, M. R. Murphy, nd J. K. Drckley Preprtum intke, postprtum induction of ketosis, nd periprturient disorders ffect the metolic sttus of diry cows. J Diry Sci 88: Dosogne, H., C. Burvenich, T. vn Werven, E. Roets, E. N. Noordhuizen-Stssen, nd B. Goddeeris Incresed surfce expression of CD11 receptors on polymorphonucler leukocytes is not sufficient to sustin phgocytosis during Escherichi coli mstitis in erly postprtum diry cows. Vet Immunol Immunopthol 60: Drckley, J. K ADSA Foundtion Scholr Awrd. Biology of diry cows during the trnsition period: the finl frontier? J Diry Sci 82:

73 Fox, C. J., P. S. Hmmermn, nd C. B. Thompson Fuel feeds function: energy metolism nd the T-cell response. Nt Rev Immunol 5: Glsser, L. nd R. L. Fiederlein Functionl differentition of norml humn neutrophils. Blood 69: Goff, J. P Mjor dvnces in our understnding of nutritionl influences on ovine helth. J Diry Sci 89: Goff, J. P. nd R. L. Horst Physiologicl chnges t prturition nd their reltionship to metolic disorders. J Diry Sci 80: Goff, J. P., Y. Nito, M. E. Kehrli, Jr., P. Hyes, nd M. Dley Physiologic effects of dministrtion of interleukin 1 et in cows. Am J Vet Res 53: Grommers, F. J., D. Vn de Geer, H. Vn der Vliet, P. A. Henricks, nd F. P. Nijkmp Polymorphonucler leucocyte function: reltionship etween induced migrtion into the ovine mmmry glnd nd in vitro cell ctivity. Vet Immunol Immunopthol 23: Hotmisligil, G. S Inflmmtion nd metolic disorders. Nture 444: Khovidhunkit, W., M. S. Kim, R. A. Memon, J. K. Shigeng, A. H. Moser, K. R. Feingold, nd C. Grunfeld Effects of infection nd inflmmtion on lipid nd lipoprotein metolism: mechnisms nd consequences to the host. J Lipid Res 45: Lehtolinen, T., S. Suominen, T. Kutil, nd S. Pyorl Effect of intr-mmmry Escherichi coli endotoxin in erly- vs. lte-lctting diry cows. J Diry Sci 86: Mllrd, B. A., J. C. Dekkers, M. J. Irelnd, K. E. Leslie, S. Shrif, C. L. Vnkmpen, L. Wgter, nd B. N. Wilkie Altertion in immune responsiveness during the periprtum period nd its rmifiction on diry cow nd clf helth. J Diry Sci 81: Mehrzd, J., H. Dosogne, E. Meyer, nd C. Burvenich Locl nd systemic effects of endotoxin mstitis on the chemiluminescence of milk nd lood neutrophils in diry cows. Vet Res 32: Mehrzd, J., D. Jnssen, L. Duchteu, nd C. Burvenich Increse in Escherichi coli inoculum dose ccelertes CD8+ T-cell trfficking in the primiprous ovine mmmry glnd. J Diry Sci 91: Moy, S. L., M. A. Gomez, L. A. Boyle, J. F. Mee, B. O'Brien, nd S. Arkins Effects of milking frequency on phgocytosis nd oxidtive urst ctivity of phgocytes from primiprous nd multiprous diry cows during erly lcttion. J Diry Sci 91:

74 Moyes, K. M., J. K. Drckley, J. L. Slk-Johnson, D. E. Morin, J. C. Hope, nd J. J. Loor Dietry-induced negtive energy lnce hs miniml effects on innte immunity during Streptococcus ueris mstitis chllenge in diry cows during midlcttion. J Diry Sci 92: Mukesh, M., M. Bionz, D. E. Grugnrd, J. K. Drckley, nd J. J. Loor. Adipose tissue depots of Holstein cows re immune responsive: Inflmmtory gene expression in vitro. Domest Anim Endocrinol 38: Nikkhh, A., J. J. Loor, R. J. Wllce, D. E. Grugnrd, J. Vsquez, B. Richrds, nd J. K. Drckley Moderte excesses of dietry energy mrkedly increse viscerl dipose tissue mss in non-lctting diry cows. Journl of Diry Science 91:LB4. Oviedo-Boyso, J., J. J. Vldez-Alrcon, M. Cjero-Jurez, A. Ocho-Zrzos, J. E. Lopez-Mez, A. Brvo-Ptino, nd V. M. Bizl-Aguirre Innte immune response of ovine mmmry glnd to pthogenic cteri responsile for mstitis. J Infect 54: Rontved, C. M., J. B. Andersen, J. Dernflk, nd K. L. Ingvrtsen Effects of diet energy density nd milking frequency in erly lcttion on tumor necrosis fctor-lph responsiveness in diry cows. Vet Immunol Immunopthol 104: Rosenerger, C. M. nd B. B. Finly Phgocyte sotge: disruption of mcrophge signlling y cteril pthogens. Nt Rev Mol Cell Biol 4: Slk, J. L., J. J. McGlone, nd M. Lyte Effects of in vitro drenocorticotrophic hormone, cortisol nd humn recominnt interleukin-2 on porcine neutrophil migrtion nd luminoldependent chemiluminescence. Vet Immunol Immunopthol 39: Shver, R. D Nutritionl risk fctors in the etiology of left displced omsum in diry cows: review. J Diry Sci 80: Shuster, D. E., E. K. Lee, nd M. E. Kehrli, Jr Bcteril growth, inflmmtory cytokine production, nd neutrophil recruitment during coliform mstitis in cows within ten dys fter clving, compred with cows t midlcttion. Am J Vet Res 57: Smll, G. W., L. M. Ercoli, D. H. Silvermn, S. C. Hung, S. Komo, S. Y. Bookheimer, H. Lvretsky, K. Miller, P. Siddrth, N. L. Rsgon, J. C. Mzziott, S. Sxen, H. M. Wu, M. S. Meg, J. L. Cummings, A. M. Sunders, M. A. Perick-Vnce, A. D. Roses, J. R. Brrio, nd M. E. Phelps Cererl metolic nd cognitive decline in persons t genetic risk for Alzheimer's disese. Proc Ntl Acd Sci U S A 97: Smith, K. L., D. A. Todhunter, nd P. S. Schoenerger Environmentl mstitis: cuse, prevlence, prevention. J Diry Sci 68:

75 Sohn, E. J., M. J. Ppe, E. E. Connor, D. D. Bnnermn, R. H. Fetterer, nd R. R. Peters Bcteril lipopolyscchride stimultes ovine neutrophil production of TNF-lph, IL-1et, IL-12 nd IFN-gmm. Vet Res 38: Trevisi, E., M. Amdori, A. M. Bkudil, nd G. Bertoni Metolic chnges in diry cows induced y orl, low-dose interferon-lph tretment. J Anim Sci 87: Wldron, M. R., A. E. Kulick, A. W. Bell, nd T. R. Overton Acute experimentl mstitis is not cusl towrd the development of energy-relted metolic disorders in erly postprtum diry cows. J Diry Sci 89:

76 Tle 6. Ingredients nd chemicl composition of experimentl diets. Overfed Lcttion Ingredients Corn silge Alflf silge Soyen mel Ground shelled corn Alflf hy Mgnesium sulfte Mgnesium oxide Vitmin E Minerl nd vitmin mix Mgnesium chloride Ure Slt Vitmin A Vitmin D Whole cottonseed Clcium cronte Corn ground Wet rewer s grin Soyen hulls Sodium icronte Diclcium phosphte Vitmin H Chemicl composition DM, % NE L, Mcl/kg DM CP, % DM AP, % DM ADICP, % DM NDF, % DM ADF, % DM C, % DM P, % DM Mg, % DM K, % DM S %DM N % DM Fe, ppm Zn, ppm Cu, ppm Mn, ppm Minerl nd vitmin mix: zinc = 60 ppm, copper = 15 ppm, mngnese = 60 ppm, selenium 0.3 ppm, iodine = 0.6 ppm, iron = 50 ppm, nd colt = 0.2 ppm. Rumensin: 360mg/dy in lcttion diet. 72

77 Tle 7. The effect of intr-mmmry LPS chllenge t 7 d postprtum on DMI, milk production, nd energy lnce in cows fed moderte-energy diet (1.62 Mcl/kg DM) during the entire dry period. Tretment P vlue Item Non-LPS LPS SEM 1 Trt Time Trt time DMI 2 % BW 7 to to kg/d 7 to to Milk 2 kg/d 7 to to Ft, % wk wk 1 to Protein, % wk wk 1 to Lctose, % wk wk 1 to Energy lnce 2 Postprtum wk 1 Mcl/d % requirements wk 1 nd 2 Mcl/d % requirements wk 1 to 6 Mcl/d % requirements Lrgest SEM is shown. 2 Dy or wk reltive to prturition. 73

78 Figure 1. Liver lipid nd liver triglyceride (TAG) in cows fed moderte-energy diet (1.62 Mcl/kg DM) during the entire dry period with (LPS) or without (Non-LPS) n intr-mmmry LPS chllenge t 7 d postprtum. Superscript letters (, ) denote significnt (Tretment time P < 0.05) differences etween tretment t specific time point. Concentrtion Liver lipid (% wet weight) Tretment x time P = 0.08 Tretment P = 0.08 Time P < Non-LPS LPS Liver TAG (% wet weight) Dy reltive to prturition Tretment x time P < 0.05 Tretment P < 0.05 Time P <

79 Figure 2. Blood concentrtions of NEFA, BHBA, glucose nd insulin in cows fed moderteenergy diet (1.62 Mcl/kg DM) during the entire dry period with (LPS) or without (Non-LPS) n intr-mmmry LPS chllenge t 7 d postprtum. Superscript letters (, ) denote significnt (Tretment time P < 0.05) differences etween tretment t specific time point. Concentrtion NEFA (µeq/l) Tretment x time P < 0.05 Time P < Glucose (mmol/l) Non-LPS LPS BHBA (mmol/l) Tretment x time P = Insulin (µiu/ml) Tretment x time P = 0.06 Time P < Dy Reltive to Prturition 75

80 Figure 3. Blood concentrtions of hptogloin, iliruin, ure, ceruloplsmin, lumin nd GOT in cows fed moderte-energy diet (1.62 Mcl/kg DM) during the entire dry period with (LPS) or without (Non-LPS) n intr-mmmry LPS chllenge t 7 d postprtum. Superscript letters (, ) denote significnt (Tretment time P < 0.05) differences etween tretment t specific time point. 1.2 Hptogloin (g/l) Time P < Biliruin (µmol/l) Time P < Non-LPS LPS Concentrtion Ure (mmol/l) Tretment P = Ceruloplsmin (µmol/l) Time P < Alumin (g/l) Tretment x time P < GOT (U/L) Time P < Dy reltive to prturition 76

81 Figure 4. Blood concentrtions of ROM, cholesterol, vitmin A, vitmin E, β-crotene nd cretinine in cows fed moderte-energy diet (1.62 Mcl/kg DM) during the entire dry period with (LPS) or without (Non-LPS) n intr-mmmry LPS chllenge t 7 d postprtum. Superscript letters (, ) denote significnt (Tretment time P < 0.05) differences etween tretment t specific time point ROM (mg H 2 O 2 /100 ml) 8 Cholesterol (mmol/l) Time P < 0.05 Tretment x time nd time P < Non-LPS LPS Concentrtion Vitmin A (µg/100 ml) Tretment x time nd time P < Vitmin E (µg/100 ml) Tretment x time nd time P < β-crotene (mg/100 ml) 130 Cretinine (µmol/l) Time P < Tretment x time nd Time P < Dy reltive to prturition 77

82 Figure 5. Blood neutrophils chemotxis ssessed with C5 (A) nd humn IL-8 (B) nd totl phgocytosis (C) in cows with (LPS) or without (non-lps) n intr-mmmry LPS-chllenge t 7 d postprtum. Asterisks denote significnt (Tretment time P < 0.05) differences etween tretments t specific time point. Chemotxis (cells/cm 2 ) C5 180 non-lps 160 LPS Tretment P = IL A B Phgocytosis (%) * Tretment x Time P < 0.05 Time P < Dy reltive to prturition C 78

83 CHAPTER 3: Immunometolic Indices nd Heptic Gene Expression re Altered y Level of Dietry Energy Preprtum nd Postprtum Inflmmtory Chllenge in Diry Cows D. E. Grugnrd,* M. Bionz,* E. Trevisi, J. M. Khn,* D. Keisler, K. M. Moyes,* J. Slk-Johnson, J. K. Drckley, G. Bertoni, nd J. J. Loor* *Mmmlin NutriPhysioGenomics, Deprtment of Animl Sciences nd Division of Nutritionl Sciences, University of Illinois, Urn, IL Istituto di Zootecnic, Fcolt di Agrri, Universit Cttolic del Scro Cuore, Picenz, Itly Deprtment of Animl Science, University of Missouri, Columi, MO

84 INTRODUCTION Most high-producing diry cows experience significnt numer of production (e.g., ftty liver nd ketosis) nd infectious diseses tht my impir reproductive performnce, consequently resulting in finncil losses to frmers nd reduced welfre (Mullign nd Doherty, 2008). The mjority of these diseses re cused y fctors including level of production inconsistent with nutrient intke, provision of n indequte diet pre- nd post-prtum, n unsuitle environment or vrious comintions of these fctors (Mullign nd Doherty, 2008). Helth prolems experienced y cows during the periprtl period cn hmper production in the long-term nd led to erly culling from the herd (Mullign nd Doherty, 2008). The negtive energy lnce (NEB) experienced y cows soon fter clving hs een ssocited with impired neutrophil trfficking, phgocytosis, nd killing cpcity (Goff, 2006; Sordillo et l., 2009). The NEB ssocited with prturition leds to extensive moiliztion of ftty cids stored in dipose tissue, thus, cusing mrked elevtions in lood non-esterified ftty cids nd hydroxyutyrte (BHBA) concentrtions. Preprtl level of dietry energy cn potentilly ffect dipose tissue deposition nd, thus, the mount of NEFA relesed into lood nd ville for metolism in liver (Drckley et l., 2005). Elevted lood NEFA nd BHBA s well s reduced concentrtions of ntigen-inding ntiodies (vn Knegsel et l., 2007) during periprtl NEB ll cn contriute to immunosuppression. Ketone ody concentrtions similr to those oserved round prturition impir the phgocytic nd ctericidl cpcity of neutrophils or polymorphonucler leukocytes (PMN) in vitro, n effect tht my led to reduced udder defense mechnisms ginst mstitis pthogens (Sordillo nd Aitken, 2009). Current preprtl feeding prctices cn led to elevted intkes of energy nd hve lrgely filed to overcome periprtl helth prolems or declining fertility (Beever, 2006). 80

85 Uncontrolled intke of diets with energy content resemling lcttion diets cn increse ft deposition in the viscer (Nikkhh et l., 2008) nd upon prturition led to compromised liver metolism (Beever, 2006; Drckley et l., 2005). Although different studies hve evluted effects of preprtl mnipultion of ody condition score (BCS), overfeeding or underfeeding energy, nd lipid supplementtion on mesures of metolism nd performnce in periprtl diry cows (Dnn et l., 2006; Dnn et l., 2005; Dougls et l., 2006), the present study sought to expnd on the ville ody of knowledge ccumulted regrding the concept of feed-tofill (Dnn et l., 2006; Jnovick nd Drckley, 2010), which hs clerly shown tht overfeeding moderte-energy diets preprtum results in greter metolic stress nd incidence of disorders postprtum (Jnovick et l., 2011). Our generl hypothesis ws tht overfeeding moderte-energy diet during the dry period would render the cow s immune function less responsive to n intrmmmry inflmmtory chllenge erly postprtum. The min ojectives of this study were to evlute the effect of preprtl energy overfeeding on periprtl PMN function, metolic nd inflmmtion indices in lood, liver tissue lipid composition, nd liver gene expression fter n intrmmmry chllenge with Escherichi coli (E. coli) lipopolyschride (LPS) during the first wk postprtum. MATERIALS AND METHODS Animls nd Diets All procedures were conducted under protocols pproved y the University of Illinois Institutionl Animl Cre nd Use Committee # Twenty Holstein cows entering their second or greter lcttion were used. Cows verged composite SCC of ~128,000 ± 108,000 during the previous lcttion nd were ssigned (n = 10/diet) to control diet (high-whet strw diet); which ws fed d liitum intke to provide t lest 100% of clculted net energy for 81

86 lcttion (NE L ) = 1.34 Mcl/kg or n overfed diet to provide 150% of clculted NE L = 1.62 Mcl/kg during the entire dry period (~45 d) (Tle 8). During the dry period, cows were fed diets s totl mixed rtion (TMR) once dily (0600 h) using n individul Cln (Americn Cln, Northwood, NH) gte feeding system nd were housed in ventilted enclosed rn. Cows hd ccess to snd-edded free stlls until 5 d efore expected clving dte, when they were moved to n individul mternity pen edded with strw. After prturition, cows were moved to tie-stll rn nd were fed common lcttion diet post-prtum (NE L = 1.69 Mcl/kg DM) nd milked twice dily (0400 nd 1600 h). Diets were mixed in Keenn Klssik 140 mixer wgon (Richrd Keenn & Co., Ltd., Borris, County Crlow, Irelnd) equipped with knives nd serrted pddles; strw in lrge squre les ws chopped directly y the mixer without preprocessing. Smples of feed ingredients nd TMR were otined weekly nd nlyzed for DM content to djust the rtion. Weekly smples of individul ingredients were frozen t -20 C nd were composited monthly. Composite smples were nlyzed for contents of DM, crude protein (CP), neutrl detergent fier, cid detergent fier, C, P, Mg, nd K using wet chemistry methods (Diry One, Ithc, NY, USA). Body weight ws mesured for ech cow weekly. Milk weights were recorded dily nd smples were otined from consecutive.m. nd p.m. milkings. Consecutive.m. nd p.m. smples were composited in proportion to milk yield t ech smpling nd preserved (800 Brod Spectrum Mirots II; D&F Control Systems, Inc., Sn Rmon, CA). Composite smples were nlyzed for ft, protein, lctose, ure-n, nd SCC using midinfrred procedures t commercil lortory (Diry One, Ithc, NY, USA). 82

87 Energy Blnce Clcultions nd Estimtes Energy lnce ws clculted individully for ech cow using equtions descried previously (NRC, 2001). Net energy intke (NE I ; Mcl/d) ws determined y multiplying DM intke (Kedmi nd Peer) y the clculted men NE L density of the diet. The NE L vlue of ech individul feed (Diry One, Ithc, NY, USA) ws used to clculte the men NE L content of the diet. Net energy required for mintennce (NE M ) ws clculted s BW(kg) (Mcl/kg). Net energy requirement for pregnncy (NE P ; Mcl/d) ws clculted s [( dy of gesttion ) (clf irth weight/45)]/ Milk net energy requirement (NE LAC ; Mcl/kg) ws clculted s ( ft% protein% lctose%) milk yield. The eqution used to clculte preprtl energy lnce (EB PRE ; Mcl/kg ws EB PRE = NE I (NE M + NE P ). The eqution used to clculte postprtl energy lnce (EB POST ; Mcl/d) ws EB POST = NE I (NE M + NE LAC ). Lipopolyscchride Chllenge At ~7 d in milk (DIM), ll the cows received n intrmmmry E. coli LPS chllenge (200 μg, strin 0111:B4, ct. # L2630, Sigm Aldrich, St. Louis, MO). Prior to LPS chllenge (~2 dys), foremilk smples from ll qurters of ech cow were cultured nd confirmed to e cteriologiclly negtive. LPS ws dissolved in 20 ml of 0.09% sterile physiologicl sline (Hospir, Lke Forest, IL). Immeditely fter milking (0530 h), one rer mmmry qurter ws disinfected with cotton wool pre-soked in 70% ethnol nd the LPS ws infused vi sterile disposle syringe fitted with sterile tet cnnul using the full insertion infusion method. The qurter ws thoroughly mssged. 83

88 Liver Biopsy nd Chemicl Composition Liver ws smpled vi puncture iopsy (Dnn et l., 2006) from cows under locl nesthesi t pproximtely 0800 h on d -14, 7, 14 nd 30 reltive to prturition. Liver ws frozen immeditely in liquid N, nd lter nlyzed for contents of totl lipids, TAG nd RNA extrction. Lipids nd TAG were nlyzed following protocols descried efore (Dnn et l., 2006). Chemotxis Twenty ml of lood for neutrophil isoltion were collected t ~0700 h from the coccygel vein or rtery in vcutiner tues contining EDTA t -14 (± 3 d), 7 (prior to LPS), 14, 30, 60 nd 120 DIM. After lood collection, tues were plced on ice (~30 min) until isoltion (Auchtung et l., 2004, Moyes et l., 2009, Slk et l., 1993). Smples were centrifuged t 600 g for 15 min t 4 C. The uffy cot nd pproximtely one qurter of red lood cells were removed nd discrded. The remining smple ws poured into 50 ml tue prior to chemotxis ssy. Twenty ml deionized wter t 4 C were dded to lyse red lood cells followed y ddition of 5 ml 5X PBS t 4 C to repristinte n iso-osmotic environment. Smples were centrifuged t 200 g for 10 min t 4 C. Three susequent wshings using 1X PBS t 4 C were performed (centrifuge ws set t 500 g for 3 min t 4 C). Isolted neutrophils were resuspended in 1 ml 1X PBS t 4 C nd kept on ice. Cells were counted using Beckmn Coulter Counter fter ddition of Zp-OGloin II Lytic Regent (ct. #13020, Beckmn Coulter) to further lyse ny remining red lood cells. Chemotxis ws ssessed using method previously descried (Auchtung et l., 2004, Slk et l., 1993) with modifictions (Moyes et l., 2009). A totl of cells/ml were resuspended in 1 ml of RPMI 1640 medi (R0883, Sigm) with 5% FBS. The ssy ws 84

89 conducted in 48-well Micro AP48 Chemotxis Chmer (P48AP30, Neuro Proe). Thirty μl of 10 ng/ml RPMI 1640 (without FBS) of humn interleukin-8 (I1645, Sigm), 1 ng/ml RPMI 1640 (without FBS) of humn complement C5 (C5788, Sigm), nd RPMI 1640 (without FBS, control) were dded to ech of 4 wells per smple (qudruplicte). A PVP-free filter (5 µm pore size, mm; ct# , Neuro Proe) ws mounted in ech chmer. The chmer ws incuted in 5% CO 2 t 37 C for 10 min for equilirtion. Fifty μl of cells/ml from ech incuted in qudruplicte in 5% CO 2 t 37 C for 1 h. The memrne ws then removed nd fixed with Hem 3 Hemtology Stining Methnol Fixtive ( , Fisher Scientific). Cell memrnes were stined with Hem 3 Hemtology Stining Solution I ( , Fisher Scientific) nd then cell nuclei were stined with Hem 3 Hemtology Stining Solution II ( , Fisher Scientific). The numer of cells in ech well ws counted using n inverted microscope. Lstly, cell counts were corrected sed on viility nd ckground (RPMI vlues were sutrcted). Phgocytosis Twenty ml of lood for neutrophils isoltion were collected t ~0700 h y coccygel vein or rtery in vcutiner tues contining sodium heprin t -14 (± 3 d), 7 (prior to LPS), 14, 30, 60 nd 120 DIM. After lood collection, tues were plced on ice (~30 min) until isoltion (Moyes et l., 2009). Smples were centrifuged t 600 g for 15 min t 4 C. The uffy cot nd pproximtely one qurter of red lood cells were removed nd discrded. The remining smple ws poured into 50 ml tue prior to phgocytosis ssy. Twenty ml deionized wter t 4 C were dded to lyse red lood cells followed y ddition of 5 ml 5X PBS t 4 C to repristinte n iso-osmotic environment. Smples were centrifuged t 200 g for 10 min t 4 C. Three susequent wshings using 1X PBS t 4 C were performed (centrifuge ws set t 500 g for 3 85

90 min t 4 C). Isolted neutrophils were resuspended in 1 ml 1X PBS t 4 C nd kept on ice. Cells were counted using Beckmn Coulter Counter fter ddition of Zp-OGloin II Lytic Regent (ct. #13020, Beckmn Coulter) to further lyse ny remining red lood cells. Phgocytosis ( cells/ml) ws conducted in qudruplicte in 1 ml RPMI 1640 medi following ddition of 1:10 rtio of Fluoresrite ltex Croxy Yellow-Green 1.75 μm Microspheres (2.5%, #17687, Polysciences, Inc.). Smples were then incuted for 2 h in 5% CO 2 t 37 C. A control smple ws incuted for 2 h t 4 C. After incution, cells were rinsed twice with 1X PBS (vi centrifugtion t 1000 g for 5 min t 4 C), fixed with 150 μl 4% prformldehyde (P6148, Sigm), nd preserved t 4 C until reding using flow cytometry. Cell Viility nd Differentil Twenty μl of the cell suspension from ech smple for chemotxis nd phgocytosis ssys ws used to determine viility using Burke chmer fter 2 min incution with solution of Trypn lue. The verge of vile neutrophils ws ± 7.87; dt for chemotxis nd phgocytosis ws corrected with the oserved viility. Fifty μl of cell suspension from the smples used for the chemotxis ssy were fixed in microscope slide to determine cell differentils; overll the verge of neutrophils in the differentil ws ± Blood Metolites For the immedite time post-lps chllenge, lood ws smpled from the coccygel vein or rtery t 1200 h during d 2, 10, 14, nd 21 reltive to prturition. During d 7 (LPS chllenge dy) the lood smples were collected efore the LPS chllenge (t 530 = 0 h), 2, 6 nd 12 h fter LPS. For dt t 2, 7, 10, 14, nd 21 d reltive to prturition lood ws collected t 1200 h. In oth cses smples were collected into evcuted tues (Becton Dickinson Vcutiner Systems, Frnklin Lkes, NJ, USA) contining either ethylenediminetetr cetic cid (EDTA) 86

91 or lithium heprin for plsm nd clot ctivtor for serum. After lood collection, tues with EDTA nd lithium heprin were plced on ice while tues with clot ctivtor were kept t room temperture until centrifugtion (~30 min). Serum nd plsm were otined y centrifugtion t 1,900 g for 15 min. Aliquots of serum nd plsm were frozen (-20 C) until further nlysis. Mesurements of serum NEFA nd BHBA were performed using commercil kits in n utonlyzer t the University of Illinois Veterinry Dignostic Lortory (Urn, IL, USA). Other prmeters were mesured in lithium heprin smples t the Istituto di Zootecnic t the Università Cttolic del Scro Cuore in Picenz (Itly). Glucose, lumin, cholesterol, iliruin, cretinine, ure, nd glutmic-oxlcetic trnsminse (GOT) were determined using kits purchsed from Instrumenttion Lortory (IL Test) following the procedures previously descried (Bionz et l., 2007) in clinicl uto-nlyzer (ILAB 600, Instrumenttion Lortory, Lexington, MA, USA). Tricylglycerol (TAG) ws mesured using commercil kit (LAssy TM Triglyceride, Wko Chemicls Inc., USA). Hptogloin nd ceruloplsmin were nlyzed using methods previously descried (Bertoni et l., 2008) dpted to the ILAB 600 conditions. Plsm vitmin A, vitmin E, nd β-crotene were extrcted with hexne nd nlyzed y reverse-phse HPLC using Allsphere ODS-2 3µm in mm column (Grce Dvison Discovery Science, Deerfield, IL, USA), UV detector set t 325 nm (for vitmin A), 290 nm (for vitmin E), or 460 nm (for β-crotene), nd 80:20 methnol:tetrhydrofurne s the moile phse. Totl plsm rective oxygen metolites (ROM) were mesured using the nlyticl method ptented y Dicron Interntionl s.r.l. (Grosseto, Itly) (Bertoni et l., 2008). Plsm insulin concentrtions were mesured y doule ntiody rdioimmunossy, using kit for humn insulin following the procedures from the vendor (Dignostic Systems 87

92 Lortories, Inc., Wester, TX, USA). The detection limit of the ssy ws 1.3 mu/ml; the coefficients of vrition verged 7.5% within ssy nd 9.5 % etween ssys. There is no commercilly ville ovine-specific Angptl4 ELISA kit. Therefore, we vlidted humn Angptl4 Elis kit (RyBiotech Inc., Norcross, GA) for use with ovine smples. The specificity of the nti-humn Angptl4 detection ntiody from RyBio kit ws evluted y Western lot nlysis of ovine serum protein nd recominnt ovine Angptl4. Recominnt ovine Angptl4 ws produced y GenScript Corportion (Pisctwy, NJ). The ArcticExpress (DE3) RP E. coli strin ws trnsformed pet-15 vector construct encoding n N-His tg nd the mture ovine Angptl4 protein (NCBI ccession NP_ , region ). Purity nd immunorectivity of the isolted recominnt Angptl4 were verified y previously-vlidted Western lot ssy (Mmedov et l., 2010). Serum or stndrd smples (1 µl) were diluted with 19 µl Lemmli smple uffer (Bio-Rd, Richmond, CA). Recominnt ovine nd humn Angptl4 stndrds were used t 200 pg nd 20 pg concentrtions. Smples were heted t 90 C for 5 min, cooled, vortexed, nd loded onto 4-20% Tris-HCl gel for electrophoresis. Smples were seprted y SDS-PAGE nd dry-trnsferred onto nitrocellulose memrnes (iblot, Invitrogen, Crlsd, CA). Memrnes were locked for 2 h in locking uffer (5% dry milk in Tris-HCl uffer, ph 7.5, with 0.05 % Tween 20). After incution with locking uffer, the memrnes were wshed 3 times for 5 min ech with wshing uffer (phosphte-uffered sline, ph 7.5, contining 0.05% Tween 20), then incuted for overnight with iotinylted nti-humn Angptl4 (RyBiotech Inc) diluted 20,000-fold in locking uffer. After incution, memrnes were rinsed 3 times with wshing uffer nd then incuted for 1 h with horserdish peroxidse-leled streptvidin diluted 50,000-fold in locking uffer. Immunodetection ws performed y chemiluminescence (West-Dur; Thermo Scientific, 88

93 Wlthm, MA). Western lot showed tht the detection ntiody used in the Angptl4 ELISA detected single nd in serum with the expected moleculr weight of hangptl4 (~55 kd). RNA extrction, quntittive PCR (qpcr), nd design nd evlution of primers RNA smples were extrcted from frozen tissue using estlished protocols in our lortories (e.g. Loor et l., 2007). Briefly, liver tissue smple ws weighed (~ g) nd strightwy ws put inside 15 ml centrifuge tue (Corning Inc., Ct. No ) with 1 µl of Liner Acrylmine (Amion Ct. No. 9520) s co-precipitnt, nd 5 ml of ice-cold Trizol regent (Invitrogen Corp.) to proceed with RNA extrction ccording to the mnufcturer. This extrction procedure lso utilizes cid-phenol chloroform (Amion Ct. No. 9720, Austin, TX, USA), which removes residul DNA. Any remining genomic DNA ws removed from RNA with DNse using RNesy Mini Kit columns (Qigen, Germny). RNA concentrtion ws mesured using Nno-Drop ND-1000 spectrophotometer (Nno-Drop Technologies). The purity of RNA (A 260 /A 280 ) for ll smples ws ove The qulity of RNA ws evluted using the Agilent Bionlyzer system (Agilent 2100 Bionlyzer, Agilent Technologies, Snt Clr, CA). The verge RNA integrity numer (RIN) vlue for smples ws 8.0 ± 0.4. For qpcr, cdna ws synthesized using 100 ng RNA, 1 µg dt18 (Operon Biotechnologies, Huntsville, AL, USA), 1 µl 10 mmol/l dntp mix (Invitrogen Corp., CA, USA), 1 µl rndom primer p(dn) 6 (Roche Ct. No , Roche Dignostics GmH, Mnnheim, Germny), nd 10 µl DNse/RNse free wter. The mixture ws incuted t 65 C for 5 min nd kept on ice for 3 min. A totl of 6 µl of mster mix composed of 4.5 µl 5X First-Strnd Buffer, 1 µl 0.1 M dithiothreitol, 0.25 µl (50 U) of SuperScript TM III RT (Invitrogen Corp.CA, USA), nd 0.25 µl of RNse Inhiitor (10 U; Promeg, Mdison, WI, USA) ws dded. The rection ws performed in n Eppendorf Mstercycler Grdient using the 89

94 following temperture progrm: 25 C for 5 min, 50 C for 60 min nd 70 C for 15 min. cdna ws then diluted 1:4 (v:v) with DNse/RNse free wter. Quntittive PCR (qpcr) ws performed using 4 µl diluted cdna (dilution 1:4) comined with 6 µl of mixture composed of 5 µl 1 SYBR Green mster mix (Applied Biosystems, CA, USA), 0.4 µl ech of 10 µm forwrd nd reverse primers, nd 0.2 µl DNse/RNse free wter in MicroAmp Opticl 384-Well Rection Plte (Applied Biosystems, CA, USA). Ech smple ws run in triplicte nd 6 point reltive stndrd curve plus the non-templte control (NTC) were used (User Bulletin #2, Applied Biosystems, CA, USA). The rections were performed in n ABI Prism 7900 HT SDS instrument (Applied Biosystems, CA, USA) using the following conditions: 2 min t 50 C, 10 min t 95 C, 40 cycles of 15 s t 95 C (denturtion) nd 1 min t 60 C (nneling nd extension). The presence of single PCR product ws verified y the dissocition protocol using incrementl tempertures to 95 C for 15 s plus 65 C for 15 s. Dt were clculted with the 7900 HT Sequence Detection Systems Softwre (version 2.2.1, Applied Biosystems, CA, USA). The finl dt were normlized using the geometric men of uiquitously-expressed trnscript (UXT), glycerldehyde-3-phosphte dehydrogense (GAPDH), nd riosoml protein S9 (RPS9). Sequence nd primer informtion of GAPDH nd RPS9 were pulished y Jnovick et l. (2007). Genes selected for trnscript profiling in this study re listed in Tle 10. Primers were designed using Primer Express 2.0 or 3.0 with minimum mplicon size of 80 p (when possile mplicons of p were chosen) nd limited 3 G+C (Applied Biosystems, CA). When possile, primers were designed to fll cross exon exon junctions. Primers were ligned ginst pulicly ville dtses using BLASTN t NCBI nd UCSC s Cow (Bos turus) Genome 90

95 Browser Gtewy. Prior to qpcr, primers were tested in 20 μl PCR rection using the sme protocol descried for qpcr except for the finl dissocition protocol. For primer testing we used universl reference cdna (RNA mixture from 5 different ovine tissues) to ensure identifiction of desired genes. Five μl of the PCR product were run in 2% grose gel stined with ethidium romide (2 μl). The remining 15 μl were clened using QIAquick PCR Purifiction Kit (QIAGEN) nd sequenced t the Core DNA Sequencing Fcility of the Roy J. Crver Biotechnology Center t the University of Illinois, Urn-Chmpign. Only those primers tht did not present primer-dimer, single nd t the expected size in the gel, nd hd the right mplifiction product (verified y sequencing) were used for qpcr (Tles 11-13). The ccurcy of primer pir lso ws evluted y the presence of unique pek during the dissocition step t the end of qpcr. Efficiency of PCR mplifiction for ech gene ws clculted using the stndrd curve method [E = 10 (-1/slope) ] (Tle 14). Reltive mrna undnce mong mesured genes ws clculted s previously reported (Bionz nd Loor 2008), using the inverse of PCR efficiency rised to ΔCt (gene undnce = 1/EΔCt, where ΔCt = Ct smple - geometric men Ct of 3 internl control genes; Tle 14). Overll mrna undnce for ech gene mong ll smples mesured ws clculted using the medin ΔCt. Use of this technique for estimting reltive mrna undnce mong genes ws necessry ecuse reltive mrna quntifiction ws performed using stndrd curve (mde from mixture of RNA) which precluded direct comprison mong genes. Together, use of Ct vlues corrected for the efficiency of mplifiction plus internl control genes s seline overcome this limittion. Sttisticl Anlysis 91

96 A totl of 10 cows from ech preprtl dietry group (from 20/group tht strted the study) with the most complete dt set including production, lood indices, nd PMN function were used for the present report. Eleven of the originl 40 cows were removed from sttisticl nlysis due to lmeness nd/or cteriologiclly-positive qurters fter prturition. The MIXED procedure of SAS (SAS Institute, Inc., Cry, NC, USA) ws used for sttisticl nlysis. The fixed effects included preprtl diet (control or overfed), time (7, 14, 30, 60, nd/or 120 d reltive to prturition; or 0, 2, 6, nd 12 h post-lps), nd interction diet time. The rndom effect ws cow within diet. A repeted mesures nlysis using n AR(1) structure ws used. Ech vrile of interest ws evluted for norml distriution using the Shpiro-Wilk test (SAS Inst. Inc.) nd normlized y logrithmic trnsformtion when necessry prior to sttisticl nlysis. Normlized gene expression dt were log-2 trnsformed prior to sttisticl nlysis. All mens were compred using the PDIFF sttement of SAS (SAS Institute, Inc., Cry, NC, USA). RESULTS Performnce Averge DMI (% or kg/d) over the lst 4 wk preprtum did not differ (P > 0.10) due to diet (Tle 9). We oserved greter DMI s % of BW during the first 41 d postprtum in the control group (Tle 9). The overll consumption of DM ws similr for oth groups when expressed in kg/dy, thus, differences in DMI s % of BW were due to lower BW in control cows when compred to overfed (Tle 9). Both groups incresed DMI (kg/d or s % of BW) grdully over time (Time P < 0.05; Figure 6). Milk yield lso incresed (Time P < 0.05; Figure 6) for oth groups from 7 to 41 DIM with no differences mong diets; there were no differences 92

97 mong diets in milk ft percentge resulting in similr ft-corrected milk (FCM) yield nd pprent energetic efficiency. Averge BW nd BCS during the lst 4 wk preprtum were greter (P < 0.05) in overfed thn control cows (Tle 9). In terms of postprtl BCS there ws no overll difference (P > 0.10) due to diet. However, we oserved n expected decrese (P < 0.05) in BCS etween wk 1 to 6 fter prturition. As expected, energy lnce (Mcl/d or % of requirements) during the lst 4 wk preprtum ws greter (P < 0.05) in cows overfed the moderte-energy diet. We lso oserved cler differences in energy lnce sttus during the first wk fter prturition due to diet, i.e. cows in the control group were in more positive energy lnce sttus (i.e. efore LPS; P < 0.05). There ws n overll increse (Time P < 0.05) in energy lnce etween wk 2 to 6 regrdless of diet. Clf irth weight ws not ffected (P > 0.10) y preprtl dietry energy level. Acute Response to Lipopolyscchride Figure 15 shows the temporl chnges in rectl temperture nd lood concentrtion of NEFA, BHBA, TAG nd iliruin efore (0 h) nd during the first 12 h post-lps chllenge. There were no temperture differences mong dietry preprtum tretments; however, there ws n ovious nd expected temperture increse (Time P < 0.05) tht peked t 6 h post LPS chllenge. Intrmmmry LPS chllenge regrdless of diet incresed (P < 0.05) circulting NEFA nd TAG y 2 h post-chllenge fter which concentrtions returned to pre-chllenge vlues. Opposite to NEFA nd TAG, there ws grdul decrese (Time P < 0.05) in lood BHBA concentrtion regrdless of preprtl diet. Biliruin incresed (Time P < 0.05) 2 h fter the infusion of LPS regrdless of preprtl diet nd ws mintined until the lst smpling time t 12 h post chllenge. 93

98 Lipid nd TAG Accumultion in Liver Figure 7 shows the concentrtions of liver lipid nd TAG efore nd fter prturition. After prturition, i.e. in the iopsy hrvested ~2-3 h post-lps chllenge on d 7, we oserved greter (Diet Time P < 0.05) concentrtion of lipid nd TAG in the overfed group nd this difference persisted until 14 d for totl lipid nd until 30 d for TAG concentrtion. Metolic nd Oxidtive Stress Indices in Blood Figure 8 shows lood serum concentrtion of the metolic indictors NEFA, BHBA, glucose, insulin, cretinine, ROM, TAG, nd ure during the erly postprtl period. After LPS chllenge, concentrtion of NEFA decresed (P < 0.05) in the control group ut it incresed slightly or remined unchnged in overfed cows resulting in Diet Time response (P < 0.05) during d 10 to 21 post-prtum. Concentrtion of BHBA decresed (Time P < 0.05) fter LPS chllenge through d 14 regrdless of diet, nd then incresed to pre-chllenge concentrtions y d 21. Glucose concentrtion remined constnt from 2 to 7 DIM fter which significnt (Time P < 0.05) increse regrdless of diet ws oserved y 10 through 21 DIM (Figure 8). In contrst, overfed cows hd greter (Diet Time P = 0.09) lood insulin due to differences t d 2 postprtum. Temporl lood insulin concentrtion seemed to reflect chnges in lood glucose with mrked increse (Time P < 0.05) from 7 to 10 DIM. Overll concentrtion of ROM ws greter for cows in the overfed group (Diet P < 0.06) thn the control due primrily to greter vlues t 10 nd 21 DIM. Although control cows hd greter (Diet Time P < 0.05) cretinine concentrtion t 2 d postprtum, regrdless of diet cretinine decresed over time (P < 0.05) in oth groups to ndir t 10 DIM. 94

99 The concentrtion of TAG decresed (Time P < 0.05) grdully from 2 to 21 d fter prturition in oth groups. In ddition, cows in the control group tended (P = 0.11) to hve overll higher concentrtions of ure. Its concentrtion decresed (Time P < 0.05) in oth groups from 7 to 14 d followed y return to sl concentrtions y d 21. Liver Function nd Inflmmtion Indices in Blood Figure 10 shows concentrtions of cholesterol, lumin, ceruloplsmin, hptogloin, glutmic oxlocetic trnsminse (Gottipti et l.), nd iliruin. Cholesterol concentrtion ws greter (Diet Time P < 0.05) in the overfed group t 10 nd 14 DIM when compred to controls ut the trend for oth groups ws for grdul increse through 21 DIM. Alumin concentrtion ws greter t 2 nd 21 DIM in the control group resulting in significnt interction (P < 0.05). Regrdless of dry period diet, ceruloplsmin concentrtion incresed grdully (Time P < 0.05) from 2 to 10 DIM; susequently, the concentrtion ws constnt until 21 DIM. Furthermore, the overfed group hd greter (Diet P = 0.08) ceruloplsmin concentrtions during the 21 d period. Concentrtion of hptogloin incresed (Time P < 0.05) shrply etween 7 nd 10 DIM then decresed y d 14 to 21 to vlues elow those oserved t 2 nd 7 DIM. Concentrtion of ngiopoietin-like 4 (ANGPTL4), which hs een recently identified s n cute-phse protein in rodents (Lu et l., 2010), ws greter overll (diet P = 0.06) in cows fed controlled-energy. Concentrtions of oth GOT nd iliruin decresed (Time P < 0.05) grdully y 10 to 21 DIM regrdless of diet. Regrdless of dry period diet, vitmin A, E nd β-crotene concentrtion incresed (Time P < 0.05) over time (Figure 11) nd overll vitmin E concentrtion ws greter (P = 0.09) in the overfed group due minly to differences t 10, 14 nd 21 DIM. 95

100 Growth Hormone (GH) nd Insulin-like Growth Fctor-1 (IGF-1) Figure 13 shows the concentrtions of GH nd IGF-1 long with mrna expression of two genes ssocited with GH signling in liver. There ws n interction effect (Diet Time P = 0.07) for GH due primrily to greter lood concentrtions t 0, 2, nd 30 d reltive to clving. In contrst, we oserved significnt interction (Diet Time P < 0.05) for the concentrtion of IGF-1 due to the response preprtum in overfed cows which hd greter concentrtions through clving. The temporl chnges (Time P < 0.05) in concentrtion of GH nd IGF-1 were typicl of this physiologicl stge, i.e. grdul increse in GH from lte preprtum through erly lcttion coupled with grdul decrese in IGF-1. Neutrophil Chemotxis nd Phgocytosis Neutrophil chemotxis evluted with humn C5 or IL-8 did not differ etween tretments (Figure 12). However, there ws n overll time effect (P < 0.05) for chemotxis ssessed with IL-8. This temporl response ws chrcterized y grdul increse in chemotxis from 7 through 120 DIM. Totl neutrophil phgocytosis cpcity (Figure 12) ws lower (Diet Time P < 0.06) t 14 nd 120 DIM in the overfed group versus the control. Despite reound in phgocytosis cpcity etween 14 to 60 DIM in overfed cows (Diet Time P < 0.05), phgocytosis gin decresed mrkedly etween 60 nd 120 DIM. Overll, the temporl response oserved in overfed cows compred with the stedy increse in phgocytosis cpcity in control cows led to lower overll phgocytosis due to preprtl energy overfeeding. Heptic Gene Expression Tle 15 nd Figure 14 nd 15 show reltive mrna expression of genes relted with metolism, stress nd inflmmtion, nd control of gene trnscription. We oserved upregultion over time (P < 0.01; Tle 15) in DGAT1 nd FAAH oth of which re involved in 96

101 metolism of lipids. Among the stress nd inflmmtion-relted genes, PERK expression incresed over time (P < 0.01; Tle 15) with no differences mong preprtl diet. Another gene ssocited with cellulr stress is XBP1 nd ws downregulted over time (P < 0.01; Tle 15) with no differences mong preprtl diet. Among trnscription regultors evluted, NFKB1, CREB3L3 nd PPARD ehved in similr fshion with decrese in mrna expression fter d 7 (Time P < 0.01) with no differences oserved due to diet. Figure 14 shows reltive mrna expression of key genes relted with ftty cid oxidtion, ketogenesis, nd growth hormone (GH) signling in liver. Our dt reveled significnt upregultion (Diet Time P < 0.05) etween 7 nd 14 DIM in the expression of ACOX1, HMGCS2, nd PPARA due to feeding control with corresponding decrese in CPT1A, HMGCS2, STAT5B, nd SOCS2 in overfed cows. In ddition, the increse in PPARA y 14 DIM with controls resulted in greter expression (Diet Time P < 0.05) thn overfed cows; wheres, the decrese in STAT5B nd SOCS2 y 14 DIM in overfed cows resulted in lower expression (Diet Time P < 0.05) thn controls. The only genes ffected y preprtl diet were SOD2 nd MYD88, with overfed cows hving greter expression (P < 0.05; Figure 15). Postprtum, the expression pttern of SOD2, TNF, MYD88, TLR4, nd NFKB1 ws similr (P > 0.10) etween tretments; downregultion ws oserved fter LPS infusion from d 7 to d 14 fter which the expression level ws mintined reltively stle through d 30 (P < 0.01). In the cse of NR3C1 expression ws downregulted (Diet Time P < 0.10) etween 7 nd 14 d in oth overfed nd control cows ut expression decresed further y 30 DIM in overfed cows; wheres, cows fed control hd stle expression through 30 DIM. 97

102 DISCUSSION Short-term Adpttions to LPS The 12-h lood metolite nlysis provided some evidence of cute effects of LPS on dipose lipolysis, ketogenesis, nd liver function (i.e., iliruin clernce). Similr results for NEFA nd BHBA were oserved in cows infused i.v. with LPS during mid-lcttion (Wldron et l., 2003); however, in non-lctting heifers there ws n ctul increse in NEFA nd glycerol coupled with decresed BHBA (Steiger et l., 1999). In non-ruminnts nd ruminnts (Steiger et l., 1999) cteril LPS elicits inflmmtion (e.g. incresed lood TNF) leding to elevted circulting levels of NEFA resulting from enhnced dipose lipolysis (Zu et l., 2009). These dt (Steiger et l., 1999; Wldron et l., 2003) seem to suggest tht ketogenesis (t lest in the short-term) my hve een impired y LPS-induced inflmmtion, n effect tht hs een clerly demonstrted in non-ruminnts (Khovidhunkit et l., 2004). Systemic hypertriglyceridemi lso is consequence of n inflmmtory response cused y LPS in nonlctting nimls (Feingold et l., 1992). This effect hs een ttriuted to impirment in clernce of triglyceride-rich lipoproteins from the circultion, enhnced heptic VLDL production, nd/or reduced ctivity of tissue (e.g. dipose, hert, muscle) lipoprotein lipse (Kufmnn et l., 1976). In our study, mmmry utiliztion of TAG ftty cids nd NEFA my hve plyed role in the rpid return to sl concentrtions of oth metolites. At lest in non-ruminnts, the increse in iliruin concentrtion (n index of liver function; Bionz et l., 2007) s consequence of inflmmtion ppers to e cused y the proinflmmtory cytokine IL-1β, which inhiits the nucler ctivtor NFKB tht regultes the mrna expression of key heptic enzymes involved in iliruin clernce (Assent et l., 2004). The results from our study re somewht comprle with those reported y Bionz et l. (2007) 98

103 where plsm iliruin ws highest (10.1 vs. 6.2 ± 0.6 μmol/l) in cows clssified retrospectively s hving low liver function. The discussion elow will focus on longer-term dpttions to LPS chllenge s it reltes to preprtl consumption of dietry energy. Performnce Effects due to Preprtl Energy nd LPS Our performnce dt (Tle 9, Figure 6) re similr to those reported in previous experiments (Dougls et l., 2006; Jnovick nd Drckley, 2010) in cows fed to meet or exceed preprtl energy requirements (c. 100 to 150% of NRC requirements). Although dt reported y Jnovick nd Drckley (2010) showed tht overfed cows tended (P = 0.10) to produce more milk over the first 8 wk of lcttion, the tendency ws negted when yields were djusted for previous mture equivlent yield. Together, our performnce dt during the first ~6 wk postprtum showed tht there ws no enefit of preprtl overconsumption of energy nd demonstrted evidence of more severe NEB erly postprtum. Liver Lipid Composition The oserved concentrtion of totl lipid in liver we oserved post-lps chllenge in overfed cows ws similr to cows clssified s hving ftty liver (~8% to ~11% totl lipid) during the first ~3 wk postprtum (Ametj et l., 2005). Control LPS-chllenged cows hd similr totl liver lipid s helthy/controls in the study of Ametj et l. (2005). There re severl mechnisms tht cn e proposed to explin the differences to LPS etween diets. First, overfeeding during the dry period leds to overconditioning (i.e. excessive dipose tissue deposition) nd greter BCS prior to clving nd more mrked reduction in ppetite round clving (Hyirli et l., 2002). As consequence, preprtl overconditioned high-producing diry cows often go into more severe NEB thn cows tht hve norml ppetite (Hyirli et l., 2002; Rukkwmsuk et l., 1999), which is in line with wht we oserved (Tle 9). Under such 99

104 conditions, it is likely tht the cpcity of the liver to mintin the lnce etween export of the TAG in VLDL with heptic TAG synthesis is indequte, thus, resulting in TAG ccumultion (Drckley et l., 2005). Our oservtions tht overfeeding energy preprtum led to greter ccumultion of TAG in liver soon fter LPS chllenge (nd in the longer-term) is in line with lood metolic indictors of liver lipid metolism, i.e. overfed cows hd greter lood NEFA etween 10 nd 21 DIM, numericlly-greter TAG etween 10 nd 14 DIM, ut hd similr decrese in lood BHBA etween 7 nd 14 DIM (Figure 10). Together, those dt re suggestive of greter impirment of liver lipid metolism due to LPS. Although previous studies hve exmined lood mrkers of inflmmtion in response to endotoxin or E. coli mstitis erly postprtum (Hoeen et l., 2000), we re unwre of studies with erly postprtl cows tht hve exmined ny link etween liver lipid composition in response to LPS or endotoxin chllenge nd preprtl feeding mngement. However, there is evidence of incresed plsm NEFA concentrtions following LPS infusion (Steiger et l., 1999; Wldron et l., 2003) or TNF (Kushiiki et l., 2003), nd of liver TAG ccumultion following s.c. TNF in mid-lcttion cows (Brdford et l., 2009). Our dt reveled tht preprtl energy overfeeding coupled with n inflmmtory chllenge erly postprtum elicited sustined lipolytic response, hence, fvoring higher levels of NEFA in the circultion nd resulting in persistent TAG ccumultion during erly lcttion. Mrkers of Inflmmtion nd Oxidtive Stress in Blood Overll, the lood dt on inflmmtory nd oxidtive stress mrkers were suggestive of chronic ltertion in liver ftty cid oxidtion nd ketogenesis in the preprtl energy-overfed cows when exposed to n inflmmtory chllenge. The drmtic increse in heptic mrna expression of TNF t 7 vs. -14 DIM with oth diets (Figure 15) likely reflected n cute response 100

105 to LPS, nd grees with previous dt showing greter liver TNF mrna expression in response to s.c. injection of ovine TNF (Brdford et l., 2009). Although there were no differences in lood NEFA, s.c. injection of TNF in mid-lcttion cows for 7 d resulted in greter liver TAG concentrtion (Brdford et l., 2009). The TNF response in the overfed cows vs. controls might hve remined elevted during the susequent d post-lps chllenge, thus, fvoring dipose tissue lipolysis (Kushiiki et l., 2003) nd prtly explining the higher NEFA concentrtions t 10 nd 14 d (Figure 10). Inflmmtory responses to LPS in our cows seemed to differ from those oserved y Trevisi et l. (2009) fter sustined IFNα chllenge round prturition where, despite difference in BHBA concentrtions, the increse in NEFA in treted nd control cows ws similr. Together the dt seem to indicte tht the nture of the inflmmtory chllenge (e.g., LPS, IFNα, or pthogen chllenge) in periprtl cows could dictte the type of physiologicl response y the niml leding to impired ketogenesis in cows mnged to overconsume energy preprtum, i.e. diets promoting overconditioning. Excess ccumultion of ROM cn cuse cell nd tissue injury nd led to oxidtive stress (Sordillo nd Aitken, 2009). Cows with higher preprtl BCS, n indirect mesure of ody ftness, nd elevted levels of NEFA t clving re in more precrious oxidtive sttus [e.g., lower superoxide dismutse (SOD) ctivity in lood] rendering them more sensitive to oxidtive stress (Bernucci et l., 2005). A more recent study lso showed tht cows in more severe NEB during erly lcttion hd higher lood ROM levels nd indequte vilility of iologicl ntioxidnts, thus, were under incresed oxidtive stress (Pederner et l., 2009). Our dt ppered consistent with the ove studies in the sense tht overfed cows were in more positive energy lnce preprtum, more NEB efore the LPS chllenge (Tle 9), ut ROM 101

106 concentrtions etween tretments did not differ until fter LPS chllenge when overfed cows lso hd greter increse in concentrtion of NEFA. Liver Function nd Inflmmtion Becuse of the direct link etween liver synthesis of cholesterol, hptogloin, nd ceruloplsmin nd their correltion with inflmmtion, the concentrtions of these molecules in lood hve een routinely used s indictors of liver function (Bertoni et l., 2008; Bionz et l., 2007; Trevisi et l., 2009). Trevisi et l (2009) reported lower lood cholesterol in periprtl cows receiving IFN-α thn controls. After LPS chllenge, the greter temporl concentrtion of cholesterol nd ceruloplsmin in overfed cows ws suggestive of more vigorous nd sustined cute-phse response to LPS potentilly s counter regultory mechnism to rech norml set-point. This ide is supported y other dt (e.g, ROM, NEFA, liver TAG, ceruloplsmin) showing tht overfeeding energy preprtum clerly plced igger toll on metolism which ws excerted once the niml ws fced with n inflmmtory chllenge. It is noteworthy tht the temporl profile of ROM resemled tht of ceruloplsmin (Figure 11), response not oserved in the inflmmtory chllenge study of Trevisi et l. (2009), which lso could e tken s indiction of some degree of impirment of liver function. In the ove context, it is well-estlished tht inflmmtion protects nimls ginst infection nd tissue injury, ut lso cn hve deleterious consequences if it ecomes deregulted (Sordillo et l., 2009). Our lood concentrtions of cholesterol, ceruloplsmin, nd lumin regrdless of diet were within non-pthologicl rnge (Bertoni et l., 2008). It ws noteworthy, however, tht lumin concentrtion ws greter in control vs. overfed cows prior to LPS nd lso t 21 DIM which would e suggestive of higher liver function in those cows (Ametj et l., 2005; Bertoni et l., 2008; Cvestny et l., 2005). Overll, the sustined incresed in lood 102

107 cholesterol over time is typicl response (Bionz et l., 2007; Cvestny et l., 2005) nd hs een previously relted with n improvement in energy lnce sttus (Bertoni et l., 2008). Despite the pprent signs of norml liver function regrdless of diet, the ctul concentrtion of hptogloin t 2 to 10 d in oth groups ws similr to those oserved in postprtl cows with signs of inflmmtion nd low liver function t 7 DIM (Trevisi et l., 2009). However, our dt on liver TAG, cholesterol, nd hptogloin do not support correltion etween these prmeters s reported y Ametj et l. (2005) using erly postprtl cows clssified s helthy or with ftty liver, i.e. negtive correltions etween totl liver lipid nd cholesterol ut positive correltions etween totl liver lipid nd hptogloin. Our dt on liver TAG nd NEFA post-lps with overfed cows do support positive reltionship etween oth prmeters s oserved y Ametj et l. (2005). Clerly, dditionl mechnisms t the level of liver or whole-niml likely ply role in the overll dpttions of the postprtl cow to n inflmmtory chllenge. Some of those re discussed in the gene expression section. A previous study found lower temporl vitmin A concentrtion in response to inflmmtory chllenge with IFN-α round clving (Trevisi et l., 2009), which supported dt demonstrting negtive reltionship etween inflmmtion nd liver function round clving (Bertoni et l., 2008). The concentrtions we oserved (ssessed s retinol) regrdless of diet during the first 14 DIM were elow the rnge ssocited with optiml liver function in erly postprtl cows (Sordillo nd Aitken, 2009) ut they were within the rnge reported in the study of Trevisi et l. (2009). The overll increse in vitmin A concentrtion etween 7 nd 14 DIM suggested tht LPS chllenge did not impir the heptic response despite the fct tht overfed cows (s noted ove) were under more pprent stressful stte. 103

108 Sordillo nd Aitken (2009) provided detiled review of the role of vitmin E during inflmmtion nd immune response. There is evidence tht oth vitmin E nd Selenium sttus of cows could ffect the extent of oxidtive stress experienced y the cow, hence, hve n impct on the functionl cpility of periprtl lood neutrophils (Hogn et l., 1992; Sordillo et l., 2009). Neutrophil phgocytosis, cteril killing, nd oxidtive metolism re enhnced when cows hve dequte levels of oth vitmin E nd Selenium (Sordillo nd Aitken, 2009). Concentrtions of vitmin E oserved in this study etween 2 nd 7 DIM were ove those reported y Bionz et l. (2007) in cows grouped ccording to seline proxonse ctivity. In fct, overll concentrtions oserved in our study y 21 DIM were nerly douled those reported y Bionz et l. (2007), suggesting tht cows in our study likely were in dequte vitmin E sttus. The temporl increse in vitmin E in overfed cows likely ws relted with the increse in ROM s counter regultory mechnism to stop or control their production (Skln, 1983) induced y LPS. Furthermore, the temporl pttern of vitmin E post-lps in overfed cows lso resemled tht of cholesterol nd seemed to e in greement with dt showing positive reltionship etween vitmin E nd serum cholesterol concentrtion in chickens (Skln, 1983). The rte of incorportion of cette into heptic cholesterol is >2-fold in chicken thn cow (Emmnuel nd Rolee, 1984), nd oth supplementl vitmin E nd A incresed ovine heptic cholesterol nd TAG synthesis (Pullen et l., 1990). Lower rtes of cholesterogenesis prtly explin the reduced cpcity for VLDL export in ruminnt liver (Pullen et l., 1990) ut more importntly our dt on liver TAG coupled with lood cholesterol nd vitmin E fter LPS in overfed cows ppered to highlight mechnistic link, i.e. potentil dpttion y liver to hndle excess NEFA nd ccumultion of TAG. Thus, despite the greter metolic lod fcing 104

109 overfed cows there were counter regultory mechnisms in plce to respond to inflmmtion. Whether such responses would occur in ll cows my depend on the overll helth sttus of the niml, i.e. whether cows re free from metritis, mstitis, or other diseses typicl of the postprtl period. Neutrophil Function Commonly, neutrophil function (e.g., phgocytosis, superoxide nion genertion, chemotxis) declines grdully s prturition pproches nd lowest levels re often reched soon fter prturition through 15 d postprtum (Gilert et l., 1993; Kimur et l., 2002; Moy et l., 2008). Susequently, neutrophil function increses through t lest 6 wk postprtum (Sordillo et l., 2009). Contrry to previous studies mentioned ove we found tht feeding controlledenergy preprtum resulted in stle response in totl neutrophil phgocytosis postprtum through the first 30 DIM. Furthermore, in control cows the stle response remined through the LPS chllenge; wheres, cler decrese in phgocytic cpcity ws oserved in the overfed cows (Figure 13). Despite the greter concentrtion of vitmin E post-lps (Figure 12), the lower phgocytosis in overfed cows could hve een relted with greter lood NEFA nd ROM (not BHBA), in prticulr, ecuse of the well-estlished negtive effects of such molecules on immune cell response during the periprtl period (Sordillo et l., 2009). These findings offer further support for controlling energy intke during the dry period, i.e. it could e more dvntgeous to the cow in terms of mintining more ctive immune environment during the first 30 DIM when they likely re most susceptile to mstitis pthogens. Metolic Heptic Gene Expression In non-ruminnts, the nucler receptor PPARA is considered the mster regultor of heptic lipid metolism during fsting or undernutrition (Kersten et l., 1999). Activtion of 105

110 PPARA promotes uptke, utiliztion, nd ctolism of ftty cids vi coordinted upregultion of CPT1A, ACOX1, nd HMGCS2 mong other genes (Loor et l., 2005; Selerg et l., 2005). There lso is evidence tht PPARA ctivtion cn regulte inflmmtion prtly y neutrlizing nd promoting the degrdtion of Leukotriene B 4 in oth PMN nd mcrophges (Pyper et l., 2010). Initil dt with trnsition diry cows provided indirect evidence tht circulting NEFA might e lignds for PPARA potentilly resulting in the upregultion nd downstrem ctivtion of genes with key functions in ftty cid oxidtion, ketogenesis, nd gluconeogenesis (Loor et l., 2005; Selerg et l., 2005). Although recent study with diry clves reported no chnge in expression of PPARA when injected with the PPAR lignd clofirte (Litherlnd et l., 2010), this lignd incresed or tended to increse expression of the PPARA trget genes ACADVL, ACOX1, nd CPT1A. Furthermore, work with ovine kidney cells recently showed tht LCFA, e.g. plmitte, sterte, nd eicospentnote, lso might ctivte PPARA-regulted pthwys (Bionz et l., 2011). Therefore, the reltive chnge in expression of PPAR trget genes could e tken s indictors of tretment effects on the ctivity of this nucler receptor. The lck of increse in expression of PPARA etween 7 nd 14 DIM (i.e. post-lps; Figure 12) in overfed vs. control cows might e explined in prt y derngement in the mechnisms tht needed to e in plce for the PPARA response to tke plce, e.g. downregultion of RXR or other co-ctivtors (Pyper et l., 2010). Furthermore, it could e possile tht GH signling in liver is mechnisticlly linked with PPARA s in rodents (Ljungerg et l., 2007). The fct tht oth STAT5B nd SOCS2 decresed mrkedly fter LPS only in overfed cows ws suggestive of n excerted uncoupling of the GH/IGF-1 xis (Lucy, 2008) in response to inflmmtion. The NEFA nd ROM response etween 7 nd 14 DIM in overfed cows clerly suggested n ltered cellulr stte induced y LPS in energy-overfed cows. 106

111 The decrese in HMGCS2 fter LPS in overfed cows lso suggested tht inflmmtion in ovine could led to impired ketogenesis s in rodents (Khovidhunkit et l., 2004; Prieur et l., 2009). Despite the inflmmtory chllenge, control cows clerly responded in wy tht might hve een expected under norml physiologicl conditions. The response in PPARA, ACOX1, nd HMGCS2 fter the LPS-chllenge in control cows followed the sme trend (Figure 14) nd ppered to e inversely ssocited (t lest through d 14) with concentrtions of liver TAG nd lood NEFA nd BHBA (Figure 8 nd 10). Such response my hve een ssocited with greter rtes of LCFA oxidtion s shown in diry clves dosed with clofirte (Litherlnd et l., 2010). In diry cows grouped retrospectively sed on concentrtions of BHBA, correltions etween BHBA nd HMGCS2 were significnt regrdless of grouping t 4 wk in lcttion (vn Dorlnd et l., 2009). Interestingly, in tht study the group with higher BHBA concentrtion lso hd positive correltion etween HMGCS2 nd CPT1A s our dt with control cows seemed to confirm. Tken together, these dt seem to suggest tht energy-overfeeding despite incresing vilility of NEFA to liver resulted in other ltertions (e.g. inflmmtion) tht dmpened PPAR signling. In fct, the decrese in CPT1A fter LPS in overfed cows is similr to previous dt from mid-lcttion cows injected with TNF (Brdford et l., 2009), providing evidence tht inflmmtion hs the potentil to inhiit ftty cid oxidtion nd indirectly result in TAG ccumultion prtly through increses in CD36 nd AGPAT mrna expression (Khovidhunkit et l., 2004). There ws no evidence of long-term effect of diet or inflmmtion on MTTP expression (Tle 15) ut the decrese in expression of DGAT1 etween 7 nd 14 DIM regrdless of diet could e tken s n indiction of reduction in VLDL synthesis. The ERound DGAT1 enzyme, rther thn the cytosolic DGAT2, is thought to e ssocited with 107

112 chnneling of ftty cids towrds the ER lumen for TAG synthesis nd ssemly of mture VLDL (Lvoie nd Guthier, 2006). The decrese in lood TAG etween 7 nd 14 DIM (Figure 10), prticulrly in control cows, seems to support this ide. Our contrsting responses etween groups in regrds to BHBA, NEFA, CPT1A, HMGCS2, PPARA, nd liver TAG point t dditionl mechnisms in control cows tht prevented heptic ccumultion of TAG despite the pprent decrese in ketogenesis, i.e. lower BHBA from 7 through 14 DIM. In tht regrd, it should e noted tht n importnt effect of PPARA on systemic lipid metolism is the positive effect it hs on peripherl VLDL utiliztion, process driven vi upregultion of heptic APOA5 nd its ctivtion of lipoprotein lipse in peripherl tissues (Krj et l., 2010). Although we did not mesure APOA5, positive effect of PPARA upregultion on this poprotein my hve een ssocited with the grdul decrese in NEFA nd TAG tht ws oserved in control cows. Whether the LPL effect ws t the level of mmmry or dipose is difficult to determine; however, the fct tht insulin incresed fter LPS regrdless of diet my hve een ssocited with response in dipose nd/or skeletl muscle. Heptic Expression of Inflmmtion- nd Stress-relted Genes Although there ws no control dt to compre with, the striking upregultion of TNF, NFKB1, nd SOD2when compring dt t -14 vs. 7 DIM, i.e h post-lps chllenge, proly reflected the cute response to inflmmtion. The sme could e envisged for ANGPTL4 which hs recently een shown to respond s positive cute-phse protein in mice chllenged with LPS (Lu et l., 2010). TNF is well-known pro-inflmmtory cytokine nd its heptic expression ws upregulted t ~3 h post infusion of LPS in mid-lcttion diry cows (Vels et l., 2009). Previous work with periprtl cows showed tht ctivity of SOD in erythrocytes ws higher preprtum thn postprtum ut lood indices of oxidtive stress [e.g. 108

113 ROM, thiorituric cid-rective sustnces (TBARS)] were greter postprtum thn preprtum, i.e. oxidtive stress is chrcteristic of the periprtl period (Bernucci et l., 2005). The reltively similr pttern of expression we oserved for NFKB1 nd MYD88 (long with TNF, TLR4, nd IRAK1) ws suggestive of the existence of TLR4-medited signling likely due to direct inding of LPS, i.e. this molecule seems to e heptic TLR4 gonists s it ws proposed in ovine mcrophges (Iegh-Awemu et l., 2008). IRAK1 is key meditor of TLR/MYD88 signling during cteril infections, which leds to roust inflmmtory trget gene expression in prt vi NFKB1 ctivtion (Trktsoglou et l., 2011). We previously found n upregultion of IRAK1 in mmmry tissue nd lood neutrophils from diry cows receiving n intrmmmry chllenge with S. ueris (Moyes et l., 2010; Moyes et l., 2010). The greter TLR4 expression t 30 DIM in cows fed control is puzzling ut my underscore the importnce of the TLR/MYD88 pthwy in liver for estlishing successful immune response. Furthermore, it lso could imply tht cows in more negtive energy lnce due to overfeeding energy tht undergo n immune chllenge would hve compromised TLR response. In regrd to immune response, the mrked downregultion of STAT5B nd its regultor SOCS2 (Nicholson nd Hilton, 1998) etween 7 nd 14 DIM in overfed cows supports the ide of compromised response to inflmmtion, e.g. SOCS2 negtively regultes cytokine signling (Udy et l., 1997). More importntly, downregultion of STAT5B my hve hd direct negtive effects on metolism y dmpening GH signling (Lin et l., 1996) nd IGF-1 production. The fct tht STAT5B lso is ctivted y cytokines nd growth fctors in diry cows leding to CD4 + T cell differentition during inflmmtion (He et l., 2011) suggests tht overfeeding 109

114 energy preprtum hs wide-rnging negtive effects on liver metolism nd immune response fter clving. 110

115 REFERENCES Ametj, B. N., B. J. Brdford, G. Boe, R. A. Nfikov, Y. Lu, J. W. Young, nd D. C. Beitz Strong reltionships etween meditors of the cute phse response nd ftty liver in diry cows. Cn J Anim Sci 85: Assent, E., S. Gerl-Chloin, D. Lrrey, J. Sric, J. M. Fre, P. Murel, M. J. Vilrem, nd J. M. Pscussi Interleukin 1et inhiits CAR-induced expression of heptic genes involved in drug nd iliruin clernce. Heptology 40: Auchtung, T. L., J. L. Slk-Johnson, D. E. Morin, C. C. Mllrd, nd G. E. Dhl Effects of photoperiod during the dry period on cellulr immune function of diry cows. J Diry Sci 87: Beever, D. E The impct of controlled nutrition during the dry period on diry cow helth, fertility nd performnce. Anim Reprod Sci 96: Bernucci, U., B. Ronchi, N. Lceter, nd A. Nrdone Influence of ody condition score on reltionships etween metolic sttus nd oxidtive stress in periprturient diry cows. Journl of Diry Science 88: Bertoni, G., E. Trevisi, X. Hn, nd M. Bionz Effects of inflmmtory conditions on liver ctivity in puerperium period nd consequences for performnce in diry cows. J. Diry Sci. 91: Bionz, M., B. J. Thering, nd J. J. Loor Fine metolic regultion in ruminnts vi nutrient-gene interctions: sturted long-chin ftty cids increse expression of genes involved in lipid metolism nd immune response prtly through PPAR-lph ctivtion. Br J Nutr Bionz, M., E. Trevisi, L. Clmri, F. Lirndi, A. Ferrri, nd G. Bertoni Plsm proxonse, helth, inflmmtory conditions, nd liver function in trnsition diry cows. J. Diry Sci. 90: Brdford, B. J., L. K. Mmedov, J. E. Minton, J. S. Drouillrd, nd B. J. Johnson Dily injection of tumor necrosis fctor-{lph} increses heptic triglycerides nd lters trnscript undnce of metolic genes in lctting diry cttle. J Nutr 139: Cvestny, D., J. E. Blnc, M. Kulcsr, G. Urirte, P. Chiliroste, A. Meikle, H. Feel, A. Ferrris, nd E. Krll Studies of the trnsition cow under psture-sed milk production system: metolic profiles. J Vet Med A Physiol Pthol Clin Med 52:

116 Dnn, H. M., N. B. Litherlnd, J. P. Underwood, M. Bionz, A. D'Angelo, J. W. McFdden, nd J. K. Drckley Diets during fr-off nd close-up dry periods ffect periprturient metolism nd lcttion in multiprous cows. J. Diry Sci. 89: Dnn, H. M., D. E. Morin, G. A. Bollero, M. R. Murphy, nd J. K. Drckley Preprtum intke, postprtum induction of ketosis, nd periprturient disorders ffect the metolic sttus of diry cows. J. Diry Sci. 88: Dougls, G. N., T. R. Overton, H. G. Btemn, 2nd, H. M. Dnn, nd J. K. Drckley Preprtl plne of nutrition, regrdless of dietry energy source, ffects periprturient metolism nd dry mtter intke in Holstein cows. J Diry Sci 89: Drckley, J. K., H. M. Dnn, G. N. Dougls, N. A. J. Guretzky, N. B. Litherlnd, J. P. Underwood, nd J. J. Loor Physiologicl nd pthologicl dpttions in diry cows tht my increse susceptiility to periprturient diseses nd disorders. Itl. J. Anim. Sci. 4: Emmnuel, B. nd A. R. Rolee Cholesterogenesis from propionte: fcts nd specultions. Int J Biochem 16: Feingold, K. R., I. Stprns, R. A. Memon, A. H. Moser, J. K. Shigeng, W. Doerrler, C. A. Dinrello, nd C. Grunfeld Endotoxin rpidly induces chnges in lipid metolism tht produce hypertriglyceridemi: low doses stimulte heptic triglyceride production while high doses inhiit clernce. J Lipid Res 33: Gilert, R. O., Y. T. Grohn, P. M. Miller, nd D. J. Hoffmn Effect of prity on periprturient neutrophil function in diry cows. Vet Immunol Immunopthol 36: Goff, J. P Mjor dvnces in our understnding of nutritionl influences on ovine helth. J Diry Sci 89: Gottipti, S., N. L. Ro, nd W. P. Fung-Leung IRAK1: criticl signling meditor of innte immunity. Cell Signl 20: Hyirli, A., R. R. Grummer, E. V. Nordheim, nd P. M. Crump Animl nd dietry fctors ffecting feed intke during the prefresh trnsition period in Holsteins. J Diry Sci 85: He, Y., Q. Chu, P. M, Y. Wng, Q. Zhng, D. Sun, Y. Zhng, nd Y. Yu Assocition of ovine CD4 nd STAT5 single nucleotide polymorphisms with somtic cell scores nd milk production trits in Chinese Holsteins. J Diry Res 25:

117 Hoeen, D., C. Burvenich, E. Trevisi, G. Bertoni, J. Hmnn, R. M. Bruckmier, nd J. W. Blum Role of endotoxin nd TNF-lph in the pthogenesis of experimentlly induced coliform mstitis in periprturient cows. J Diry Res 67: Hogn, J. S., W. P. Weiss, D. A. Todhunter, K. L. Smith, nd P. S. Schoenerger Bovine neutrophil responses to prenterl vitmin E. J Diry Sci 75: Iegh-Awemu, E. M., J. W. Lee, A. E. Iegh, D. D. Bnnermn, M. J. Ppe, nd X. Zho Bcteril lipopolyscchride induces incresed expression of toll-like receptor (TLR) 4 nd downstrem TLR signling molecules in ovine mmmry epithelil cells. Vet Res 39: Jnovick, N. A. nd J. K. Drckley Preprtum dietry mngement of energy intke ffects postprtum intke nd lcttion performnce y primiprous nd multiprous Holstein cows. J Diry Sci 93: Jnovick, N. A., Y. R. Boisclir, nd J. K. Drckley Preprtum dietry energy intke ffects metolism nd helth during the periprturient period in primiprous nd multiprous Holstein cows. J Diry Sci 94: Kufmnn, R. L., C. F. Mtson, A. H. Rowerg, nd W. R. Beisel Defective lipid disposl mechnisms during cteril infection in rhesus monkeys. Metolism 25: Kersten, S., J. Seydoux, J. M. Peters, F. J. Gonzlez, B. Desvergne, nd W. Whli Peroxisome prolifertor-ctivted receptor lph medites the dptive response to fsting. J Clin Invest 103: Khovidhunkit, W., M. S. Kim, R. A. Memon, J. K. Shigeng, A. H. Moser, K. R. Feingold, nd C. Grunfeld Effects of infection nd inflmmtion on lipid nd lipoprotein metolism: mechnisms nd consequences to the host. J Lipid Res 45: Kimur, K., J. P. Goff, M. E. Kehrli, Jr., nd T. A. Reinhrdt Decresed neutrophil function s cuse of retined plcent in diry cttle. J. Diry Sci. 85: Krj, A. T., M. A. Province, R. J. Strk, J. M. Ordovs, I. B. Borecki, nd D. K. Arnett Fenofirte nd metolic syndrome. Endocr Met Immune Disord Drug Trgets 10: Kushiiki, S., K. Hodte, H. Shingu, Y. Or, E. Touno, M. Shinod, nd Y. Yokomizo Metolic nd lcttionl responses during recominnt ovine tumor necrosis fctor-lph tretment in lctting cows. J Diry Sci 86: Lvoie, J. M. nd M. S. Guthier Regultion of ft metolism in the liver: link to nonlcoholic heptic stetosis nd impct of physicl exercise. Cell Mol Life Sci 63:

118 Lin, J. X., J. Mietz, W. S. Modi, S. John, nd W. J. Leonrd Cloning of humn Stt5B. Reconstitution of interleukin-2-induced Stt5A nd Stt5B DNA inding ctivity in COS-7 cells. J Biol Chem 271: Litherlnd, N. B., M. Bionz, R. L. Wllce, J. J. Loor, nd J. K. Drckley Effects of the peroxisome prolifertor-ctivted receptor-lph gonists clofirte nd fish oil on heptic ftty cid metolism in wened diry clves. J Diry Sci 93: Ljungerg, A., D. Linden, C. Ameen, G. Bergstrom, nd J. Oscrsson Importnce of PPAR lph for the effects of growth hormone on heptic lipid nd lipoprotein metolism. Growth Horm IGF Res 17: Loor, J. J., H. M. Dnn, R. E. Everts, R. Oliveir, C. A. Green, N. A. Guretzky, S. L. Rodriguez- Zs, H. A. Lewin, nd J. K. Drckley Temporl gene expression profiling of liver from periprturient diry cows revels complex dptive mechnisms in heptic function. Physiol Genomics 23: Lu, B., A. Moser, J. K. Shigeng, C. Grunfeld, nd K. R. Feingold The cute phse response stimultes the expression of ngiopoietin like protein 4. Biochem Biophys Res Commun 391: Lucy, M. C Functionl differences in the growth hormone nd insulin-like growth fctor xis in cttle nd pigs: implictions for post-prtum nutrition nd reproduction. Reprod Domest Anim 43 Suppl 2: Moy, S. L., M. A. Gomez, L. A. Boyle, J. F. Mee, B. O'Brien, nd S. Arkins Effects of milking frequency on phgocytosis nd oxidtive urst ctivity of phgocytes from primiprous nd multiprous diry cows during erly lcttion. J Diry Sci 91: Moyes, K. M., J. K. Drckley, D. E. Morin, nd J. J. Loor Greter expression of TLR2, TLR4, nd IL6 due to negtive energy lnce is ssocited with lower expression of HLA-DRA nd HLA-A in ovine lood neutrophils fter intrmmmry mstitis chllenge with Streptococcus ueris. Funct Integr Genomics 10: Moyes, K. M., J. K. Drckley, D. E. Morin, S. L. Rodriguez-Zs, R. E. Everts, H. A. Lewin, nd J. J. Loor Mmmry gene expression profiles during n intrmmmry chllenge revel potentil mechnisms linking negtive energy lnce with impired immune response. Physiol Genomics. Moyes, K. M., J. K. Drckley, J. L. Slk-Johnson, D. E. Morin, J. C. Hope, nd J. J. Loor Dietry-induced negtive energy lnce hs miniml effects on innte immunity during Streptococcus ueris mstitis chllenge in diry cows during midlcttion. J Diry Sci 92:

119 Mullign, F. J. nd M. L. Doherty Production diseses of the trnsition cow. Vet J 176:3-9. Nicholson, S. E. nd D. J. Hilton The SOCS proteins: new fmily of negtive regultors of signl trnsduction. J Leukoc Biol 63: Nikkhh, A., J. J. Loor, R. J. Wllce, D. E. Grugnrd, J. Vsquez, B. Richrds, nd J. K. Drckley Moderte excesses of dietry energy mrkedly increse viscerl dipose tissue mss in non-lctting diry cows. J. Diry Sci. 91:LB4. NRC Nutrient Requirements of Diry Cttle. 7th rev. ed. Ntl. Acd. Sci., Wshington, DC. Pederner, M., P. Celi, S. C. Grci, H. E. Slvin, I. Brchi, nd W. J. Fulkerson Effect of diet, energy lnce nd milk production on oxidtive stress in erly-lctting diry cows grzing psture. Vet J. Prieur, X., P. Lesnik, M. Moreu, J. C. Rodriguez, C. Doucet, M. J. Chpmn, nd T. Huy Differentil regultion of the humn versus the mouse polipoprotein AV gene y PPARlph. Implictions for the study of phrmceuticl modifiers of hypertriglyceridemi in mice. Biochim Biophys Act 1791: Pullen, D. L., J. S. Liesmn, nd R. S. Emery A species comprison of liver slice synthesis nd secretion of tricylglycerol from nonesterified ftty cids in medi. J Anim Sci 68: Pyper, S. R., N. Viswkrm, S. Yu, nd J. K. Reddy PPARlph: energy comustion, hypolipidemi, inflmmtion nd cncer. Nucl Recept Signl 8:e002. Rukkwmsuk, T., T. A. Kruip, nd T. Wensing Reltionship etween overfeeding nd overconditioning in the dry period nd the prolems of high producing diry cows during the postprturient period. Vet Q 21: Slk, J. L., J. J. McGlone, nd M. Lyte Effects of in vitro drenocorticotrophic hormone, cortisol nd humn recominnt interleukin-2 on porcine neutrophil migrtion nd luminoldependent chemiluminescence. Vet Immunol Immunopthol 39: Selerg, K. T., C. R. Stples, N. D. Luchini, nd L. Bding Dietry trns octdecenoic cids upregulte the liver gene encoding peroxisome prolifertor-ctivted receptor-lph in trnsition diry cows. J Diry Res 72: Skln, D Effect of high vitmin A or tocopherol intke on heptic lipid metolism nd intestinl sorption nd secretion of lipids nd ile cids in the chick. Br J Nutr 50:

120 Sordillo, L. M. nd S. L. Aitken Impct of oxidtive stress on the helth nd immune function of diry cttle. Vet Immunol Immunopthol 128: Sordillo, L. M., G. A. Contrers, nd S. L. Aitken Metolic fctors ffecting the inflmmtory response of periprturient diry cows. Anim Helth Res Rev 10: Steiger, M., M. Senn, G. Altreuther, D. Werling, F. Sutter, M. Kreuzer, nd W. Lnghns Effect of prolonged low-dose lipopolyscchride infusion on feed intke nd metolism in heifers. J Anim Sci 77: Trktsoglou, M., U. Szlsk, D. A. Mgee, J. A. Browne, T. Sweeney, E. Gormley, nd D. E. McHugh Trnscriptionl profiling of immune genes in ovine monocyte-derived mcrophges exposed to cteril ntigens. Vet Immunol Immunopthol 140: Trevisi, E., M. Amdori, A. M. Bkudil, nd G. Bertoni Metolic chnges in diry cows induced y orl, low-dose interferon-lph tretment. J Anim Sci 87: Udy, G. B., R. P. Towers, R. G. Snell, R. J. Wilkins, S. H. Prk, P. A. Rm, D. J. Wxmn, nd H. W. Dvey Requirement of STAT5 for sexul dimorphism of ody growth rtes nd liver gene expression. Proc Ntl Acd Sci U S A 94: vn Dorlnd, H. A., S. Richter, I. Morel, M. G. Doherr, N. Cstro, nd R. M. Bruckmier Vrition in heptic regultion of metolism during the dry period nd in erly lcttion in diry cows. J Diry Sci 92: vn Knegsel, A. T., G. de Vries Reilingh, S. Meulenerg, H. vn den Brnd, J. Dijkstr, B. Kemp, nd H. K. Prmentier Nturl ntiodies relted to energy lnce in erly lcttion diry cows. J Diry Sci 90: Vels, L., C. M. Rontved, M. Bjerring, nd K. L. Ingvrtsen Cytokine nd cute phse protein gene expression in repeted liver iopsies of diry cows with lipopolyscchrideinduced mstitis. J Diry Sci 92: Wldron, M. R., T. Nishid, B. J. Nonnecke, nd T. R. Overton Effect of lipopolyscchride on indices of peripherl nd heptic metolism in lctting cows. J Diry Sci 86: Zu, L., J. He, H. Jing, C. Xu, S. Pu, nd G. Xu Bcteril endotoxin stimultes dipose lipolysis vi toll-like receptor 4 nd extrcellulr signl-regulted kinse pthwy. J Biol Chem 284:

121 Tle 8. Ingredients nd chemicl composition of experimentl diets. Preprtl energy level Control Overfed Lcttion Ingredients Whet strw Corn silge Alflf silge Soyen mel Ground shelled corn Alflf hy Mgnesium sulfte Mgnesium oxide Vitmin E Minerl nd vitmin mix Mgnesium chloride Ure Slt Sodium phosphte Vitmin A Vitmin D Whole cottonseed Clcium cronte Corn ground Wet rewer s grin Soyen hulls Sodium icronte Diclcium phosphte Vitmin H Chemicl composition DM, % NE L, Mcl/kg DM CP, % DM AP, % DM ADICP, % DM NDF, % DM ADF, % DM C, % DM P, % DM Mg, % DM K, % DM S %DM N % DM Fe, ppm Zn, ppm Cu, ppm Mn, ppm Minerl nd vitmin mix: zinc = 60 ppm, copper = 15 ppm, mngnese = 60 ppm, selenium 0.3 ppm, iodine = 0.6 ppm, iron = 50 ppm, nd colt = 0.2 ppm. Rumensin: 360mg/dy in the lcttion diet. 117

122 Tle 9. The effect of intrmmmry LPS chllenge t 7 d postprtum on dry mtter intke, milk production, ody weight (BW), ody condition score (BCS) nd energy lnce in cows (n = 9/tretment) fed control diet (1.34 Mcl/kg DM) or moderte-energy diet (overfed; 1.62 Mcl/kg DM) during the entire dry period. Preprtum diet P vlue Overfed Control SEM 1 Diet Time Diet time DMI -4 to -1 wk, % BW to 14, % BW to 41, % BW to -1 wk, kg/d to 14, kg/d to 41, kg/d Milk yield 7 to 14, kg/d to 41, kg/d wk 1, % Ft wk 2 to 6, % Ft wk 1, % Protein wk 2 to 6, % Protein wk 1, % Lctose wk 2 to 6, % Lctose % FCM yield 2 7 to 41, kg/d Apprent efficiency 4 7 to 41, kg/d Body Weight wk -4 to -1, kg wk 1, kg wk 1 nd 2, kg wk 1 to 6, kg Body Condition Score wk -4 to wk wk 1 nd wk 1 to Clf irth weight, kg Energy lnce wk -4 to -1, Mcl/d wk -4 to -1, % req wk 1, Mcl/d wk 1, % req wk 2, Mcl/d wk 2,% req wk 2 to 6, Mcl/d wk 2 to 6, % req Lrgest SEM is shown % FCM, kg = Milk yield, kg [(0.4324) + ( ft % 0.01)]. 3% of requirements 4 Defined s 3.5% FCM (kg) divided y DMI (kg). 118

123 Tle 10. Description of genes selected for qpcr. Symol Description GenBnk ccession MYD88 myeloid differentition primry response gene (88) NM_ CREB3L3 camp responsive element inding protein 3-like 3 NM_ NR3C1 nucler receptor sufmily 3, group C, memer 1 (glucocorticoid receptor) XM_ TLR4 toll-like receptor 4 NM_ TNF tumor necrosis fctor NM_ FAAH ftty cid mide hydrolse NM_ HMGCS2 3-hydroxy-3-methylglutryl-CoA synthse 2 (mitochondril) NM_ ACOX1 cyl-coa oxidse 1, plmitoyl NM_ CPT1A crnitine plmitoyltrnsferse 1A (liver) FJ ANGPTL4 ngiopoietin-like 4 NM_ FGF21 firolst growth fctor 21 XM_ PPARA peroxisome prolifertor-ctivted receptor lph NM_ PPARD peroxisome prolifertor-ctivted receptor delt NM_ XBP1 X-ox inding protein pseudogene 1 XM_ DGAT1 dicylglycerol O-cyltrnsferse homolog 1 NM_ PERK eukryotic trnsltion initition fctor 2-lph kinse 3 NM_ NFKB1 nucler fctor of kpp light polypeptide gene enhncer in B-cells 1 NM_ SOD2 superoxide dismutse 2, mitochondril NM_ IRAK1 interleukin-1 receptor-ssocited kinse 1 NM_ MTTP microsoml triglyceride trnsfer protein NM_

124 Tle 11. Gene ID, GenBnk ccession numer, hyridiztion position, sequence nd mplicon size of primers for Bos turus used to nlyze gene expression y qpcr. Similr informtion for remining genes ws reported previously (2, 3). Gene Accession # Gene Primers 1 Primers (5-3 ) 2 p 3 ID NM_ MYD88 F.367 GGAGGACTGCCAAAAGTATATTCTG 105 R. 471 GCCATGTCATTTATCCGAGTTATG NM_ CREB3L3 F.1606 TGGAGATGCACAGATACACAGCTA 100 R.1705 AGATTTCTCAGACTTTGTGGCCTTA XM_ NR3C1 F.395 AAGCACCCCCAGTAGAGAAGAA 100 R.494 CACAGTAGCTCCTCCCCTTAGG NM_ TLR4 F.103 GCTGTTTGACCAGTCTGATTGC 99 R.201 GGGCTGAAGTAACAACAAGAGGAA NM_ TNF F.174 CCAGAGGGAAGAGCAGTCCC 114 R.287 TCGGCTACAACGTGGGCTAC NM_ FAAH F.1332 TTCCTGCCAAGCAACATACCT 105 R.1436 CACGAAATCACCTTTGAAGTTCTG NM_ HMGCS2 F.837 TTACGGGCCCTGGACAAAT 100 R.936 GCACATCATCGAGAGTGAAAGG NM_ ACOX1 F.180 ACCCAGACTTCCAGCATGAGA 100 R.279 TTCCTCATCTTCTGCACCATGA FJ CPT1A F.141 TCGCGATGGACTTGCTGTATA 100 R.240 CGGTCCAGTTTGCGTCTGTA NM_ ANGPTL4 F.28 AGGAAGAGGCTGCCCAAGAT 109 R.136 CCCTCTCTCCCTCTTCAAACAG NM_ PPARA F.729 CATAACGCGATTCGTTTTGGA 102 R.830 CGCGGTTTCGGAATCTTCT NM_ PPARD F.460 TGTGGCAGCCTCAATATGGA 100 R.559 GACGGAAGAAGCCCTTGCA XM_ XBP1 F.618 GAGAGCGAAGCCAATGTGGTA 80 R.697 ACTGTGAATTCAGGGTGATCTTTCT NM_ DGAT1 F.210 ACCGCCTGCAGGATTCC 105 R.314 ATAACCGTGCGTTGCTTAAGATC NM_ PERK F.3160 ATATGAGCCCGGAACAGATTCAT 101 R.3262 AGTGCCGAACGGGTATAGTAATTC NM_ NFKB1 F.172 TTCAACCGGAGATGCCACTAC 95 R.266 ACACACGTAACGGAAACGAAATC NM_ SOD2 F.620 TGTGGGAGCATGCTTATTACCTT 101 R.714 TGCAGTTACATTCTCCCAGTTGA NM_ IRAK1 F.950 CCTCAGCGACTGGACATCCT 103 R.1052 GGACGTTGGAACTCTTGACATCT NM_ MTTP F.617 R.716 ACCAGGCTCATCAAGACAAAGTG GTGACACCCAAGACCTGATGTG Primer direction (F forwrd; R reverse) nd hyridiztion position on the sequence. 2 Exon-exon junctions re underlined. 3 Amplicon size in se pir (p). 120

125 Tle 12. Sequencing results of PCR products from primers of genes designed for this experiment. Best hits using BLASTN ( re shown. Gene Sequence MYD88 GACGCGGAGCATCGTAGAGGCCTTACGGTGGACTCTATAGACAGGC AGCATAACTCGGATAAATGGACATGGGCAACAC CREB3L3 GCCAGGATCGGGTCCACGTAAACGGATTCTCAGACAAAGGACCATT AAGGGCCACAAAGTCTGAGAAATTCTACA NR3C1 CCGTACGGTGTCTGTGTCAGAGAGGGAATGTGATGGACTTCTATAAA ACCCCTAAGGGGGAGGGAGCTACTGTGGAGTGCCC TLR4 GCATCCCTCACCGTTATGGTCAGGTGAATTCCTGGGATAAGGCCAGG CTTCCTCTTGTTGGTTACTTCAGCCAGAAA TNF TCACTCTCCGGGGCAGCTCCGGTGGTGGGACTCGTATGCCAATGCCC TCATGGAA FAAH GCGGACGGGCAGGGGTGGCGTTTCAGTGACGGGTGCACGACCTTCCT ACAGAACTTCAAAGGTGATTTCGTGGATTCAAA HMGCS2 CACTAGCCAGATCGAGAACAGGTGAAGCAAGCTGGCATCGAATCGG CCTTTCACTCTCGATGAATGTGCAAAACCC ACOX1 ATCCTCGTATCCGCGTTCAGGGTGCGTTTAAGAAGAGTGCCATCATG GTGCAGAAGATGAGGAAATCCCC CPT1A GGACTATGAAGGTAAACCAGGCCCGGGACGCCCTTCGTACAGGCCT CTCGCTCCAGCTGGCTCATTACAAGGGACCA ANGPTL4 GCCCATCAGCATCCTCAACCGTGAAGCGGCCAGTATTTCCACTCCAT TTCCAAGGGAAGA PPARA CGAGATCTGAAGCAAATTGAGGCAGAAATCCTTACGTGTGAGCATG ACCTAGAAGATTCCGAAACCGCGA PPARD GCATGGGGACGGCGTCGGGCTCACTACGGCGTTCACGCTTGTGAGGG ATGCAAGGGCTTCTTCCGTCCACAAA XBP1 GGGATGTAGGACACTTTTCAGCCCTCAGAGAAAGATCACCCTGAATT CACAGGTAAG DGAT1 CTAGGCTTCCACTACCGGTGCATCCTGAATTGGTGTGTGGGTGGATG CTGATCCTTAAGCAACGCACGGGTTATAATA PERK GATCAGCATCTCTCATAGTGACATCTTTTCTTTGGGCCTCATTCTGTT TGAATTACTATACCCGTTCGGCACCTCGAA NFKB1 CGATATCTTCGTGTCAAGCAAAAGTATTCGCAACACTGGAAGCACGA ATGACAGATGCCTGTATACGGGGCATCAGAAGGCCGTA SOD2 GCATGTTTGGCCGATTATCTGAGGCCATTTTGGAATGTGATCAACTG GGAGAATGTAACTGCAATAC IRAK1 MTTP GCTAGCGGGCATCTAGTTCTTACATCAAGGAATAGCCCCAGCCCTCA TCCATGGAGAATGTCAAGAAGTTCCAACGCTCCAAAAAGGG GCACTGCCCCCTCTATTTTTCAGTTAATCCAAAGCCCTTTAATTTTTG GTCACTTTGTCTTGATGAGCCCTGAGGAATATCAAA 121

126 Tle 13. Sequencing results of genes using BLASTN from NCBI ginst nucleotide collection (nr / nt) with totl score. Gene Best hits Score MYD88 Bos turus myeloid differentition primry response gene (88) (MYD88), mrna 73.4 CREB3L3 Bos turus camp responsive element inding protein 3-like 3 (CREB3L3), mrna 64.4 NR3C1 PREDICTED: Bos turus nucler receptor sufmily 3, group C, memer 1 (glucocorticoid receptor) (NR3C1), mrna 69.8 TLR4 Bos turus toll-like receptor 4 (TLR4), mrna 64.4 TNF Bos turus tumor necrosis fctor (TNF), mrna 93.3 FAAH Bos turus ftty cid mide hydrolse (FAAH), mrna 105 HMGCS2 Bos turus 3-hydroxy-3-methylglutryl-CoA synthse 2 (mitochondril) (HMGCS2), nucler gene encoding mitochondril protein, mrna 80.6 ACOX1 Bos turus cyl-coa oxidse 1, plmitoyl (ACOX1), mrna 68 CPT1A PREDICTED: Bos turus crnitine plmitoyltrnsferse 1A liver-like (CPT1A), mrna 71.6 ANGPTL4 Bos turus ngiopoietin-like 4 (ANGPTL4), mrna 48.2 PPARA Bos turus peroxisome prolifertor-ctivted receptor lph (PPARA), mrna 98.7 PPARD Bos turus peroxisome prolifertor-ctivted receptor delt, mrna 98.7 XBP1 Bos turus X-ox inding protein pseudogene 1 (XBPP1), mrna 64.4 DGAT1 Bos turus dicylglycerol O-cyltrnsferse homolog 1 (mouse) (DGAT1), mrna 75.2 PERK Bos turus eukryotic trnsltion initition fctor 2-lph kinse 3 (EIF2AK3), mrna 102 NFKB1 Bos turus nucler fctor of kpp light polypeptide gene enhncer in B-cells 1 (NFKB1), mrna SOD2 Bos turus superoxide dismutse 2, mitochondril (SOD2), nucler gene encoding 82.4 mitochondril protein, mrna IRAK1 Bos turus interleukin-1 receptor-ssocited kinse 1 (IRAK1), mrna 77 MTTP Bos turus microsoml triglyceride trnsfer protein (MTTP), mrna

127 Tle 14. qpcr performnce mong the genes mesured in Liver Tissue Gene Medin Ct Medin Ct Slope (R 2 ) Efficiency %Reltive mrna Aundnce MYD CREB3L NR3C TLR TNF FAAH HMGCS ACOX CPT1A ANGPTL PPARA PPARD XBP DGAT PERK NFKB SOD IRAK MTTP

128 Tle 15. The effect of intrmmmry LPS chllenge t 7 d postprtum on heptic reltive mrna expression (log-scle) in cows (n = 6/tretment) fed control diet (1.34 Mcl/kg DM) or moderte-energy diet (overfed; 1.62 Mcl/kg DM) during the entire dry period. Dy reltive to prturition P vlue Genes Diet SEM 1 Diet Time Diet Time Metolism DGAT1 Overfed Control FAAH Overfed Control MTTP Overfed Control Stress nd inflmmtion PERK Overfed c Control c 0.62 c 0.89 TLR4 Overfed * Control * XBP1 Overfed c Control Inflmmtion nd metolic trnscription regultors NFKB1 Overfed c c Control c c CREB3L3 Overfed Control c c PPARD Overfed Control c Lrgest SEM is shown. -c Differences etween dys (time P < 0.05 or diet time effects P < 0.10). *Denote significnt interctions (diet time effects P < 0.10) t given dy. 124

129 Figure 6. Dily DMI nd milk production in cows (n = 9/tretment) fed control diet (1.34 Mcl/kg DM) or moderte-energy diet (overfed; 1.62 Mcl/kg DM) during the entire dry period. 30 DMI (kg/d) Control 28 Overfed Diet x time P < 0.05 Time P < DMI (% of BW) Milk (kg/d) Diet P < 0.05 Time P < Time P < Dy reltive to prturition 125

130 Figure 7. Liver lipid nd triglyceride in cows (n = 9/tretment) fed control diet (1.34 Mcl/kg DM) or moderte-energy diet (overfed; 1.62 Mcl/kg DM) during the entire dry period. Smple t d 7 ws collected 2.5 h fter LPS Chllenge. - Differences etween dys (time or within diet time effects); *Diet time t given dy. Concentrtion (% wet weight) Lipid * 14 Control 12 * Overfed Diet xtime P < TAG * 6 * Diet xtime P < * Dy reltive to prturition 126

131 Figure 8. Blood concentrtion of metolic indictors in cows (n = 9/tretment) fed control diet (1.34 Mcl/kg DM) or moderte-energy diet (overfed; 1.62 Mcl/kg DM) during the entire dry period. Smple t d 7 ws collected efore LPS Chllenge. -c Differences etween dys (time or within diet time effects); *Diet time t given dy. Concentrtion NEFA (µeq/l) c * * c c 0.7 * 0.6 Control 0.5 Overfed 0.4 Glucose (mmol/l) Time P < Insulin (µiu/ml) Diet x Time P = 0.09 Time P < * Cretinine (µmol/l) * TAG (mg/dl) 1.0 BHBA (mmol/l) Diet x Time P < 0.05 Time P < 0.05 Diet x Time P < 0.05 Time P < 0.05 c c c c c Time P < 0.05 c c c c ROM (mg H 2 O 2 /100 ml) Diet P < 0.06 Time P < 0.05 c Ure (mmol/l) c Diet P = 0.11 Time P < Dy reltive to prturition 127

132 Figure 9. Blood concentrtion of indexes of inflmmtion nd liver function in cows (n = 9/tretment) fed control diet (1.34 Mcl/kg DM) or moderte-energy diet (overfed; 1.62 Mcl/kg DM) during the entire dry period. Smple t d 7 ws collected efore LPS Chllenge. -d Differences etween dys (time or within diet time effects); *Diet time t given dy. Concentrtion Cholesterol (mmol/l) Diet x Time P = d Ceruloplsmin (µmol/l) Diet P = 0.08 Time P < 0.05 c GOT (U/L) d d d * c d * c Alumin (g/l) * Hptogloin (g/l) Diet x Time P = 0.06 Time P = 0.05 Time P < 0.05 Control Overfed Time P < Biliruin (µmol/l) Time P < 0.05 c c * c c ANGPTL4 (pg/ml) Diet P = Dy reltive to prturition 128

133 Figure 10. Blood concentrtion of selected vitmins in cows (n = 9/tretment) fed control diet (1.34 Mcl/kg DM) or moderte-energy diet (overfed; 1.62 Mcl/kg DM) during the entire dry period. Smple t d 7 ws collected efore LPS Chllenge. -c Differences etween dys (time or within diet time effects); *Diet time t given dy Vitmin A (µg/100 ml) Time P < d cd c Control Overfed Concentrtion Vitmin E (µg/100 ml) Diet P = 0.09 Time P < 0.05 c c c β-crotene (mg/100 ml) Time P < Dy reltive to prturition 129

134 Figure 11. Neutrophil chemotxis ssessed with C5 (pnel A) nd humn IL-8 (pnel B), nd phgocytosis in cows (n =9/tretment) fed control diet (1.34 Mcl/kg DM) or moderteenergy diet (overfed; 1.62 Mcl/kg DM) during the entire dry period. Smple t d 7 ws collected efore LPS Chllenge. -c Differences etween dys (time or diet time); *Diet time t given dy. A 120 Control 100 Overfed Chemotxis (cells/cm 2 ) Phgocytosis (%) B c * c c Time P < 0.05 * Diet x Time P = Dy reltive to prturition c 130

135 Figure 12. Expression pttern of genes ssocited with lipid metolism (CPT1A, ACOX1, HMGCS2, PPARA) nd GH signling (STAT5B, SOCS2) in liver from cows fed control diet (1.34 Mcl/kg DM; N = 6) or moderte-energy diet (overfed, n = 6; 1.62 Mcl/kg DM) during the entire dry period nd receiving n intrmmmry LPS chllenge t 7 d postprtum. -c Differences etween dys (time or within diet time effects); *denote significnt interctions (diet time effects) t given dy. Gene expression (log-scle) CPT1A 0.8 Control 0.6 Overfed Diet x Time P < HMGCS ACOX1 PPARA Diet x Time P < * Time P < Diet x Time P < * Dy reltive to prturition 131

136 Figure 13. Blood serum concentrtion of growth hormone (GH) nd insulin-like growth fctor 1 (IGF-1), nd expression of GH signling-relted genes (STAT5B, SOCS2) in liver from cows fed control diet (1.34 Mcl/kg DM; n = 6) or moderte-energy diet (overfed, n = 6; 1.62 Mcl/kg DM) during the entire dry period nd receiving n intrmmmry LPS chllenge t 7 d postprtum. -c Differences etween dys (time or within diet time effects). *denote significnt interctions (diet time effects) t given dy. ng/ml Gene expression (log-scle) 15 Growth hormone GHR * STAT5B * * * 7 Diet x Time P = Diet x Time P < 0.01 * Diet x Time P = IGF-1 IGF1-14 * * SOCS2 * Dy reltive to prturition * Diet x Time P = Control Overfed 30 Diet x Time P = Diet x Time P = 0.01 * c 132

137 Figure 14. Expression pttern of genes ssocited with stress (SOD2, NR3C1) nd inflmmtion (TNF, ANGPTL4, IRAK1, MYD88) in liver from cows fed control diet (1.34 Mcl/kg DM; n = 6) or moderte-energy diet (overfed, n = 6; 1.62 Mcl/kg DM) during the entire dry period nd receiving n intrmmmry LPS chllenge t 7 d postprtum. -c Differences etween dys (time or within diet time effects). *denote significnt interctions (diet time effects) t given dy. Gene expression (log-scle) SOD2 TNF IRAK1 * * c * Control Overfed Diet x Time P < c Diet x Time P = NR3C1 c ANGPTL4 MYD88 Diet x Time P < Time P < Diet x Time P = * Time P < Dy reltive to prturition 133

138 Figure 15. Blood concentrtion of non-esterified ftty cids (NEFA), hydroxyutyric cid (BHBA), iliruin nd rectl temperture fter intrmmmry LPS-chllenge t 7 d postprtum in cows fed control diet (1.34 Mcl/kg DM) or overfed energy (1.62 Mcl/kg DM) during the entire dry period. -c Differences etween dys (time or diet time effects); *denote significnt interctions (diet time effects) t given dy NEFA (µeq/l) Time P < BHBA (mmol/l) c Control Overfed c Concentrtion LPS 12 TAG (mg/dl) 10 Time P < LPS Time P < 0.05 Biliruin (µmol/l) Time P < 0.05 LPS Temperture ( C) LPS c c Time P < 0.05 LPS Hour reltive to LPS chllenge 134

139 CHAPTER 4: Liver nd Mmmry Glnd Trnscript Profiles Affected y Preprtum Dietry Energy nd Erly- Lcttion E. coli Lipopolyscchride Chllenge in Diry Cttle D.E. Grugnrd*, S.L. Rodriguez Zs, R.E. Everts, H.A. Lewin, nd J.J. Loor*. *Mmmlin NutriPhysioGenomics, Deprtment of Animl Sciences nd Division of Nutritionl Sciences, University of Illinois, Urn, IL

140 INTRODUCTION Periprtl cows experience some degree of negtive energy lnce (NEB) nd immunosuppression round prturition (Goff, 2006). Neutrophil trfficking, phgocytosis, nd killing cpcity re impired t clving (Kehrli et l., 1989). Lymphocyte numers decrese round prturition s function of reduced prolifertion (Kehrli et l., 1989). The metolic chllenges ssocited with the onset of lcttion re fctors cple of ffecting immune function not only in neutrophils ut lso liver nd mmmry (Goff, 2006). The NEB ssocited with prturition leds to extensive moiliztion of ftty cids stored in dipose tissue, thus, cusing mrked elevtions in lood non-esterified ftty cids (NEFA) nd hydroxyutyrte (BHBA) concentrtions (Drckley et l., 2001). Preprtl level of dietry energy cn potentilly ffect dipose tissue deposition nd, thus, the mount of NEFA relesed into lood (Jnovick nd Drckley, 2010) nd ville for metolism in liver nd mmmry glnd (Drckley et l., 2005). From helth stndpoint, clinicl mstitis is most likely to occur during the first mo of lcttion (Oviedo-Boyso et l., 2007) nd in mny cses results from n infection estlished during the dry period or during erly lcttion (Goff nd Horst, 1997). Once pthogen is detected y the receptors in the epithelil cells of the mmmry tissue the cute phse response egins nd ctivtes the immune system to eliminte the pthogen. This defense mechnism includes ntomicl, cellulr, nd solule fctors tht ct in coordintion nd re crucil to the modultion of the mmmry resistnce nd susceptiility to infection (Oviedo-Boyso et l., 2007). The liver is centrl orgn during n inflmmtory response in the orgnism. It is responsile for determining the level of essentil metolites during the criticl stges of stress. In ddition, the liver synthesizes the necessry components for immedite defense t the site of 136

141 tissue dmge (Bumnn nd Guldie, 1994). Current dry period feeding prctices cn led to elevted intkes of energy, which cn increse ft deposition in the viscer nd upon prturition led to compromised liver metolism (Beever, 2006, Drckley et l., 2005). Our generl hypothesis ws tht overfeeding dietry energy during the dry period, ccompnied y the metolic chllenges ssocited with the onset of lcttion would render the cow s immune function less responsive erly postprtum when the likelihood of mmmry infection is higher. Trnscript profiling using microrrys is n excellent technique to decipher complex gene networks underlying differences in physiologicl stte tht cn help understnding reltionships with the liver nd mmmry glnd with other tissues. In ddition it hs een demonstrted tht mny of these dpttions cn e influenced y nutritionl mngement strtegies during the dry period (Loor et l., 2005, Loor et l., 2006, Loor et l., 2007). OBJECTIVES The min ojectives of this study were to determine gene expression ptterns in diry cttle liver nd mmmry tissues: 1) In response to n erly-lcttion E. coli lipopolyscchride intr-mmmry chllenge (LPS vs. non-lps) in cows overfed during the dry period. 2) In response to different preprtl dietry energy levels (1.34 vs Mcl/kg DM) nd n erly-lcttion E. coli lipopolyscchride intr-mmmry chllenge. 137

142 MATERIALS AND METHODS All procedures involving nimls received pprovl from the University of Illinois Institutionl Animl Cre nd Use Committee (protocol # 06145). Animls nd Diets A detiled description of experimentl design nd dt collection ws previously descried in Chpters 2 nd 3. Briefly 28 Holstein cows entering their second or greter lcttion were enrolled in the study. Cows were ssigned to control diet (n =14, controlled energy, high fier), which ws fed for d liitum intke to provide t lest 100% of clculted NE L (1.34 Mcl/kg diet DM), or fed diet providing ~159% clculted NE L requirements (n=14, overfed diet, 1.62 Mcl/kg DM) during the entire 45-d dry period. Diets were fed s TMR once dily (0600 h) using n individul gte feeding system (Americn Cln, Northwood, NH, USA). Cows were housed in ventilted enclosed rn during the dry period nd hd ccess to sndedded free stlls until 5 d efore expected clving dte, when they were moved to n individul mternity pen edded with strw. After prturition, ll cows were moved to tie-stll rn nd were fed common lcttion diet (NE L = 1.69 Mcl/kg DM) s TMR once dily (0600 h) nd milked twice dily (0400 nd 1600 h). Diets were mixed in Keenn Klssik 140 mixer wgon (Richrd Keenn & Co., Ltd., Borris, County Crlow, Irelnd) equipped with knives nd serrted pddles; strw in lrge squre les ws chopped directly y the mixer without preprocessing. Lipopolyschride Chllenge At ~7 DIM, 7 cows on ech of the two experimentl diets were ssigned to receive n intr-mmmry E. coli lipopolyschride (LPS) chllenge (200 μg, strin 0111:B4, ct. # L2630, 138

143 Sigm Aldrich, St. Louis, MO) nd 7 cows in the overfed diet only, served s non-lps controls. Prior to LPS chllenge (~2 dys), foremilk smples from ll qurters of ech cow were cultured nd confirmed to e cteriologiclly negtive. LPS ws dissolved in 20 ml of 0.09% sterile physiologicl sline (Hospir, Lke Forest, IL). Immeditely fter milking (0530 h), one rer mmmry qurter ws disinfected with cotton wool pre-soked in 70% ethnol nd the LPS ws infused vi sterile disposle syringe fitted with sterile tet cnnul using the full insertion infusion method. The qurter ws thoroughly mssged. Liver nd Mmmry Biopsies Biopsies of liver were smpled vi puncture iopsy (Dnn et l., 2006) from cows under locl nesthesi. Smples were collected during d 7 reltive to prturition. The procedure ws performed t pproximtely 0730 h (2 h fter LPS or non-lps) to void excessive infiltrtion of PMN, i.e. s mens to void excessive confounding on tissue gene expression.biopsies of mmmry tissue were collected simultneously with the liver iopsies from rer qurter in ll the cows (infused with LPS or selected rndomly in the cse of the non-lps group). Cows were restrined in squeeze chute to minimize movement nd were sedted using n intrvenous dministrtion of xylzine HCl (35 µg/kg BW; Phoenix Phrmceuticls, St. Joseph, MO). The hir round the tip of the til ws clipped nd the til ws tied to prevent contmintion of the surgicl site. The iopsy site ws crefully selected to void sucutneous lood vessels s well s the cisternl region. An re of skin (10 cm 2 ) on the rer qurter ws clipped closely, wshed, nd sterilized with iodine surgicl scru. For locl nesthesi, lidocine HCl (5 ml; Phoenix Phrmceuticls, St. Joseph, MO) ws dministered sucutneously. The iopsy site ws then wshed n dditionl 3X s descried ove. After wshing, 3 cm incision ws mde through 139

144 the skin nd underlying fsci to the point where the mmmry glnd cpsule ws visile. The iopsy trocr ws ttched to high-speed (16 Volts) cordless drill. The trocr consisted of stinless steel cnnul of 90 mm in length with 6-mm dimeter contining retrctle lde t the cutting edge of the cnnul to sever the core of the tissue once it ws cut. Once the tissue ws collected, pressure ws pplied to the incision re until leeding cesed. The skin incision ws closed with Michel wound clips (11 mm; Down Surgicl, Mississug, ON, Cnd) nd coting of Prodine (Phoenix Phrmceuticl, Inc., St. Joseph, MO) iodine ointment ws pplied to the surgicl site. Liver nd mmmry tissues ( ~ 1g) were frozen immeditely in liquid nitrogen nd stored until isoltion of RNA. Cows were monitored during two weeks fter iopsy during the milking in order to evcute lood clots nd ensure proper heling of the incision (clening nd iodine ointment pplictions were performed when necessry). RNA Isoltion RNA ws isolted from mmmry tissue using TRIzolRegent (Invitrogen, Crlsd, CA). Mmmry tissue ws thwed nd immeditely homogenized in TRIzol regent with 1 µl of liner crylmide (Amion, Inc., Austin, TX) using Polytron power homogenizer t mximum speed. Upon centrifugtion, totl RNA ws seprted with chloroform followed y cid phenol:chloroform (Amion, Inc., Austin, TX). Totl RNA ws then precipitted with isopropnol, nd the RNA pellet ws clened with 75% ethnol prior to reconstitution in RNA storge uffer (Amion, Inc., Austin, TX) for storge t -80 C. RNA integrity nd qulity ws confirmed if OD 260mm /OD 280mm sorption rtio ws > 1.7 (NnoDrop ND-1000, NnoDrop Technologies, Rocklnd, DE). 140

145 Microrrys A ovine oligonucleotide (70-mers) microrry with >13,000 nnotted sequences developed t the University of Illinois (Loor et l., 2007) ws used for trnscript profiling. Detils on the development, nnottion, nd use of this microrry hve een reported previously (Loor et l., 2007). Methods for microrry hyridiztion nd scnning were s reported y Loor et l. (2007). Briefly, slides were hydrted, dried, nd plced in UV Strtlinker 1800 (Strtgene, L Joy, CA) for ~5 min. Slides were wshed with 0.2% SDS solution, rinsed with MilliQ (Millipore) H 2 O, nd plced in wrm prehyridiztion soln for 45 min t 42 o C. The sme mount of Cy3- or Cy5-lelled cdna from mmmry nd reference stndrd RNA pool (mde of different ovine tissues) were co-hyridized using dye-swp design (i.e., two microrrys per smple). Slides were incuted for 48 h t 45 o C prior to scnning. Criteri for evlution of slide qulity included: identifiction of numer of spots with minimum medin signl intensity of 3 SD ove ckground; keeping slides with minimum of 20,000 spots with minimum medin signl intensity of 3 SD ove ckground in oth Cy3 nd Cy5 chnnels; nd keeping slides with minimum men intensity of 400 reltive fluorescent units in oth Cy3 nd Cy5 chnnels cross the entire slide. Dt Anlyses GeneSpring GX (Agilent Technologies) ws used for dt visuliztion nd preliminry dt mining. Susequently dt from microrrys (84 slides) ws normlized for dye nd microrry effects (i.e., Lowess normliztion nd microrry centering) nd used for sttisticl nlysis. Dt were nlyzed using the Proc MIXED procedure of SAS (SAS Inst. Inc., Cry, NC). Fixed effects were diets (control, overfed) tretment (LPS, non-lps) nd dye (Cy3, Cy5). 141

146 Rndom effects included cow nd microrry. Rw P vlues were djusted using Benjmini nd Hocherg s flse discovery rte (FDR) (Reiner et l., 2003). Differences in reltive expression due to diet or tretment were considered significnt t n FDR-djusted P 0.38 or t P 0.02 (Tle 16). Dynmic Impct Approch This novel ioinformtics pproch hs een descried in prt (Loor et l., 2011) nd in more detil y Bionz, Perismy, Rodriguez-Zs, Everts, Lewin, Hurley, nd Loor (currently under review t PLoS One). The Dynmic Impct Approch (DIA) is sed on clculted impct nd the direction of the impct (i.e., induce/increse or inhiited/decrese) of DEG on the iologicl terms (e.g., pthwys, functions, nd other terms). The DIA ws implemented using MS Excel nd clcultions run utomticlly the iologicl terms otined from different dt ses. In this nlysis the entire microrry dt set with ssocited sttisticl P-vlues nd fold chnges ws imported into the Dtse for Annottion, Visuliztion nd Integrted Discovery (DAVID v6.7) nd Kyoto Encyclopedi of Genes nd Genomes (KEGG) softwre in order to otin significnt iologicl processes, moleculr functions nd pthwys tht were further nlyzed with the DIA pproch. The rtionl of the method lies on the fct tht in cells the trnscriptome expression is non-rndom. From this ssumption the chnge in flux of metolic or signling pthwy is determined y the chnge in numer nd mount of proteins involved in the pthwy. If lrge numer of proteins involved in pthwy re significntly ffected y the tretment or physiologicl phse we cn expect to hve lrge impct of such tretment on the pthwy. However, the finl flux is not just determined y the numer of protein tht chnge y the 142

147 tretment ut lso y the direction of the chnge (i.e., down-regulted or up-regulted). For instnce pthwy where ll proteins re significntly ffected y specific tretment cn e highly impcted, ut the direction of the flux will e determined (considering ll the proteins hving the sme effect on the pthwy) y the numer of up-regulted vs. the numer of downregulted proteins. When the rtio of up-regulted/down-regulted = 1, the flux cn e considered overll unchnged, despite the fct tht the tretment hd lrge impct on the pthwy (Morndini, 2009). In ddition, lso the mgnitude of chnge of proteins content determines the impct on metolic or signling flux. For instnce, if two tretments ffect expression of the sme proteins with the sme direction of chnge (e.g., up-regulted) ut one tretment chnge the mount of proteins in verge twice s much compred to the other tretment we will expect to hve c. twice s much flux in the former tretment compred to the ltter. When considering the fct tht we use few smples to infer the effect of tretments or physiologicl phses for the universl popultion we need to ccount lso for the significnce of the chnge of protein expression. For instnce if on the previous exmple the numer of proteins nd the mgnitude of chnge (nd direction of chnge) of the proteins were equl etween the two tretment ut in the first tretment the verge significnce is 10-fold lower thn the second tretment we will expect tht in the universl popultion the flux of the pthwy will e 10-fold more significntly ffected in the second thn in the first tretment. Considering ll the ove points we cn summrize tht specific tretment impcts pthwy (or ny iologicl term) in proportion of the numer of proteins involved in such pthwy significntly ffected y the tretment, the verge mgnitude of the effect on proteins expression, nd the verge significnce of the proteins ffected. For the microrry nlysis we mesure only gene expression nd not protein expression, ut we ssumed tht the expression of 143

148 genes is proportionl to expression of proteins. This is gross, ut unvoidle, ssumption ecuse the correltion etween mrna nd protein is highly vrile etween types of mrna nd estimted to e less thn 0.5 (Gygi et l., 1999, Schwnhusser et l., 2011). Bsed on this rtionle the impct nd the direction of the impct re clculted s: Impct = [Proportion of DEG in the pthwy (corrected y the numer of genes in the pthwy present in the rry or ckground)] [verge log2 fold chnge of the DEG] [verge of log P-vlue of the DEG] Direction of the Impct = Impct of up-regulted DEG Impct of down-regulted DEG RESULTS AND DISCUSSION As explined in the mterils nd methods section in this study we did not use the non- LPS group fed control diet during the dry period due to removl of cows ecuse of helth prolems. However, the effect of preprtl dietry energy supplementtion ws ssessed in the group of cows tht received LPS (Overfed energy diet vs. Control diet, ll cows receiving LPS chllenge) nd the effect of LPS ws evluted solely in cows overfed energy during the dry period (LPS vs. Non-LPS. The nlysis ws performed in liver nd mmmry tissues resulting in 4 comprisons. After the correction of P- vlue nd FDR (Tle 16) we uncovered 676 nd 51 DEG in liver nd mmmry tissue, respectively, due to preprtl diet. In ddition, 758 nd 859 DEG in liver nd mmmry tissue, respectively, were found due to LPS in cows overfed energy preprtum. 144

149 Chromosome Evlution The determintion of impct of DEG on chromosomes cn e useful to identify regions of chromosomes with lrger groups of ffected genes. This informtion cn help in genetic selection nd identifiction of genes in quntittive trit loci (QTL). The impct nd the direction of the impct of the DEG on ovine chromosome re reported in Tle 18. Overll, the most impcted chromosomes in this comprison were BTA12, BTA14, nd BTA22. BTA12 hs een ssocited with milk production nd fertility trits (Olsen et l., 2011). BTA14 hs een ssocited with trits of economic importnce nd some of the genes (CRH,CYP11B1, DGAT1, FABP nd TG) responsile for those trits hve lso een identified (Wiowo et l., 2008). BTA14 lso hs een ssocited with trit relted to ovultion rte (Gond et l., 2004). BTA22 hs een ssocited with trits relted with mechnisms of defense nd the immune system (Bnd et l., 2000). The direction of the flux of BTA12 nd BTA14 in the liver dtset indicted inhiition during LPS chllenge in the overfed group compred to the control. In n opposite direction, the flux in those chromosomes seemed to e incresed or ctivted in LPS chllenged cows compred to controls (in liver nd mmmry glnd tissues). BTA22 flux direction ws inhiited in the liver for oth effects (Preprtl diet nd LPS chllenge) in the overfed group. BTA22 ws ctivted in the mmmry glnd of LPS treted cows, s expected, compred to the controls. Preprtum Dietry Energy Effect in Liver Tle 17 shows the cnonicl KEGG pthwys. Overll, the direction of the flux ws inhiited in most of the pthwys in the overfed group compred to the control. The most impcted pthwy ws trnsltion with consistent decrese in flux. Also lipid nd energy 145

150 metolism were mong the impcted cnonicl pthwys. Lipid metolism hd n incresing in flux in the overfed group. This lst ctegory is quite extensive, nd comprises ftty cid oxidtion. This finding is in greement with higher rtes of moiliztion resulting from overfeeding during the dry period (Drckley, 1999, Drckley et l., 2005, Zmmit, 1984). Tle 19 shows the results of the top KEGG suctegories of pthwys in liver in the overfed vs. control comprison. The direction of flux for the mjority of the impcted functions ws inhiition. Tle 20 shows moleculr functions provided y DAVID in the comprison of diet effect in liver. The results of this comprison reveled tht the most impcted functions hd decresein flux in the overfed group. The most impcted function ws phospholipidhydroperoxide glutthione peroxidse ctivity. This enzyme provides significnt protection ginst singlet oxygen generted lipid peroxidtion vi removl of lipid hydroperoxides nd suggest tht lipid hydroperoxides re mjor meditors in this cell injury process (Wng et l., 2001). Other impcted functions were RNA primry trnscript inding nd CD4 receptor inding. Tle 21 shows DAVID iologicl processes. The overll flux direction of the impcted iologicl processes ws inhiition, which followed similr pttern to the direction of the KEGG nlysis. Among the processes relevnt to the context of preprtl energy feeding, connective tissue replcement during inflmmtion response ws highly impcted with lower flux in the overfed group. Also in this comprison we oserved positive regultion of centrosome dupliction nd positive regultion of tyrosine phosphoryltion of STAT protein s two pthwys tht were ctivted in the overfed group. The STAT (Signl Trnsducer nd Activtor of Trnscription) group of proteins regultes mny spects of growth, survivl nd differentition of cells. (Khti et l., 2009). STAT3 for instnce is trnscription fctor tht regultes the 146

151 expression of vriety of genes in response to cell stimuli, nd thus plys key role in mny cellulr processes such s cell growth nd poptosis (Yun et l., 2004). Preprtum Dietry Energy Effect in the Mmmry Glnd A totl of 51 DEG genes resulting from the preprtl diet effect in mmmry glnd stisfied the P-vlue restriction ut did not meet the FDR estlished (0.38). Interestingly, in the context evluted the response oserved in the mmmry glnd suggested stte of self preservtion. Performnce nd metolic indices results relted to energy lnce ffected y preprtl diet (Chpters 1nd 3), clerly indicted tht during the trnsition period drmtic chnges re occurring in terms of energy moiliztion. However these chnges nd dpttions impct the metoliclly ctive tissues in different wys. For instnce the dipose tissue hydrolyzes triglycerides in order to provide energy to meet the incresing requirements during the onset of lcttion (Horst et l., 2005). The liver oxidizes nd ccumultes NEFA providing intermedite energy compounds for the mmmry glnd nd other tissues. Finlly the mmmry glnd initites the synthesis of milk nd this event instinctively ecomes priority (Drckley, 1999). Physiologiclly, meeting the energy requirements for milk production ecomes priority s well. This ehvior compels the dipose nd liver tissues to mke dpttions in terms of energy utiliztion tht re reflected t the gene level explining the greter mount of DEG in the liver (676 genes) compred to mmmry glnd (51). The mmmry glnd seems to e progrmmed to produce milk, regrdless of the source of the necessry intermedite molecules, to wrrnty the survivl of the neworn nd in this wy preserve the specie. This mechnism, could explin in prt the few chnges oserved in the mmmry glnd s consequence of the preprtl dietry tretment. 147

152 Lipopolyscchride Effect in Liver Tle 17 shows KEGG cnonicl pthwy results. In the liver the comprison of LPS vs. Non LPS seemed to e overll ctivted. In this comprison we oserved some pthwys with reltively high impct tht included metolism of other mino cids nd iosynthesis of other secondry metolites. In the LPS chllenged group the direction of flux of metolism of other mino cids nd iosynthesis of other secondry metolites ws inhiition. Tle 22 showed the top KEGG pthwys su-ctegories sed on reltive impct. Among the most impcted suctegories were ftty cid elongtion in mitochondri, p53 signling pthwy, pyruvte metolism, poptosis nd PPAR signling. In the LPS chllenged group the direction of the flux in the p53 signling pthwy ws ctivtion. The p53 ctivtion is induced y numer of stress signls, including oxidtive stress. The p53 protein is employed s trnscriptionl ctivtor of p53-regulted genes. This results in three mjor outputs including cell cycle rrest, cellulr senescence or poptosis. In diry cows this pthwy hs een relted to e ctivted in response to negtive energy lnce (Morris et l., 2009). Tle 23 shows the top moleculr functions from DAVID sed on reltive impct. Among the moleculr functions with high impct nd relevnce were clcium-dependent cysteine-type inhiitor ctivity nd functions relted with thyroid hormone ctivtion. However, priori, the top moleculr functions oserved in this comprison do not seem to hve gret relevnce to the effect of LPS chllenge in the liver. Tle 24 shows the top iologicl processes from DAVID. Among the most impcted iologicl processes ws monocyte chemotxis. This process is of gret importnce for immune cells during inflmmtion or immune response. In the LPS chllenged group the flux direction of monocyte phgocytosis ws ctivtion, thus, providing evidence of the liver response to the LPS. 148

153 Other relevnt iologicl process were positive regultion of tyrosine phosphoryltion of STAT3 protein with n ctivted flux in the LPS infused group. Phosphoryltion of STAT3 hs een relted with immune cells nd there is evidence of STAT3 upregultion in the presence of LPS (Chen et l., 2011). Lipopolyscchride Effect in the Mmmry Glnd The most impcted KEGG pthwy ws immune system with flux direction indicting ctivtion in the LPS chllenged group (Tle 17). Tle 25 shows the KEGG pthwys suctegories; overll, most of the ctegories in this tle hd n ctivted flux direction due to the LPS chllenge. Among the relevnt pthwys su-ctegories tht were highly impcted nd lso with n ctivted flux direction in the LPS treted group were poptosis nd chemokine signling pthwy (Tle 25). Among the most impcted moleculr functions from DAVID in the LPS chllenged group were nucler locliztion sequence inding, CXCR chemokine receptor inding, firolst growth fctor 2 inding nd firinogen inding (Tle 26). Most of the moleculr functions were ctivted in the mmmry glnd. Overll, most of the iologicl processes were with n incresed flux in the LPS group s well (Tle 27). The most relevnt nd impcted processes included negtive regultion of NF-kppB, negtive regultion of ntigen processing nd presenttion, monocyte chemotxis nd toll-like receptor 4 signling pthwy. Overll, the response oserved in the mmmry glnd in the comprison ssessing the effect of LPS reveled gret level of ctivtion in the different nlysis. The mmmry glnd during the trnsition period seemed to e extremely responsive to inflmmtion t the gene level. 149

154 CONCLUSION This nlysis provided specific functions, processes nd pthwys tht cn fcilitte the comprehension of the underlying mechnism etween metolic sttus during the trnsition period nd the risk of mstitis during erly lcttion. Liver tissue nlysis reveled n evident increse in lipid metolism tht ws s consequence of preprtl overfeeding. In response to LPS different pthwys ssocited with immune cells signling were impcted. Results from the mmmry tissue reveled ctivtion ssocited with inflmmtion nd the immune system in cows chllenged with LPS erly postprtum. 150

155 REFERENCES Bnd, M. R., J. H. Lrson, M. Reeiz, C. A. Green, D. W. Heyen, J. Donovn, R. Windish, C. Steining, P. Mhyuddin, J. E. Womck, nd H. A. Lewin An ordered comprtive mp of the cttle nd humn genomes. Genome Res 10: Bumnn, H. nd J. Guldie The cute phse response. Immunol Tody 15(2): Beever, D. E The impct of controlled nutrition during the dry period on diry cow helth, fertility nd performnce. Anim Reprod Sci 96: Chen, K. D., L. W. Hsu, S. Goto, C. W. Yeh, T. Nkno, C. Y. Li, Y. C. Chng, C. H. Hou, C. C. Wng, Y. F. Cheng, K. W. Chiu, C. C. Lin, nd C. L. Chen Adptor protein Shc cts s n immune-regultor for the LPS-stimulted mturtion of one mrrow-derived dendritic cells. BMC Immunol 12: Dnn, H. M., N. B. Litherlnd, J. P. Underwood, M. Bionz, A. D'Angelo, J. W. McFdden, nd J. K. Drckley Diets during fr-off nd close-up dry periods ffect periprturient metolism nd lcttion in multiprous cows. J Diry Sci 89: Drckley, J. K ADSA Foundtion Scholr Awrd. Biology of diry cows during the trnsition period: the finl frontier? J Diry Sci 82: Drckley, J. K., A. D. Beulieu, nd J. P. Elliott Responses of milk ft composition to dietry ft or nonstructurl crohydrtes in Holstein nd Jersey cows. J Diry Sci 84: Drckley, J. K., H. M. Dnn, G. N. Dougls, N. A. J. Guretzky, N. B. Litherlnd, J. P. Underwood, nd J. J. Loor Physiologicl nd pthologicl dpttions in diry cows tht my increse susceptiility to periprturient diseses nd disorders. Itlin Journl of Animl Science 4: Goff, J. P Mjor dvnces in our understnding of nutritionl influences on ovine helth. J Diry Sci 89: Goff, J. P. nd R. L. Horst Physiologicl chnges t prturition nd their reltionship to metolic disorders. J Diry Sci 80: Gond, M. G., J. A. Aris, G. E. Shook, nd B. W. Kirkptrick Identifiction of n ovultion rte QTL in cttle on BTA14 using selective DNA pooling nd intervl mpping. Anim Genet 35: Gygi, S. P., Y. Rochon, B. R. Frnz, nd R. Aeersold Correltion etween protein nd mrna undnce in yest. Mol Cell Biol 19:

156 Horst, R. L., J. P. Goff, nd T. A. Reinhrdt Adpting to the trnsition etween gesttion nd lcttion: differences etween rt, humn nd diry cow. J Mmmry Glnd Biol Neoplsi 10: Jnovick, N. A. nd J. K. Drckley Preprtum dietry mngement of energy intke ffects postprtum intke nd lcttion performnce y primiprous nd multiprous Holstein cows. J Diry Sci 93: Kehrli, M. E., Jr., B. J. Nonnecke, nd J. A. Roth Altertions in ovine neutrophil function during the periprturient period. Am J Vet Res 50: Khti, H., W. Hung, D. Mikheil, V. Schutzkus, nd R. L. Monson Effects of signl trnsducer nd ctivtor of trnscription (STAT) genes STAT1 nd STAT3 genotypic comintions on fertiliztion nd emryonic survivl rtes in Holstein cttle. J Diry Sci 92: Loor, J. J., H. M. Dnn, R. E. Everts, R. Oliveir, C. A. Green, N. A. Guretzky, S. L. Rodriguez- Zs, H. A. Lewin, nd J. K. Drckley Temporl gene expression profiling of liver from periprturient diry cows revels complex dptive mechnisms in heptic function. Physiol Genomics 23: Loor, J. J., H. M. Dnn, N. A. Guretzky, R. E. Everts, R. Oliveir, C. A. Green, N. B. Litherlnd, S. L. Rodriguez-Zs, H. A. Lewin, nd J. K. Drckley Plne of nutrition preprtum lters heptic gene expression nd function in diry cows s ssessed y longitudinl trnscript nd metolic profiling. Physiol Genomics 27: Loor, J. J., R. E. Everts, M. Bionz, H. M. Dnn, D. E. Morin, R. Oliveir, S. L. Rodriguez-Zs, J. K. Drckley, nd H. A. Lewin Nutrition-induced ketosis lters metolic nd signling gene networks in liver of periprturient diry cows. Physiol Genomics 32: Loor, J. J., K. M. Moyes, nd M. Bionz Functionl dpttions of the trnscriptome to mstitis-cusing pthogens: the mmmry glnd nd eyond. J Mmmry Glnd Biol Neoplsi 16: Morndini, P Rethinking metolic control. Plnt Sci 176: Morris, D. G., S. M. Wters, S. D. McCrthy, J. Ptton, B. Erley, R. Fitzptrick, J. J. Murphy, M. G. Diskin, D. A. Kenny, A. Brss, nd D. C. Wthes Pleiotropic effects of negtive energy lnce in the postprtum diry cow on splenic gene expression: repercussions for innte nd dptive immunity. Physiol Genomics 39: Olsen, H. G., B. J. Hyes, M. P. Kent, T. Nome, M. Svendsen, A. G. Lrsgrd, nd S. Lien Genome-wide ssocition mpping in Norwegin Red cttle identifies quntittive trit loci for fertility nd milk production on BTA12. Anim Genet 42:

157 Oviedo-Boyso, J., J. J. Vldez-Alrcon, M. Cjero-Jurez, A. Ocho-Zrzos, J. E. Lopez-Mez, A. Brvo-Ptino, nd V. M. Bizl-Aguirre Innte immune response of ovine mmmry glnd to pthogenic cteri responsile for mstitis. J Infect 54: Reiner, A., D. Yekutieli, nd Y. Benjmini Identifying differentilly expressed genes using flse discovery rte controlling procedures. Bioinformtics 19: Schwnhusser, B., D. Busse, N. Li, G. Dittmr, J. Schuchhrdt, J. Wolf, W. Chen, nd M. Selch Glol quntifiction of mmmlin gene expression control. Nture 473: Wng, H. P., S. Y. Qin, F. Q. Schfer, F. E. Domnn, L. W. Oerley, nd G. R. Buettner Phospholipid hydroperoxide glutthione peroxidse protects ginst singlet oxygen-induced cell dmge of photodynmic therpy. Free Rdic Biol Med 30: Wiowo, T. A., C. T. Gskins, R. C. Newerry, G. H. Thorgrd, J. J. Michl, nd Z. Jing Genome ssemly nchored QTL mp of ovine chromosome 14. Int J Biol Sci 4: Yun, Z. L., Y. J. Gun, L. Wng, W. Wei, A. B. Kne, nd Y. E. Chin Centrl role of the threonine residue within the p+1 loop of receptor tyrosine kinse in STAT3 constitutive phosphoryltion in metsttic cncer cells. Mol Cell Biol 24: Zmmit, V. A Mechnisms of regultion of the prtition of ftty cids etween oxidtion nd esterifiction in the liver. Prog Lipid Res 23:

158 Tle 16. Overll microrry differentilly expressed genes in liver nd mmmry tissues restricted y P-vlue nd Benjmini nd Hocherg s flse discovery rte. Cutoffs Effect DEG 1 P- vlue FDR 2 Overfed vs. Control Liver Mmmry LPS vs. Non-LPS Liver Mmmry Differentilly expressed genes 2 Flse discovery rte 154

159 Tle 17. Impct of DEG during erly lcttion (7 d) in cnonicl pthwys from KEGG. All the cows in the comprison Overfed vs. Control received n LPS chllenge. All the cows on the LPS vs. Non-LPS comprison were fed 1.62 Mcl/kg DM of energy during the dry period (Overfed energy diet). Overfed vs. Control LPS vs. Non-LPS Pthwys 1. Metolism 1.1 Crohydrte Metolism 1.2 Energy Metolism 1.3 Lipid Metolism 1.4 Nucleotide Metolism 1.5 Amino Acid Metolism 1.6 Metolism of Other Amino Acids 1.7 Glycn Biosynthesis nd Metolism 1.8 Metolism of Cofctors nd Vitmins 1.9 Metolism of Terpenoids nd Polyketides 1.10 Biosynthesis of Other Secondry Metolites 1.11 Xenoiotics Biodegrdtion nd Metolism 2. Genetic Informtion Processing 2.1 Trnscription 2.2 Trnsltion 2.3 Folding, Sorting nd Degrdtion 2.4 Repliction nd Repir 3. Environmentl Informtion Processing 3.1 Memrne trnsport 3.2 Signl Trnsduction 3.3 Signling Molecules nd Interction 4. Cellulr Processes 4.1 Trnsport nd Ctolism 4.2 Cell Motility 4.3 Cell Growth nd Deth 4.4 Cell Communiction 5. Orgnisml Systems 5.1 Immune System 5.2 Endocrine System 5.3 Circultory System 5.4 Digestive System 5.5 Excretory System 5.6 Nervous System 5.7 Sensory System 5.8 Development 5.9 Environmentl Adpttion Liver Liver Mmmry Impct Flux

160 Tle 18. Impct of DEG during erly lcttion (7 d) in ovine chromosomes. All the cows in the comprison Overfed vs. Control received n LPS chllenge. All the cows on the LPS vs. Non-LPS comprison were fed 1.62 Mcl/kg DM of energy during the dry period (Overfed energy diet). Overfed vs. Control LPS vs. Non-LPS Chromosome BTA1 BTA2 BTA3 BTA4 BTA5 BTA6 BTA7 BTA8 BTA9 BTA10 BTA11 BTA12 BTA13 BTA14 BTA15 BTA16 BTA17 BTA18 BTA19 BTA20 BTA21 BTA22 BTA23 BTA24 BTA25 BTA26 BTA27 BTA28 BTA29 BTAX Liver Liver Mmmry Impct Flux

161 Tle 19. Su-ctegories from KEGG impct of DEG during erly lcttion (7 d) in liver. All the cows received n LPS chllenge. Su-ctegory from KEGG Riosome Vline, leucine nd isoleucine iosynthesis Hedgehog signling pthwy Glyoxylte nd dicroxylte metolism Bsl trnscription fctors Mismtch repir Pentose nd glucuronte interconversions Sulfur metolism Uiquinone nd other terpenoid-quinone iosynthesis Aminocyl-tRNA iosynthesis Primry immunodeficiency Long-term potentition Cytosolic DNA-sensing pthwy Sphingolipid metolism Glycosylphosphtidylinositol(GPI)-nchor iosynthesis Glycosminoglycn degrdtion Prkinson's disese Alzheimer's disese Melnogenesis Protesome Arrhythmogenic right ventriculr crdiomyopthy (ARVC) Clcium signling pthwy Wnt signling pthwy Oxidtive phosphoryltion Gstric cid secretion Ftty cid elongtion in mitochondri Endocytosis Gliom Glycerolipid metolism Bsl cell crcinom Impct Flux Overfed vs. Control Liver 157

162 Tle 20. Moleculr functions from DAVID impct of DEG during erly lcttion (7 d) in liver. All the cows received n LPS chllenge. Moleculr Functions from DAVID Phospholipid-hydroperoxide glutthione peroxidse ctivity ISG15 ctivting enzyme ctivity Cereroside-sulftse ctivity Prostglndin-I synthse ctivity 5S rrna inding Peptide hormone receptor inding Thyrotropin-relesing hormone receptor inding trna denylyltrnsferse ctivity Vitmin D3 receptor ctivity Mnnose-1-phosphte gunylyltrnsferse ctivity Arylsulftse ctivity 20-lph-hydroxysteroid dehydrogense ctivity Mnnose-phosphte gunylyltrnsferse ctivity CD4 receptor inding Archidonte 15-lipoxygense ctivity rrna primry trnscript inding Hormone-sensitive lipse ctivity Pre-mRNA 3'-splice site inding Second spliceosoml trnsesterifiction ctivity Complement receptor ctivity Lnosterol synthse ctivity Estrogen response element inding Lysophospholipse ctivity Neurotrophin receptor ctivity RNA polymerse I trnscription fctor ctivity Oxidosqulene cyclse ctivity Hyluronn synthse ctivity Inhiin inding Alph-1,3-mnnosyltrnsferse ctivity Inhiin et-a inding Impct Flux Overfed vs. Control Liver 158

163 Tle 21. Biologicl processes from DAVID impct of DEG during erly lcttion (7 d) in liver. All the cows received n LPS chllenge. Biologicl Processes from DAVID Detection of chemicl stimulus involved in sensory perception of tste Detection of chemicl stimulus involved in sensory perception Detection of chemicl stimulus involved in sensory perception of itter tste Regultion of mitotic centrosome seprtion Positive regultion of mitotic centrosome seprtion Trnscriptionl preinitition complex ssemly Regultion of vitmin D 24-hydroxylse ctivity Vitmin D receptor signling pthwy Positive regultion of vitmin D 24-hydroxylse ctivity Positive regultion of helicse ctivity Regultion of helicse ctivity Nucler mrna 3'-splice site recognition Positive regultion of retinoic cid receptor signling pthwy Glutmte secretion Rdil pttern formtion Enkephlin processing Positive regultion of centrosome dupliction Tyrosine phosphoryltion of STAT protein Regultion of centrosome cycle Connective tissue replcement during inflmmtory response STAT protein nucler trnsloction Positive regultion of centrosome cycle Positive regultion of tyrosine phosphoryltion of Stt3 protein Activtion of Rho GTPse ctivity Leukemi inhiitory fctor signling pthwy Negtive regultion of xon extension rrna trns port Activtion of Rs GTPse ctivity rrna export from nucleus Negtive regultion of developmentl growth Impct Flux Overfed vs. Control Li ver 159

164 Tle 22. Su-ctegories from KEGG impct of DEG during erly lcttion (7 d) in liver. All the cows were fed 1.62 Mcl/kg DM of energy during the dry period (Overfed energy diet). Su-ctegory from KEGG Cynomino cid metolism Turine nd hypoturine metolism Ftty cid elongtion in mitochondri O-Mnnosyl glycn iosynthesis Uiquinone nd other terpenoid-quinone iosynthesis Butirosin nd neomycin iosynthesis Pentose nd glucuronte interconversions Thyroid cncer Glctose metolism Selenomino cid metolism NOD-like receptor signling pthwy p53 signling pthwy Smll cell lung cncer Glycosminoglycn iosynthesis - kertn sulfte Pyruvte metolism Aldosterone-regulted sodium resorption Apoptosis Phenyllnine metolism Vline, leucine nd isoleucine degrdtion PPAR signling pthwy Fructose nd mnnose metolism Bsl trnscription fctors Glycerolipid metolism Cell cycle Type II dietes mellitus One cron pool y folte Non-smll cell lung cncer Acute myeloid leukemi MAPK signling pthwy Amino sugr nd nucleotide sugr metolism Impct Flux LPS vs. Non-LPS Liver 160

165 Tle 23. Moleculr functions from DAVID impct of DEG during erly lcttion (7 d) in liver. All the cows were fed 1.62 Mcl/kg DM of energy during the dry period (Overfed energy diet). Moleculr Functions from DAVID 20-lph-hydroxysteroid dehydrogense ctivity Clcium-dependent cysteine-type endopeptidse inhiitor ctivity FATZ inding Thyroid hormone receptor coctivtor ctivity Thyroid hormone receptor ctivtor ctivity ZASP inding FATZ 1 inding Ctechol O-methyltrnsferse ctivity Leukemi inhiitory fctor receptor inding Gunidinocette N-methyltrnsferse ctivity CD27 receptor inding Virl receptor ctivity Acyl inding Prostglndin-endoperoxide synthse ctivity Sterol esterse ctivity Histone methyltrnsferse ctivity (H2A-R3 specific) RNA-3'-phosphte cyclse ctivity Argininosuccinte synthse ctivity Complement inding Histone methyltrnsferse ctivity (H3-R2 specific) Triglyceride inding Amide trnsporter ctivity dtdp-glucose 4,6-dehydrtse ctivity Protein frnesyltrnsferse ctivity Protein-rginine omeg-n symmetric methyltrnsferse ctivity ErB-3 clss receptor inding Lipoprotein lipse ctivity Stem cell fctor receptor ctivity Aldehyde reductse ctivity Inhiin inding Impct Flux LPS vs. Non-LPS Liver 161

166 Tle 24. Biologicl processes from DAVID impct of DEG during erly lcttion (7 d) in liver. All the cows were fed 1.62 Mcl/kg DM of energy during the dry period (Overfed energy diet). Biologicl Processes from DAVID FsL iosynthetic process Activtion of pro-poptotic gene products Relxtion of crdic muscle Negtive regultion of crdic muscle contrction Retrogrde trnsport, vesicle recycling within Golgi Positive regultion of estlishment of protein locliztion to plsm memrne Regultion of estlishment of protein locliztion to plsm memrne Golgi to plsm memrne protein trnsport Protein trgeting to Golgi Lymph vessel development Lymphngiogenesis Leukemi inhiitory fctor signling pthwy Regultion of epithelil cell migrtion Regultion of crosome rection Lung sccule development Positive regultion of tyrosine phosphoryltion of Stt3 protein Monocyte chemotxis Lung cell differentition Cellulr chperone-medited protein complex ssemly Positive regultion of epithelil cell prolifertion involved in wound heling Lung epithelil cell differentition Elstin metolic process Lctte metolic process Clr cell differentition Positive regultion of epithelil cell migrtion Type II pneumocyte differentition Response to muscle ctivity Regultion of endothelil cell differentition Folic cid nd derivtive ctolic process Negtive regultion of cyclic-nucleotide phosphodiesterse ctivity Impct Flux LPS vs. Non-LPS Liver 162

167 Tle 25. Su-ctegories from KEGG impct of DEG during erly lcttion (7 d) in mmmry glnd. All the cows were fed 1.62 Mcl/kg DM of energy during the dry period (Overfed energy diet). Su-ctegory from KEGG NOD-like receptor signling pthwy Mlri RIG-I-like receptor signling pthwy Apoptosis Cytosolic DNA-sensing pthwy Smll cell lung cncer Chemokine signling pthwy Chgs disese Toll-like receptor signling pthwy Adipocytokine signling pthwy Chronic myeloid leukemi B cell receptor signling pthwy Neurotrophin signling pthwy Pthwys in cncer (overview) Prostte cncer TGF-et signling pthwy Leishmnisis Bldder cncer ECM-receptor interction Focl dhesion Intestinl immune network for IgA production Bsl trnscription fctors Phgosome Drug metolism - other enzymes T cell receptor signling pthwy Prion diseses Protein export Complement nd cogultion cscdes Cell dhesion molecules (CAMs) Type II dietes mellitus Impct Flux Lps vs. Non-LPS Mmmry 163

168 Tle 26. Moleculr functions from DAVID impct of DEG during erly lcttion (7 d) in mmmry glnd. All the cows were fed 1.62 Mcl/kg DM of energy during the dry period (Overfed energy diet). Moleculr Functions from DAVID Nucler locliztion sequence inding Firinogen inding Firolst growth fctor 2 inding Fructose inding CXCR chemokine receptor inding Interleukin-8 receptor inding Interleukin-6 receptor inding Riokinse ctivity Collgen V inding Leukemi inhiitory fctor receptor inding Interleukin-5 receptor inding Superoxide dismutse ctivity Oxidoreductse ctivity, cting on superoxide Glutmte-cysteine ligse ctlytic suunit inding Firolst growth fctor inding Doule-strnded RNA denosine deminse ctivity Fructose-isphosphte ldolse ctivity Fironectin inding Isovleryl-CoA dehydrogense ctivity NF-kppB inding DNA topoisomerse type I ctivity Firolst growth fctor receptor ntgonist Nitric-oxide synthse regultor ctivity RNA helicse ctivity Interleukin-1 receptor ntgonist ctivity Aldehyde-lyse ctivity Firolst growth fctor receptor inding Arginine inding Chemokine ctivity Chemokine receptor inding Impct Flux LPS vs. Non-LPS Mmmry 164

169 Tle 27. Biologicl processes from DAVID impct of DEG during erly lcttion (7 d) in mmmry glnd. All the cows were fed 1.62 Mcl/kg DM of energy during the dry period (Overfed energy diet). Biologicl Processes from DAVID Negtive regultion of NF-kppB import into nucleus Cytoplsmic sequestering of NF-kppB Negtive regultion of Notch signling pthwy Cytoplsmic sequestering of trnscription fctor Negtive regultion of ntigen processing nd presenttion Cytoplsmic sequestering of protein Negtive regultion of ntigen processing nd presenttion Age-dependent response to rective oxygen species Monocyte chemotxis FsL iosynthetic process Negtive regultion of plsminogen ctivtion Negtive regultion of dendritic cell ntigen processing Regultion of dendritic cell ntigen processing nd presen Negtive regultion of plsm memrne long-chin ftty cids Regultion of plsm memrne long-chin ftty cid trnsp Regultion of plsminogen ctivtion Regultion of ntigen processing nd presenttion of peptides Engulfment of poptotic cell Regultion of nitric oxide medited signl trnsduction Regultion of firolst migrtion Positive regultion of firolst migrtion Response to mgnesium ion Negtive regultion of nitric oxide medited signl trnsd Negtive regultion of orgnic cid trnsport Nucleotide-inding oligomeriztion domin contining signling Nucleotide-inding oligomeriztion domin contining 1 signling Regultion of cgmp-medited signling Regultion of ntigen processing nd presenttion Toll-like receptor 4 signling pthwy Nucleotide-inding oligomeriztion domin contining 2 signling Impct Flux LPS vs. Non-LPS Mmmry 165

170 CHAPTER 5: Periprtl Bovine Blood Neutrophil Metolic, Antioxidnt nd Inflmmtory Gene Networks Affected y Preprtl Level of Dietry Energy D.E. Grugnrd* nd J.J. Loor*. *Mmmlin NutriPhysioGenomics, Deprtment of Animl Sciences nd Division of Nutritionl Sciences, University of Illinois, Urn, IL

171 INTRODUCTION During the trnsition period the increse in nutrient demnd, the drstic chnges in endocrine sttus nd the decrese in DMI during lte gesttion influence metolism rendering diry cows in stte of immunosuppression tht leds to incresed susceptiility to mmmry infections (Mllrd et l., 1998) nd metolic disorders (Drckley, 1999). Clinicl mstitis is most likely to occur during the first mo of lcttion. Once pthogen is detected y the receptors in the epithelil cells of the mmmry glnd the cute phse response egins nd the immune system is ctivted to eliminte the pthogen (Oviedo-Boyso et l., 2007). After initition of the inflmmtory response, lood neutrophils or polymorphonucler leukocytes (PMN) ecome the predominnt cell type oserved during n infection. Neutrophils constitute up to 70% of the circulting white lood cells (Goldsy et l., 2000). During the trnsition period, the level of energy consumption preprtum my e determinnt fctor in llowing cows to resolve n inflmmtory sitution. There is evidence tht diry cows cn esily over consume energy during the dry period (Dnn et l., 2006). However, during erly lcttion there is period of negtive energy lnce where the cow relies on dipose tissue moiliztion tht cn cuse metolic disorders like ketosis nd ftty liver (Drckley, 1999). In ddition, in vitro studies showed evidence of reduction in PMN viility due to high levels of NEFA nd tht could impir the immune response to pthogens (Scli et l., 2006). Our group is interested in the use gene expression technology on PMN cells to uncover reltionships etween the intensity of lipid moiliztion, nd ovine immune cell function. 167

172 OBJECTIVE The min ojective of this study ws to determine the gene expression ptterns relted to inflmmtion nd lipid metolism in lood PMN from periprtl diry cows in response to different preprtum dietry energy level (1.34 vs Mcl/kg DM). MATERIALS AND METHODS All procedures involving nimls received pprovl from the University of Illinois Institutionl Animl Cre nd Use Committee (protocol # 06145). Animls nd Diets Ten 10 Holstein cows entering their second or greter lcttion were enrolled in the study. Cows were ssigned (n=5/diet) to control or overfed diet, which were fed d liitum intke to provide t lest 100% of clculted NE L (1.34 Mcl/kg diet DM) or ~159% clculted NE L requirements (1.62 Mcl/kg DM) respectively during the entire 45-d dry period. Diets were fed s TMR once dily (0600 h) using n individul gte feeding system (Americn Cln, Northwood, NH, USA). Cows were housed in ventilted enclosed rn during the dry period nd hd ccess to snd-edded free stlls until 5 d efore expected clving dte, when they were moved to n individul mternity pen edded with strw. After prturition, ll cows were moved to tie-stll rn nd were fed common lcttion diet (NE L = 1.69 Mcl/kg DM) s TMR once dily (0600 h) nd milked twice dily (0400 nd 1600 h). Diets were mixed in Keenn Klssik 140 mixer wgon (Richrd Keenn & Co., Ltd., Borris, County Crlow, Irelnd) equipped with knives nd serrted pddles; strw in lrge squre les ws chopped directly y the mixer without preprocessing. 168

173 Neutrophil Isoltion Smples of of lood (~120 ml) were collected t ~0700 h from the coccygel vein or rtery in vcutiner tues contining cid citrte dextrose (ACD Solution A; Fisher Scientific) t -14, 7 nd 14 d reltive to prturition. After lood collection, tues were plced on ice (~30 min) until isoltion (Auchtung et l., 2004, Moyes et l., 2009, Slk et l., 1993). Smples were centrifuged t 600 g for 15 min t 4 C. The uffy cot nd pproximtely one-fourth of red lood cells were removed nd discrded. The remining smple ws poured into 50 ml tue. Twenty milliliters of deionized wter t 4 C were dded to lyse red lood cells followed y ddition of 5 ml 5X PBS t 4 C to restore n iso-osmotic environment. Smples were centrifuged t 200 g for 10 min t 4 C. Three susequent wshings using 1X PBS t 4 C were performed with smples centrifuged t 500 g for 3 min t 4 C. Neutrophils were immeditely homogenized in 2 ml of TRIzol regent (Invitrogen, Crlsd, CA) with 1 µl of liner crylmide (Amion, Inc., Austin, TX) using Polytron power homogenizer t mximum speed. The suspension ws then trnsferred eqully into two RNA-free microcentrifuge tues (2mL; Fisher Scientific, Pittsurgh, PA) nd stored t -80 C until further nlysis. RNA Isoltion The suspension of RNA nd TRIzol regent ws thwed nd upon centrifugtion, totl RNA ws seprted with chloroform followed y cid phenol:chloroform (Amion, Inc., Austin, TX). Totl RNA ws then precipitted with isopropnol, nd the RNA pellet ws clened with 75% ethnol prior to reconstitution in RNA storge uffer (Amion, Inc., Austin, TX) for storge t -80 C. RNA integrity nd qulity ws confirmed y OD 260mm /OD 280mm sorption rtio (NnoDrop ND-1000, NnoDrop Technologies, Rocklnd, DE). 169

174 Quntittive Polymerse Chin Rection Anlysis (qpcr) RNA isolted from neutrophils ws used for qpcr nlysis. Complementry DNA ws synthesized using 100 ng RNA, 1 µg dt18 (Operon Biotechnologies, AL), 1 µl 10 mmol/l dntp mix (Invitrogen Corp., CA), 1 µl rndom primers (Invitrogen Corp., CA), nd 10 µl DNse/RNse free wter. The mixture ws incuted t 65 C for 5 min nd kept on ice for 3 min. A totl of 6 µl of mster mix composed of 5.5 µl 5X Rection Buffer, 0.25 µl (50 U) of RevertAid TM Reverse Trnscriptse (Ferments Inc., MD), nd 0.25 µl of RNse Inhiitor (10 U, Promeg, WI) ws dded. The rection ws performed in n Eppendorf Mstercycler Grdient using the following temperture progrm: 25 C for 5 min, 42 C for 120 min nd 70 C for 15 min. cdna ws then diluted 1:3 with DNse/RNse free wter. Quntittive PCR ws performed using 4 µl diluted cdna comined with 6 µl of mixture composed of 5 µl 1 SYBR Green mster mix (Applied Biosystems, CA), 0.4 µl ech of 10 µm forwrd nd reverse primers, nd 0.2 µl DNse/RNse free wter in MicroAmp Opticl 384-Well Rection Plte (Applied Biosystems, CA). Ech smple ws run in triplicte nd 6 point reltive stndrd curve plus the non-templte control (Kozniewsk et l.) were used (User Bulletin #2, Applied Biosystems, CA). The rections were performed in n ABI Prism 7900 HT SDS instrument (Applied Biosystems, CA) using the following conditions: 2 min t 50 C, 10 min t 95 C, 40 cycles of 15 s t 95 C (denturtion) nd 1 min t 60 C (nneling + extension). The presence of single PCR product ws verified y the dissocition protocol using incrementl tempertures to 95 C for 15 s plus 65 C for 15 s. Dt were clculted with the 7900 HT Sequence Detection Systems Softwre (version 2.2.1, Applied Biosystems, CA). The finl dt were normlized using the geometric men of the three most stle genes (GAPDH, 170

175 UXT nd RPS9)mong the ones tested s internl controls, s reported previously (Bionz nd Loor, 2007). Primers were designed using Primer Express 2.0 with minimum mplicon size of 80 p (when possile mplicons of p were chosen) nd limited 3 G+C (Applied Biosystems, CA). When possile, primer sets were designed to fll cross exon exon junctions. Primers were ligned ginst pulicly ville dtses using BLASTN t NCBI (Nucleotide BLAST, 2008) nd UCSC s Cow (Bos turus) Genome Browser Gtewy. Prior to qpcr primers were tested in 20 μl PCR rection using the sme protocol descried for qpcr except for the finl dissocition protocol. For primer testing we used universl reference cdna (RNA mixture from 5 different ovine tissues) to ensure identifiction of desired genes. Five μl of the PCR product were run in 2% grose gel stined with ethidium romide (2 μl). Only those primers tht did not present primer-dimers nd single nd t the expected size in the gel, nd hd the right mplifiction product (verified y sequencing) were used for qpcr. The ccurcy of primer pirs lso ws evluted y the presence of unique pek during the dissocition step t the end of qpcr. Sttisticl Anlysis Dt were nlyzed using the MIXED procedure in SAS (SAS Institute, Inc., Cry, NC, USA). Fixed effects in the model included diet, time, nd diet time. Rndom effect ws cow within diet. A repeted mesures sttement using n utoregressive covrite structure ws implemented. Sttisticl differences were declred significnt t P

176 RESULTS AND DISCUSSION It is well known tht the immune sttus of diry cows erly fter prturition is of importnce during the trnsition period ecuse there is significnt risk for development of new mstitis infections in the udder tht my result in cses of clinicl mstitis (Hogn et l., 1989). Diry cows during the trnsition period normlly experience mrked decrese in DMI some dys efore prturition, which in turn limits the consumption of dietry energy nd hs negtive impct on the energy lnce equilirium (Bertics et l., 1992). At the sme time, nutrient demnds for initition of milk synthesis re incresed, which ggrvtes the energy lnce sttus (Grummer, 1995). After prturition, s milk production increses the energy needed for milk production lso increses resulting in stte of negtive energy lnce. In results presented previously (Chpter 1) we oserved greter DMI preprtum in overfed cows nd s designed, energy requirements were exceeded during the preprtl period resulting in significntly higher energy lnce. However, oth groups were in negtive energy lnce fter clving with lrger drop oserved in the overfed group cusing drmtic chnges in metolism nd potentilly ffecting the immune sttus. Negtive energy lnce hs een ssocitions with drmtic chnges in metolites round prturition, chrcterized y incresed NEFA nd BHBA ut low glucose, nd incresed susceptiility to mstitis (Godden et l., 2003, Jnosi et l., 2003, Nymn et l., 2008) The mechnisms y which chnges in metolism ffect neutrophils re uncler; however, in vitro nd in vivo studies hve reported tht higher concentrtions of BHBA or NEFA representtive of cows during NEB resulted in ltered neutrophil ctivity including chemotxis (Suriysthporn et l., 1999), viility (Scli et l., 2006), respirtory urst (Hoeen et l., 1997), nd phgocytosis (Grinerg et l., 2008) when compred to cells under 172

177 norml concentrtions. In this study, we present PMN gene expression ptterns tht might help understnding how the chnges in whole-cow metolism ffect the immune cells. Cytokines nd Genes Associted with Inflmmtion Cytokines re essentil proteins secreted y the nervous nd immune system tht re used extensively during intrcellulr communiction (Cnnon, 2000). Figure 16 shows gene expression of the cytokines evluted (IL6, IL1B nd IL10) tht reveled importnt ptterns relted to inflmmtion tht cn e ssocited with the drmtic metolic chnges occurring during the trnsition period. The mrked increse from -14 through d 7 nd 14 in cows fed control led to diet time (P < 0.05) effect for IL6 due to. Thus, expression of IL6 t 7 nd 14 d ws 2-fold greter in controls vs. overfed cows. IL6 hs nti-inflmmtory cpility through inhiition of IL1B nd TNF-α production (Bnnermn et l., 2008). Of these two, we found greter (diet time P < 0.01) expression of IL1B t -14 d nd 7 d in the overfed group followed y similr expression etween groups t 14 d. IL1B is considered cytokine tht medites the inflmmtory response. Similr to IL1B, there ws diet time (P < 0.01) effect for IL10 expression due to greter vlues in overfed cows t d -14 nd 7; tht ws followed y similr expression etween groups t 14 d. IL10 is known to crry multiple functions in immunoregultion nd inflmmtion, especilly relted with nti-inflmmtion signling (Eskdle et l., 1997). Thus, the mrna expression dt in neutrophils in this study suggested suggested higher degree of inflmmtion in the dys prior nd round prturition in cows overfed energy during the dry period. Neutrophils represent key trget for IL10 nd it hs een demonstrted tht this 173

178 cytokine is of extreme importnce in controlling the degree nd durtion of the inflmmtory rections (Bzzoni et l., 2010). Other cytokines mesured included TNF, CCL2 nd CCL5 (Tle 29). Expression of CCL2 ws undetectle in most smples, thus, dt were not nlyzed sttisticlly. TNF is known to e involved in neutrophil poptosis which contriutes to the resolution of n inflmmtory response (Slmone et l., 2001). No overll chnges were oserved in this study due to time or diet, ut the mrked decrese in expression etween 7 nd 14 d in overfed cows led to significnt diet time effect. It could e speculted tht in PMN the expression of TNF round clving might not e s importnt s other cytokines. The chemokine CCL5 is involved in recruiting immune cells to the site of inflmmtion. Eexpression of CCL5 decresed over time (time P < 0.01) nd ws ffected y the preprtl dietry tretment (diet P < 0.05). CCL5 ws greter in the overfed group compred to the control response tht might e explined y the poorer immune sttus of those nimls tht would promote sustined chemokine signling. Overll, the expression of the PMN cytokines reveled more pronounced stte of chronic inflmmtion in cows overfed energy during the dry period. Similr results hve een oserved in non-rumints where excess of energy promotes cytokine production, proinflmmtory signling nd oxidtive stress (Peng et l., 2011) The PMN expresses importnt genes ssocited with the protection of the host orgnism nd the termintion of n inflmmtory response. For instnce, SELL plys n importnt role in slowing immune cell trfficking through the circultion y promoting dhesion nd susequent pthogen elimintion (Mommsen et l., 2011). In humns, there is evidence of upregultion of SELL in neutrophils fter surgicl trum, nd TNF-α hs een suggested to e the regultor (Mommsen et l., 2011). In this study, the expression of SELL ws greter (diet time P < 0.01) 174

179 t d -14 to 7 in the overfed group, fter which expression ws similr t 14 d. The pttern of SELL ws similr to IL10 nd lso IL1B suggesting more chronic stte of inflmmtion during the trnsition period in the overfed group. The expression nd ctivity of SOD2 is ssocited with defending cells ginst oxidtive stress (Al-Guory et l., 2010). Our results reveled greter expression (diet time P < 0.01) t - 14 nd 7 d in the overfed group followed y similr expression etween groups t 14 d. This expression pttern goes long with the pttern oserved for IL10 nd IL1B nd supporting the existence of higher level of stress nd inflmmtion s consequence of more pronounced negtive energy lnce stte. Our dt support previous findings of higher expression of SOD2 during times of high genertion of hydrogen peroxide s those chrcterizing PMN phgocytosis (Olsson et l., 2011). In tle 29 we present results of NR3C1, this gene encodes the glucocorticoid receptor tht functions s trnscription fctor upregulting the expression of nti-inflmmtory proteins or repressing the expression of pro-inflmmtory proteins (Lu et l., 2006). Expression of this gene did not chnge in overfed cows; however, in control cows expression decresed mrkedly etween -14 nd 7 d nd then incresed to pek expression y 14 d (diet time P < 0.03). Those responses might prtly explin the increse in expression of IL6, IL1B nd IL10 etween 7 nd 14 d in control cows. Trnscription Fctors nd Nucler Receptors Peroxisome prolifertors ctivted receptors (PPAR s) re well known lignd-ctivted trnscription fctors tht elong to the nucler hormone receptor superfmily. The three PPAR isoforms (α, γ nd δ) hve een found to ffect multiple spects of lipid metolism 175

180 simultneously(li nd Glss, 2004). PPAR s re lso known to ct y ltering the trnscription of mny trget genes (Michlik et l., 2006); the mjority of these genes re known to ply centrl role in energy metolism including ftty cid oxidtion (Heim et l., 2002, Wn et l., 2010). The ctivting lignds for PPAR s re determined y the lignd concentrtion nd cell type (Crisfulli nd Cuzzocre, 2009). Non esterified ftty cids re known to e common endogenous lignds tht ind ll three PPAR s (Bensinger nd Tontonoz, 2008). Our results (Tle 28 nd Figure 17) showed tht PPARA ws the most undnt of the three isoforms. Figure 17 shows gene expression of the PPAR s nd co-regultors tht reveled relevnt differences to preprtum dietryenergy. PPARA, PPARG nd PPARD hd similr expression ptterns with oth tretments. While PPARD hd cler response to diet (diet P < 0.01) due to greter overll expression in response to overfeeding energy, there ws n interction (diet time P < 0.01) for PPARG expression due to greter expression in the overfed group primrily t -14 d. Interestingly, the postprtl responses were different with decrese in PPARG expression etween 7 nd 14 d in overfed cows ut n increse in control cows. Thus, despite the greter preprtl PPARG nd PPARD in overfed cows, the response for oth genes in control cows t 14 d seemed to suggest the existence of different regultory mechnism. Overfeeding during the dry period hs een shown to result in greter rtes of dipose tissue moiliztion compred to feeding diets tht meet the energy requirements during the dry period (Dnn et l., 2006, Drckley, 1999, Jnovick nd Drckley, 2010). However, in nonruminnts the intermedite products of lipid moiliztion seem to ctivte nd cuse greter expression of PPAR s (Mochizuki et l., 2006). In this cse, neutrophils from overfed nimls were exposed to greter concentrtions of NEFA tht could hve served s ctivting lignds, thus, helping to explin the greter PPAR gene expression. Previous dt reveled tht 16:0 176

181 ctivtes PPARγ ovine mmmry cells (Kdegowd et l., 2009). More recently, it ws shown tht oth 16:0 nd 18:0 lso uprgeulted expression of severl PPARα in ovine kidney cells (Bionz et l., 2001). Activted PPAR ply role during the inflmmtory processes y inhiiting proinflmmtory trnscription fctor signling pthwys in vsculr nd inflmmtory cells nd, consequently, curtil the ctivtion of inflmmtory genes (Mores et l., 2006). PPAR ctivtion lso decreses immune cell recruitment y inhiiting the relese of chemokines (Lee et l., 2000, Muro et l., 1999). Whether ctivtion of PPAR in ovine PMN hs n ntiinflmmtory role is unknown; however, recent dt showed tht PPARα ctivtion (vi 16:0 nd 18:0) in ovine kidney cells upregulted expression of IL6 nd severl cute-phse proteins (e.g. SAA3, ANGPTL4, SPP1) suggesting tht these nucler receptors my hve n ctive role in the PMN during the inflmmtion tht chrcterizes the trnsition period. PPAR regulte gene expression y inding with RXR (Retinoid X Receptor) s heterodimeric prtner tht ttch to DNA promoter regions to induce trnscription of trget genes (Plmer et l., 1995). Figure 17 shows the pttern of RXRA which ws similr to the PPAR s, i.e. greter (diet time P < 0.01) expression in the overfed group during ll the time points. The PPAR: RXR heterodimer exists in oth n ctive nd inctive stte. When inctive, it is ound to corepressors such s NCOR1 (Nucler Receptor Corepressor 1) tht is known to disrupt nd restrict PPARA nd PPARG inding nd signling (Bttgli et l., 2010). NCOR1 (Figure 17) hd greter (diet time P < 0.05) expression in the neutrophils of the control group, which seemed to support the more inctive stte of the PPAR in those cows s result of more fvorle energy lnce sttus compred to the overfed group. NCOR2 plys similr function s NCOR1 nd hs een ssocited with different trnscription trget genes including the thyroid 177

182 hormone receptors (Jons et l., 2007). However, in this study NCOR2 expression did not chnge over time or due to diet. Other trnscription fctors evluted were STAT3, NFKB1 nd MED1 (Tle 29). These re involved in different functions such s inflmmtion, immunity, differentition, cell growth, tumorigenesis nd poptosis (Escouet-Lozch et l., 2002, Li nd Nel, 1997, Silv, 2004). MED1 hd greter expression in cows fed control (diet P < 0.05). Both NFKB1 nd STAT3 expression incresed from -14 nd 7 d nd ws greter (diet time P < 0.02) t d 7 in overfed cows thn controls. Those dt support the notion of greter inflmmtory response in PMN of cows overfed energy preprtum. Neutrophil Signling Influenced y Lipid Metolism Leukotrienes re signling molecules resulting from the metolism of lipids tht hve gret influence in immune cell function (Grnstrom, 1983, Rmos et l., 1991). Leukotrienes my lso ct upon PPAR signling nd their trgets influencing the inflmmtory response (Smuelsson, 1983, Woszczek et l., 2003). Different proteins re involved in leukotrienes iosynthesis. Figure 17 shows the expression pttern of the phospholipse enzyme PLA2G4A, which is cple of hydrolyzing memrne phospholipid ftty cids (Holinstt et l., 2011). ALOX5 nd ALOX5AP encode enzymes involved in ctlyzing different steps in leukotriene iosynthesis from ftty cids, therey plying role in the inflmmtory processes (Stephensen et l., 2011). Both LTA4H nd LTC4S prticipte in the formtion of leukotrienes from rchidonic cid. These compounds ply numerous roles in inflmmtion, immunologicl functions nd mintining iologicl homeostsis (Evns et l., 1986, Ksirg et l., 1999). 178

183 In our study, there ws diet time (P < 0.05) interction for PLA2G4A expression. Expression ws greter t -14 in overfed cows nd it incresed mrkedly y 7 d with oth diets ut to greter extent in cows overfed energy. Therefter, expression incresed in cows fed control ut decresed in cows overfed energy to vlues lower thn preprtum. These expression ptterns were similr to those of most inflmmtory nd nti-inflmmtory cytokines, SELL, PPAR, nd SOD2 suggesting mechnistic reltionship etween genertion of eicosnoids fter clving nd inflmmtory phenomen. Regrdless of tretment, ALOX5 nd LTA4H expression decresed from -14 to 7 d nd expression ws mintined until 14 d (time P < 0.01); wheres, ALOX5AP nd LTC4S expression incresed from -14 to 7 d regrdless of tretment nd remined unchnged until 14 d (time P < 0.01). The pek oserved for PLA2G4A t 7 d might hve een cused y incoming NEFA triggering response potentilly medited vi PPAR nd leding to ctivtion of this enzyme to generte eicosnoids. Tht would hve triggered the necessry pro-inflmmtory response in PMN to djust cellulr metolism to the chnge in energy lnce. The increse in PLA2G4A, ALOX5AP, nd LTC4S strongly suggest tht eicosnoid nd leukotriene synthesis incresed in PMN fter clving nd to greter extent in overfed cows. These dt underscore n importnt role for leukotriene iosynthesis nd function in the PMN dpttions to clving. Another importnt fctor in the metolism of lipids involves insulin signling. For instnce INSR (Tle 29), the receptor for insulin tht medites different metolic functions relted to this hormone ws greter (diet P < 0.05) in the overfed group, nd expression decresed fter clving regrdless of diet (time P < 0.06). Despite tht response, expression of AKT1 (Figure 16) ws lower (diet time P < 0.01) preprtum in the overfed group nd incresed y d 7; wheres, no chnge during -14 nd 7 d ws oserved with the control diet. The 179

184 protein encoded y this gene regultes multiple signling pthwys essentil for cell functioning including glucose metolism (Zrz et l., 2010). The role of AKT1 during inflmmtion hs een studied in AKT1-deficient mice nd results showed mrkedly reduced edem. However, reduced inflmmtion hs een ssocited with drmtic decrese in neutrophil nd monocyte infiltrtion (Di Lorenzo et l., 2009). CONCLUSION Overll, the gene expression dt from neutrophils reveled tht cows overfed during the dry period were more susceptile to stress nd chronic inflmmtion during the trnsition period (SELL, IL10 nd SOD2) nd tht cows fed to meet the energy requirements showed more fvorle indices of inflmmtion during the trnsition period (AKT1 nd IL6). Our dt lso showed evidence tht overfed cows hd greter expression of trnscription fctors involved in metolism of lipids (PPARA, PPARD, PPAG nd RXRA) indicting tht immune cells might e predisposed to use endogenous lignds ville in circultion (NEFA) for the nucler receptors. 180

185 REFERENCES Al-Guory, K. H., C. Grrel, L. Deltouche, Y. Heymn, nd P. Chvtte-Plmer Antioxidnt dptive responses of extremryonic tissues from cloned nd non-cloned ovine conceptuses to oxidtive stress during erly pregnncy. Reproduction 140: Auchtung, T. L., J. L. Slk-Johnson, D. E. Morin, C. C. Mllrd, nd G. E. Dhl Effects of photoperiod during the dry period on cellulr immune function of diry cows. J Diry Sci 87: Bnnermn, D. D., A. C. Kuf, M. J. Ppe, H. R. Springer, nd J. P. Goff Comprison of Holstein nd Jersey innte immune responses to Escherichi coli intrmmmry infection. J Diry Sci 91: Bttgli, S., O. Mguire, J. L. Thorne, L. B. Hornung, C. L. Doig, S. Liu, L. E. Sucheston, A. Binchi, F. L. Khnim, L. M. Gommersll, H. S. Coulter, S. Rkh, I. Giddings, L. P. O'Neill, C. S. Cooper, C. J. McCe, C. M. Bunce, nd M. J. Cmpell Elevted NCOR1 disrupts PPARlph/gmm signling in prostte cncer nd forms trgetle epigenetic lesion. Crcinogenesis 31: Bzzoni, F., N. Tmssi, M. Rossto, nd M. A. Csstell Understnding the moleculr mechnisms of the multifceted IL-10-medited nti-inflmmtory response: lessons from neutrophils. Eur J Immunol 40: Bensinger, S. J. nd P. Tontonoz Integrtion of metolism nd inflmmtion y lipidctivted nucler receptors. Nture 454: Bertics, S. J., R. R. Grummer, C. Cdornig-Vlino, nd E. E. Stoddrd Effect of preprtum dry mtter intke on liver triglyceride concentrtion nd erly lcttion. J. Diry Sci. 75: Bionz, M. nd J. J. Loor Identifiction of reference genes for quntittive rel-time PCR in the ovine mmmry glnd during the lcttion cycle. Physiol Genomics 29(3): Cnnon, J. G Inflmmtory Cytokines in Nonpthologicl Sttes. News Physiol Sci 15: Crisfulli, C. nd S. Cuzzocre The role of endogenous nd exogenous lignds for the peroxisome prolifertor-ctivted receptor lph (PPAR-lph) in the regultion of inflmmtion in mcrophges. Shock 32: Dnn, H. M., N. B. Litherlnd, J. P. Underwood, M. Bionz, A. D'Angelo, J. W. McFdden, nd J. K. Drckley Diets during fr-off nd close-up dry periods ffect periprturient metolism nd lcttion in multiprous cows. J Diry Sci 89:

186 Di Lorenzo, A., C. Fernndez-Hernndo, G. Cirino, nd W. C. Sess Akt1 is criticl for cute inflmmtion nd histmine-medited vsculr lekge. Proc Ntl Acd Sci U S A 106: Drckley, J. K ADSA Foundtion Scholr Awrd. Biology of diry cows during the trnsition period: the finl frontier? J Diry Sci 82: Escouet-Lozch, L., C. K. Glss, nd S. I. Wssermn The role of trnscription fctors in llergic inflmmtion. J Allergy Clin Immunol 110: Eskdle, J., D. Kue, H. Tesch, nd G. Gllgher Mpping of the humn IL10 gene nd further chrcteriztion of the 5' flnking sequence. Immunogenetics 46: Evns, J., D. Nthniel, S. Chrleson, C. Leveille, R. Zmoni, Y. Lelnc, R. Frenette, B. J. Fitzsimmons, S. Leger, P. Hmel, nd et l Neutrophil LTA4 hydrolses nd leukotriene B4 receptors: effects of leukotriene epoxides nd their enzymtic products. Prostglndins Leukot Med 23: Godden, S., P. Rpnicki, S. Stewrt, J. Fetrow, A. Johnson, R. Bey, nd R. Frnsworth Effectiveness of n internl tet sel in the prevention of new intrmmmry infections during the dry nd erly-lcttion periods in diry cows when used with dry cow intrmmmry ntiiotic. J Diry Sci 86: Goldsy, R. A., R. J. Kindt, nd B. A. Osorne Kuy Immunology. Grnstrom, E Prostglndin iochemistry, phrmcy nd physiologicl function. The prostglndins, thromoxnes nd leukotrienes. Act Ostet Gynecol Scnd Suppl 113:9-13. Grummer, R. R Impct of chnges in orgnic nutrient metolism on feeding the trnsition diry cow. J. Anim. Sci. 73: Heim, M., J. Johnson, F. Boess, I. Bendik, P. Weer, W. Hunziker, nd B. Fluhmnn Phytnic cid, nturl peroxisome prolifertor-ctivted receptor (PPAR) gonist, regultes glucose metolism in rt primry heptocytes. FASEB J 16: Hogn, J. S., K. L. Smith, K. H. Holet, P. S. Schoenerger, D. A. Todhunter, W. D. Hueston, D. E. Pritchrd, G. L. Bowmn, L. E. Heider, B. L. Brockett, nd et l Field survey of clinicl mstitis in low somtic cell count herds. J. Diry Sci. 72: Holinstt, M., O. Boutud, P. L. Apop, J. Vesci, M. Bl, J. A. Otes, nd H. E. Hmm Protese-ctivted receptor signling in pltelets ctivtes cytosolic phospholipse A2lph differently for cyclooxygense-1 nd 12-lipoxygense ctlysis. Arterioscler Throm Vsc Biol 31:

187 Jnosi, S., M. Kulcsr, P. Korodi, L. Kti, J. Reiczigel, S. J. Dielemn, J. A. Nikolic, G. Slyi, P. Riiczey-Szo, nd G. Huszenicz Energy imlnce relted predisposition to mstitis in group-fed high-producing postprtum diry cows. Act Vet Hung 51: Jnovick, N. A. nd J. K. Drckley Preprtum dietry mngement of energy intke ffects postprtum intke nd lcttion performnce y primiprous nd multiprous Holstein cows. J Diry Sci 93: Jons, B. A., N. Vrlkhnov, F. Hykw, M. Goodson, nd M. L. Privlsky Response of SMRT (silencing meditor of retinoic cid nd thyroid hormone receptor) nd N-CoR (nucler receptor corepressor) corepressors to mitogen-ctivted protein kinse kinse kinse cscdes is determined y lterntive mrna splicing. Mol Endocrinol 21: Kdegowd, A. K., M. Bionz, L. S. Piperov, R. A. Erdmn, nd J. J. Loor Peroxisome prolifertor-ctivted receptor-gmm ctivtion nd long-chin ftty cids lter lipogenic gene networks in ovine mmmry epithelil cells to vrious extents. J Diry Sci 92: Klmn, J. M., M. Munwr, L. G. Howes, W. J. Louis, B. F. Buxton, G. Gutteridge, nd A. M. Tonkin Atril firilltion fter coronry rtery ypss grfting is ssocited with sympthetic ctivtion. Ann Thorc Surg 60: Ksirg, E., I. Coker, S. Aydogdu, R. V. Ygci, B. Tneli, nd A. Gousseinov Blood levels of leukotrienes (LTC4, D4, E4, B4) nd synthesis of leukotriene B4 y peripherl leukocytes in children with cute A nd B heptitis. Turk J Peditr 41: Kozniewsk, E., R. Michlik, J. Rflowsk, R. Gdmski, M. Wlski, M. Frontczk-Bniewicz, P. Piotrowski, nd Z. Czernicki Mechnisms of vsculr dysfunction fter surchnoid hemorrhge. J Physiol Phrmcol 57 Suppl 11: Lee, H., W. Shi, P. Tontonoz, S. Wng, G. Sungounder, C. C. Hedrick, S. Hm, C. Borromeo, R. M. Evns, J. A. Berliner, nd L. Ngy Role for peroxisome prolifertorctivted receptor lph in oxidized phospholipid-induced synthesis of monocyte chemotctic protein-1 nd interleukin-8 y endothelil cells. Circ Res 87: Li, A. C. nd C. K. Glss PPAR- nd LXR-dependent pthwys controlling lipid metolism nd the development of therosclerosis. J Lipid Res 45(12): Li, Z. nd G. J. Nel A new memer of the I kppb protein fmily, I kppb epsilon, inhiits RelA (p65)-medited NF-kppB trnscription. Mol Cell Biol 17: Lu, N. Z., S. E. Wrdell, K. L. Burnstein, D. Defrnco, P. J. Fuller, V. Giguere, R. B. Hocherg, L. McKy, J. M. Renoir, N. L. Weigel, E. M. Wilson, D. P. McDonnell, nd J. A. Cidlowski Interntionl Union of Phrmcology. LXV. The phrmcology nd clssifiction of the nucler receptor superfmily: glucocorticoid, minerlocorticoid, progesterone, nd ndrogen receptors. Phrmcol Rev 58:

188 Mllrd, B. A., J. C. Dekkers, M. J. Irelnd, K. E. Leslie, S. Shrif, C. L. Vnkmpen, L. Wgter, nd B. N. Wilkie Altertion in immune responsiveness during the periprtum period nd its rmifiction on diry cow nd clf helth. J Diry Sci 81: Michlik, L., J. Auwerx, J. P. Berger, V. K. Chtterjee, C. K. Glss, F. J. Gonzlez, P. A. Grimldi, T. Kdowki, M. A. Lzr, S. O'Rhilly, C. N. Plmer, J. Plutzky, J. K. Reddy, B. M. Spiegelmn, B. Stels, nd W. Whli Interntionl Union of Phrmcology. LXI. Peroxisome prolifertor-ctivted receptors. Phrmcol Rev 58: Mochizuki, K., K. Surug, H. Fukmi, Y. Kiso, S. Tkse, nd T. God Selectivity of ftty cid lignds for PPARlph which correltes oth with inding to cis-element nd DNA inding-independent trnsctivity in Cco-2 cells. Life Sci 80: Mommsen, P., T. Brkhusen, F. Hildernd, C. Zeckey, C. Krettek, nd M. vn Griensven Regultion of L-selectin expression y trum-relevnt cytokines. Pthol Res Prct 207: Mores, L. A., L. Piquers, nd D. Bishop-Biley Peroxisome prolifertor-ctivted receptors nd inflmmtion. Phrmcol Ther 110: Moyes, K. M., J. K. Drckley, J. L. Slk-Johnson, D. E. Morin, J. C. Hope, nd J. J. Loor Dietry-induced negtive energy lnce hs miniml effects on innte immunity during Streptococcus ueris mstitis chllenge in diry cows during midlcttion. J Diry Sci 92: Muro, K., H. Imchi, A. Momoi, Y. Syo, H. Hosokw, M. Sto, T. Ishid, nd J. Tkhr Thizolidinedione inhiits the production of monocyte chemottrctnt protein-1 in cytokine-treted humn vsculr endothelil cells. FEBS Lett 454: Nucleotide BLAST in Ntionl Center of Biotechnology Informtion (NCBI). Snt Cruz. Nymn, A. K., U. Emnuelson, K. Holtenius, K. L. Ingvrtsen, T. Lrsen, nd K. P. Wller Metolites nd immune vriles ssocited with somtic cell counts of primiprous diry cows. J Diry Sci 91: Olsson, J., T. A. Jcoson, J. M. Pulsson, E. Ddfr, A. Moshfegh, S. H. Jcoson, nd J. Lundhl Expression of neutrophil SOD2 is reduced fter lipopolyscchride stimultion: potentil cuse of neutrophil dysfunction in chronic kidney disese. Nephrol Dil Trnsplnt 26: Oviedo-Boyso, J., J. J. Vldez-Alrcon, M. Cjero-Jurez, A. Ocho-Zrzos, J. E. Lopez-Mez, A. Brvo-Ptino, nd V. M. Bizl-Aguirre Innte immune response of ovine mmmry glnd to pthogenic cteri responsile for mstitis. J Infect 54: Plmer, C. N., M. H. Hsu, H. J. Griffin, nd E. F. Johnson Novel sequence determinnts in peroxisome prolifertor signling. J Biol Chem 270:

189 Peng, Y., D. Rideout, S. Rkit, J. Lee, nd M. Murr Diet-induced oesity ssocited with stetosis, oxidtive stress, nd inflmmtion in liver. Surg Oes Relt Dis Rmos, B. F., Y. Zhng, R. Qureshi, nd B. A. Jkschik Mst cells re criticl for the production of leukotrienes responsile for neutrophil recruitment in immune complex-induced peritonitis in mice. J Immunol 147: Slk, J. L., J. J. McGlone, nd M. Lyte Effects of in vitro drenocorticotrophic hormone, cortisol nd humn recominnt interleukin-2 on porcine neutrophil migrtion nd luminoldependent chemiluminescence. Vet Immunol Immunopthol 39: Slmone, G., M. Giordno, A. S. Trevni, R. Gmerle, M. Vermeulen, J. Schettinni, nd J. R. Geffner Promotion of neutrophil poptosis y TNF-lph. J Immunol 166: Smuelsson, B Leukotrienes: new clss of meditors of immedite hypersensitivity rections nd inflmmtion. Adv Prostglndin Thromoxne Leukot Res 11:1-13. Scli, D., N. Lceter, U. Bernucci, K. Demeyere, L. Duchteu, nd C. Burvenich In vitro effects of nonesterified ftty cids on ovine neutrophils oxidtive urst nd viility. J Diry Sci 89: Silv, C. M Role of STATs s downstrem signl trnsducers in Src fmily kinsemedited tumorigenesis. Oncogene 23: Stephensen, C. B., P. Armstrong, J. W. Newmn, T. L. Pedersen, J. Legult, G. U. Schuster, D. Kelley, S. Vikmn, J. Hrtil, R. Nssir, M. F. Seldin, nd H. Allyee ALOX5 gene vrints ffect eicosnoid production nd response to fish oil supplementtion. J Lipid Res 52: Wn, J., L. Jing, Q. Lu, L. Ke, X. Li, nd N. Tong Activtion of PPARdelt up-regultes ftty cid oxidtion nd energy uncoupling genes of mitochondri nd reduces plmitte-induced poptosis in pncretic et-cells. Biochem Biophys Res Commun 391: Woszczek, G., R. Pwliczk, nd M. L. Kowlski [Leukotrienes s inflmmtion meditors]. Postepy Hig Med Dosw 57: Zrz, J., A. Oropez, M. A. Velzquez, K. Korswe, D. Herrmnn, J. W. Crnwth, nd H. Niemnn Developmentl competence nd mrna expression of preimplnttion in vitroproduced emryos from prepuertl nd postpuertl cttle nd their reltionship with poptosis fter introvrin dministrtion of IGF-1. Theriogenology 74:

190 Figure 16. The effect of preprtum diet on neutrophil mrna expression (log-scle) of indices of signling nd inflmmtion in cows fed control diet (1.34 Mcl/kg DM) or overfed diet (1.62 Mcl/kg DM) during the entire dry period. Reltive mrna expression (log-scle) IL6 IL1B SELL c c * * Control Overfed * * * * SOD2 * AKT1 IL10 * * * * * Dy reltive to prturition 186

191 Figure 17. The effect of preprtum diet on neutrophil mrna expression (log-scle) of genes involved in lipid metolism in cows fed control diet (1.34 Mcl/kg DM) or overfed diet (1.62 Mcl/kg DM) during the entire dry period. Reltive mrna expression (log-scle) 1.5 Control Overfed PPARA PPARD RXRA * Diet nd Time P < * * c * PPARG NCOR1 PLA2G4A Dy reltive to prturition * * * * * 187

192 Tle 28. Gene symol nd description of genes evluted from ovine PMN. Symol Description AKT1 v-kt murine thymom virl oncogene homolog 1 ALOX5 rchidonte 5-lipoxygense ALOX5AP rchidonte 5-lipoxygense-ctivting protein CCL5 chemokine (C-C motif) lignd 5 IL10 interleukin 10 IL1B interleukin 1, et IL6 interleukin 6 (interferon, et 2) INSR Insulin receptor LTA4H leukotriene A4 hydrolse LTC4S leukotriene C4 synthse MED1 meditor complex suunit 1 NCOR1 nucler receptor corepressor 1 NCOR2 nucler receptor corepressor 2 NFKB1 nucler fctor of kpp light polypeptide gene enhncer in B-cells 1 NR3C1 nucler receptor sufmily 3, group C, memer 1 PLA2G4A phospholipse A2, group IVA PPARA peroxisome prolifertor-ctivted receptor lph PPARD peroxisome prolifertor-ctivted receptor delt PPARG peroxisome prolifertor-ctivted receptor gmm RXRA retinoid X receptor, lph SELL selectin L SOD2 superoxide dismutse 2 STAT3 signl trnsducer nd ctivtor of trnscription 3 TNF tumor necrosis fctor 188

193 Tle 29. The effect of preprtum diet on neutrophil mrna expression (log-scle) in cows fed control diet (1.34 Mcl/kg DM) or overfed diet (1.62 Mcl/kg DM) during the entire dry period. Dy reltive to prturition P vlue Gene Diet SEM 1 Time Diet Diet Time TNF Overfed * Control * MED1 Overfed Control NFKB1 Overfed * Control * 0.61 NR3C1 Overfed Control ALOX5 Overfed Control ALOX5AP Overfed Control STAT3 Overfed * Control * 0.03 CCL5 Overfed Control INSR Overfed Control NCOR2 Overfed Control LTA4H Overfed Control LTC4S Overfed Control Lrgest SEM is shown. -e Differences etween dys (time P < 0.05 or diet time effects P < 0.05). *Denote significnt interctions (diet time effects P < 0.05) t given dy. 189

194 Tle 30. qpcr performnce mong the genes mesured in PMN. Gene Medin Ct Medin Ct Slope (R 2 ) Efficiency Aundnce 1 AKT ALOX ALOX5AP CCL CCL IL IL1B IL INSR LTA4H LTC4S MED NCOR NCOR NFKB NR3C PLA2G4A PPARA PPARD PPARG RXRA SELL SOD STAT TNF % of mrna undnce reltive to n internl control gene (UXT). 190

195 Tle 31. GenBnk ccession numer, hyridiztion position, sequence nd mplicon size of new primers designed for Bos turus used to nlyze gene expression y qpcr. Similr informtion for remining genes ws reported previously. Accession # Gene Primers 1 Primers (5-3 ) 2 p 3 NM_ PLA2G4A F CTCCATGTCAAACCCGATGTC 105 NM_ LTA4H R.1238 GTCAGGCGCCATAAAAGTACCA F.1042 ACATTTGTGGACGACTGTTTGGT 100 R.1141 TGGGTCTCCCCAAAAGTCTTT NM_ LTC4S F.217 R.316 CATCTACCGAGCCCAAGTGAA CAGTGCTGCCGCACCTT Primer direction (F forwrd; R reverse) nd hyridiztion position on the sequence. 2 Exon-exon junctions re underlined. 3 Amplicon size in se pir (p). 191

196 Tle 32. Sequencing results of PCR products from primers of genes designed for this experiment. Best hits using BLASTN ( re shown. Gene Sequence PLA2G4A GACACGTGAAGTTGTCAGATGTGGGTTGAATTAGTCCATTTGAGATTGGC ATGGGCTAAATATGGTACTTTTTATGGCGCCCTGCACAAAAAAAA LTA4H GAAGAGTCATTTCCGGCTCGTGGGCGGAGTGGAGAACTCCAGAAT TCGATAAAGACTTTTGGGGGAGACCCAACCCCTTT LTC4S CGACGAACTCCGCGTTTCCTCGCCATGCTCTGGGTGGCCGGGCATC TTCTTTCACGAAGGTGCGGCAGCACATGGAACCCCC 192

197 Tle 33. Sequencing results of genes using BLASTN from NCBI ginst nucleotide collection (nr / nt) with totl score. Gene Best hits Score PLA2G4A Bos turus phospholipse A2, group IVA (cytosolic, clcium-dependent) 91.5 LTA4H (PLA2G4A) Bos turus leukotriene RNA A4 hydrolse (LTA4H), mrna 78.8 LTC4S Bos turus leukotriene C4 synthse (LTC4S), mrna

198 SUMMARY AND CONCLUSIONS The overll ojective of this disserttion ws to evlute neutrophil function, metolic nd inflmmtion indices nd gene expression ffected y the plne of dietry energy preprtum nd n erly postprtum inflmmtory chllenge. Our generl hypothesis ws tht overfeeding dietry energy during the dry period, ccompnied y the metolic chllenges ssocited with the onset of lcttion would render the cow s immune function less responsive erly postprtum. In chpters 1, 2 nd 3 we evluted we evluted different spects relted with the trnsition period: Preprum diet effect on erly lcttion (Chpter 1), erly lcttion inflmmtion/chllenge (LPS chllenge; Chpter 2) nd Preprtum diet effect in lcttion with nd erly lcttion LPS chllenge (Chpter 3). The prmeters evluted t this point included performnce, immune cell function (phgocytosis nd chemotxis of neutrophils). In chpter 1, our dt indicted tht the more positive energy sttus preprtum resulted in surge of insulin with temporry ut significnt effect on metolism. We otined evidence tht the greter insulin concentrtion decresed muscle protein turnover nd perhps incresed the circulting TAG uptke y dipose tissue prior to prturition. However, elevted insulin concentrtion lso could hve impired phgocytic cpcity of the PMN prior to clving. Our lood dt showed some indictions of negtive crry over effects of overfeeding energy to the point of clving (hptogloin, iliruin, nd ROM). In chpter 2, the presence of n intr-mmmry E. coli LPS chllenge represented rpid chnges in metolic indices tht cn ffect the diry cow during the dys following dys (immune function) nd might represent dpttions in longer term tht cn negtively ffect performnce (Liver TAG ccumultion). 194

199 Chpter 3 reveled tht controlling the level of dietry energy to meet the cow s requirements during the dry period is n effective mngement strtegy to improve neutrophil function. In the other hnd overfeeding during the dry period does not represent ny dvntge to the diry cow nd when coupled with n erly inflmmtory event the immune sttus is frgile compred to cows tht meet strictly the dietry requirements. In ddition, in this chpter gene expression ws evluted showing evidence of etter immune nd metolic sttus in the nimls fed to meet their energy requirements during the dry period. Bsed on the findings on chpters 1, 2 nd 3; in chpter 4 we nrrowed or investigtion to the period of erly lcttion where most of the chnges were occurring. The effect of LPS chllenge nd the effect of preprtum diet were evluted in mmmry nd liver tissues. The use of microrry technology provided specific functions, processes nd pthwys tht cn fcilitte the comprehension of the underlying mechnism etween metolic sttus during the trnsition period nd the risk of mstitis during erly lcttion. These results my led into more specific reserch tht cn turn into improved nutritionl mngement strtegies nd etter prevention nd tretment of the disorders tht occur during the trnsition period. However, there re still computtionl chllenges tht hve to e improved. In chpter 5 gene expression of immune cells ws evluted. Once gin our reserch ws nrrowed to the effect of preprtum diet sed on performnce nd immune function results from previous chpters. Expression dt supported results from previous chpters; overfed cows resulted in greter level expression of genes relted with 195

200 inflmmtion ssocited with the onset of lcttion (IL10, SELL, SOD2 nd IL1B) nd potentilly lipid utiliztion/ moiliztion (PPARA, PPARG, PPARD, RXRA nd NCOR1). The diet effect in this experiment ws trnscendentl during the trnsition period nd potentilly during the entire lcttion. Chnges in energy lnce were oserved nd provided good model to study the chllenges ssocited with the onset of lcttion. Overll the LPS model provided consistent response representing n inflmmtion incident; however the chnges in metolic indices were sudden nd hrd to detect in most of the cses during the dys following the chllenge. In generl overfeeding dietry energy during the dry period resulted in less responsive immune function during the erly postprtum. In other words, controlling the dietry energy preprtum hs more enefits for the diry cow during trnsition. Figure 18 shows n integrted model of the overll responses nd enefirts of controlling the dietry energy during the dry period nd considering n inflmmtory incident during the first wk fter prturition. In terms of performnce the energetic lnce oserved ws more fvorle compred to overfed cows in the dys fter prturition. At this point energy lnce is normlly negtive nd implies moiliztion from dipose tissue reserves. However the rte of moiliztion ws lower compred to the overfed group. The liver plys fundmentl role uptking the intermedites of dipose tissue moiliztion; in our results less TAG ccumultion ws oserved in the liver (Indirectly suggesting etter metolic functioning nd potentilly greter rted of β oxidtion). The metolic profiling ssessed confirmed n improved nd more fvorle metolic sttus tht supported the response of the liver. The metolites results were directly relted to immune function nd contriute to explin more fvorle response in terms of phgocytosis. 196

201 The LPS chllenge ffected directly the mmmry glnd nd indirectly ffected the liver nd immune cells. However is importnt to rememer tht the evlution of preprtl energy feeding ws ssessed t ll times in cows receiving LPS implying tht cows fed to meet their energy requirements performed etter with the stress of n inflmmtory event. At the gene expression level, the results reconcile most of the responses of performnce nd metolic indictors. The liver reveled greter expression in genes relted to metolism of lipids. The immune cells evluted showed n opposite response to the liver in terms of utiliztion of intermedites resulting from metolism of lipids. Clerly the improved metolic sttus of the control fed group (in prt, ttriuted to the well functioning of the liver uptking NEFA) did not oligte immune cells to drmticlly dpt nd chnge energy sources permitting etter immune function performnce. Finlly the mmmry glnd did not seem to e ffected y the preprtl dietry energy effect. This response ws expected since the cow instinctively prioritizes the mmmry glnd in the prturition of energy for self preservtion. However the mmmry glnd ws extremely responsive to the effect of LPS y ctivtion of functions relted to the immune function. 197

202 Figure 18. Responses of controlling the dietry energy to diry cows during the dry period considering chllenge of LPS during the first week fter prturition s model for inflmmtion. 198