Supporting Information
|
|
|
- Della Gardner
- 5 years ago
- Views:
Transcription
1 Supporting Information Cloning and real-time PCR testing of 14 potential biomarkers in Eisenia fetida following cadmium exposure F. Brulle, G. Mitta, C. Cocquerelle, D. Vieau, S. Lemière, A. Leprêtre, F. Vandenbulcke Number of text pages: Number of figures: 11 Number of tables: 2 1
2 S1 Table S1 : Sequences of Primers used to partially cloned effectors in Eisenia fetida Effectors Calmodulin Hsp6 Hsp7 Superoxyde Dismutase Catalase Metallothionein Ubiquitin PKC Pyruvate Carboxylase β-ark TCTP Primers calm-1_for 5'-CCGAGCTGCAGGACATGATHAAYGA-3' calm-2_rev 5'-CGGCCTCCCGGATCATYTCRTC-3' hsp6-3_for 5'-GCCATCGAGCTGAAGGACAARTDBCARAA-3' hsp6-4_rev 5'-GCGGAGATGGTGGCCACYTGNGCDAT-3' hsp7-5_for8 5'-TTTACCACCTACTCGGACAAC-3' hsp7-6_rev8 5'-TTGAGCTTCTCATCCTCGAC-3' sod-3_for 5'-TGACCCCAGGCAAGCAYGGNTTYCA-3' sod-4_rev 5'-CCGGGCGCCGGYRTTNCCNGT-3' cata-1_for 5'-GCGGCCCGAGACCACNCAYCARGT-3' cata-2_rev 5'-GATCTGCTCCACCTCGGCRAARWARTT-3' MEF-1_for 5'-CGCAAGAGAGGGATCAACTT-3' MEF-2_rev 5'-CTATGCAAAGTCAAACTGTC-3' ubiq-1_for 5'-TGAAGGCCAAGATCCAGGAYAARGARGG-3' ubiq-2_rev 5'-GCCGGTCAGGGTCTTCACRAADATYTGCA-3' pkc-1_for 5'-ACGTGATCATCCAGGACGAYGAYGTNGA-3' pkc-2_rev 5'-GATGTAGTCGGGGGTGCCRCARAANGT-3' pycarb-1_for 5'-CAAGGTGATGGTGGCCAACMGNGGNGARAT-3' pycarb-2_rev 5'-CGGGCGGCCACCTTRTCNCCCAT-3' β-ark-1_for 5'-GACGTGTCCTACCTGATGGCNATGGARA-3' β-ark-2_rev 5'-AGCTGCATGTTCAGCTCCARRTTYTTCCA-3' TCTP-3_for 5'-TGACGGGCGTGGACATHGTNATGAA-3' TCTP-4_rev 5'-CCAGGCCGTGCTTGAARAADAWCAT-3' GenBank accession no. DQ28678 DQ28679 DQ28671 DQ DQ DQ DQ DQ DQ DQ DQ DQ DQ28672 DQ β-actin β-actin3_for 5'-TCTCCACCTTCCAGCAGATG-3' β-actin2_rev 5'-CGAAAAATGTCCTCCGCAAG-3' IUB code for mixed base sites: N = A, C, G, T D = G, A, T H = A, T, C W = A,T M = A, C R = G, T Y = C, T DQ
3 S2 Table S2 : Amplification efficiencies of selected genes for Real-Time PCR. Selected gene Amplification efficiency Calmodulin Calmodulin Hsp Hsp Superoxide dismutase...2 Catalase...2 Metallothionein...2 Ubiquitin...2 PKC PKC Pyruvate carboxylase...2 β-ark β-ark TCTP...2 β-actin Ribosomal protein S
4 S3 extracted RNA quantity (µg/mg cellular pellet) h 6h 14h 1d 2d 6d Exposure time Figure S3 : Quantities of RNA extracted from exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days and 6 days. : significant difference (p<.5) 4
5 S4 Expression levels (arbitraey units) mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S4 : Expression levels of Superoxide Dismutase mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 5
6 S mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S5 : Expression levels of Protein Kinase C 2 mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 6
7 S6,7,6,5,4,3,2,1 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S6 : Expression levels of TCTP mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 7
8 S7,3,25,2,15,1,5 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S7 : Expression levels of Protein Kinase C 1 in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 8
9 S8,12,1,8,6,4,2 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S8 : Expression levels of Pyruvate Carboxylase mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 9
10 S mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S9 : Expression levels of Calmoduline 16-1 mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 1
11 S mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S1 : Expression levels of Calmoduline 16-2 mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 11
12 S mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S11 : Expression levels of β-adrenergic Receptor Kinase 1-4 mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 12
13 S mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S12 : Expression levels of β-adrenergic Receptor Kinase 2-3 mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 13
14 S mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d 8mg/kg 2h 8mg/kg 6h 8mg/kg 14h 8mg/kg 1d 8mg/kg 2d 8mg/kg 6d Figure S13 : Expression levels of Ubiquitin mrna in control and Cd exposed (8 or 8 mg/kg) earthworms after 2 hours, 6 hours, 14 hours, 1 day, 2 days, 6 days of exposure Legend : : mg/kg; : 8 mg/kg; : 8 mg/kg; : Significant difference (p<.5) 14
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
Supporting Table 1. Primers used for isoprenoid gene isolation
SUPPORTING INFORMATION Supporting Table 1. Primers used for isoprenoid gene isolation # Gene Primer use Sequence (5'3') 1 1-deoxy-D-xylulose-5-phosphate synthase (DXS) degenerate primer PCR AYACNCCNGAYGAYAARATHATHTGG
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
Ulva as a Model for the Study of Environmental stress in Intertidal Macroalgae
Kuroshio Science 61, 115119, 2012 Ulva as a Model for the Study of Environmental stress in Intertidal Macroalgae TseMin Lee*, TsureMeng Wu, MingShiuan Sung, YuanTing Hsu, HsuehLing Chang, ChengYang Kang.
Cell responses to environment-- Signals
Cell responses to environment-- Signals Signal transduction can coordinate: Development Formation of tissues Timing of cell division Direction of cell enlargement Size and shape of organs Responses to
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Chapter 11: Inherited Disorders of Human Memory Mental Retardation Syndromes. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.
Chapter 11: Inherited Disorders of Human Memory Mental Retardation Syndromes From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 11: Mental Retardation Syndromes Table I: Mouse
Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B
Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1
1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting
MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor
Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
High-throughput transcriptome sequencing
High-throughput transcriptome sequencing Erik Kristiansson (erik.kristiansson@zool.gu.se) Department of Zoology Department of Neuroscience and Physiology University of Gothenburg, Sweden Outline Genome
Revision. camp pathway
االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition
Superoxide dismutase 2 knockdown leads to defects in locomotor activity, sensitivity to
Superoxide dismutase 2 knockdown leads to defects in locomotor activity, sensitivity to paraquat, and increased cuticle pigmentation in Tribolium castaneum Hiroko Tabunoki 1,2, *, Maureen J. Gorman 2,
Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
The goal of teaching:
The goal of teaching: 1. Principles of LDG of SFI: Hair Nail Skin Mucosal Eye Ear 3. Methods for fungal identification Test methods for fungal susceptibility testing Diffusion Dilution Etest 2. Principles
a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
1 2 APPENDIX Legends to figures 3 4 5 Figure A1: Distribution of perfect SSR along chromosome 1 of V. cholerae (El-Tor N191). a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine
Protein carbonylation: a marker of oxidative stress damage
Protein carbonylation: a marker of oxidative stress damage ITN-TREATMENT Metabolic Dysfunctions associated with Pharmacological Treatment of Schizophrenia TREATMENT Protein carbonyl formation: Metal-Catalyzed
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides.
1 SUPPLEMENTAL MATERIAL SUPPLEMENT METHODS Real Time PCR. Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master Mix, Roche Applied Science) using specific oligonucleotides. Rat ST2L forward
SOIL ENZYMES. Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/
Soil Biology topic No. 11: SOIL ENZYMES Enzymes Simple (only proteins) Composite protein + cofactor coenzyme (NAD +, NADP +, FAD +,FADP +, hem, α lipoate, Fe ions etc.) = holoenzyme) prosthetic group (coenzyme
Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
MITOCHONDRIAL FUNCTION & RELATED TESTS
North Cottage 11 Dovers Green Road Reigate Surrey RH2 8BU Tel: 01737 226338 MITOCHONDRIAL FUNCTION & RELATED TESTS Chronic fatigue syndrome (CFS) is a syndrome - that is a combination of symptoms and signs
Glycinates Animal Nutrition G-ENL/MT, G-ENL/MP
Glycinates Animal Nutrition G-ENL/MT, G-ENL/MP Lampertheim, 02.12.2013 1 Introduction 2 Product offer 3 Value 4 Product portfolio 5 Dosage recommendation 6 Backup: - Animal trial data - Packaging and Labelling
Extracellular Vesicle RNA isolation Kits
Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Regulation of cell function by intracellular signaling
Regulation of cell function by intracellular signaling Objectives: Regulation principle Allosteric and covalent mechanisms, Popular second messengers, Protein kinases, Kinase cascade and interaction. regulation
Consequences of Disturbed Landscapes To Desert Tortoises Populations When Habitats Are Not Restored or Protected
Consequences of Disturbed Landscapes To Desert Tortoises Populations When Habitats Are Not Restored or Protected Kristina Drake* Todd Esque Ken Nussear Lesley DeFalco Phil Medica Melia Nafus Wildfire Impacts
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
Supplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
MicroRNA-122 is involved in oxidative stress in isoniazid-induced liver injury in mice
MicroRNA-122 is involved in oxidative stress in isoniazid-induced liver injury in mice L. Song 1,2, Z.R. Zhang 1, J.L. Zhang 1, X.B. Zhu 1, L. He 1, Z. Shi 1, L. Gao 1, Y. Li 1, B. Hu 1 and F.M. Feng 1
Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5
Supporting Information
Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Ebrahim Abbasi Oshaghi 1,2
1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi
Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.
Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Dendritic Spine Figure 1 Summary: Three Primary
CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt
Supplementary Information CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt Jae Hyang Lim, Hirofumi Jono, Kensei Komatsu, Chang-Hoon Woo, Jiyun Lee, Masanori Miyata,
Basic Immunology. Immunological tolerance. Cellular and molecular mechanisms of the immunological tolerance. Lecture 23 rd
Basic Immunology Lecture 23 rd Immunological tolerance Cellular and molecular mechanisms of the immunological tolerance Tolerated skin grafts on MHC (H2) identical mice TOLERANCE & AUTOIMMUNITY Upon encountering
Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College
Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants
Supporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
An Evolution of Michigan s SCID Algorithm
An Evolution of Michigan s SCID Algorithm A qualitative approach for the T cell receptor excision circle (TREC) assay for the detection of primary immune deficiency syndromes (PIDS) demonstrates better
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination
Int. J. Mol. Sci. 2016, 17, 1139; doi:.3390/ijms17071139 S1 of S5 Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Zhaoqun Yao, Fang
EXPANSION RESEARCH FOR DEVELOPMENT OF LOCAL ANESTHETIC HAVING ANTI INFLAMMATORY ACTION
No. 137 EXPANSION RESEARCH FOR DEVELOPMENT OF LOCAL ANESTHETIC HAVING ANTI INFLAMMATORY ACTION Takuya MIYAWAKI Professor Graduate School of Medicine, Dentistry and Pharmaceutical Sciences Okayama University
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
Supplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Activation of Chemical Biological Defense Mechanisms and Remission of Vital Oxidative Injury by Low Dose Radiation
Activation of Chemical Biological Defense Mechanisms and Remission of Vital Oxidative Injury by Low Dose Radiation K.Yamaoka 1, T.Nomura 2 and S.Kojima 3 1 Okayama University Medical School, Okayama 700-8558,
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Leen Osama, Lujain Hamdan, Osama Mohd, Razi Kittaneh... Faisal Mohammad
23 Leen Osama, Lujain Hamdan, Osama Mohd, Razi Kittaneh... Faisal Mohammad Revision of previous lectures G-proteins coupled receptors mechanism: When a hormone binds to G-protein coupled receptor, GTP
Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Diagnostik invasiver Pilzinfektionen
Diagnostik invasiver Pilzinfektionen Cornelia Lass-Flörl Medizinische Universität Innsbruck Bonn, April 2005 The medically most important opportunistic mycoses in Europe are caused by Aspergillus spp.
Supplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
Microbiology Lab Microbial Growth: Environmental Factors
Microbiology Lab Microbial Growth: Environmental Factors Ex. 2-7: Oxygen Requirements: Effects on Growth A. Bacteria may use oxygen as part of the cellular respiration. Cellular respiration is the process
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Signal Transduction: G-Protein Coupled Receptors
Signal Transduction: G-Protein Coupled Receptors Federle, M. (2017). Lectures 4-5: Signal Transduction parts 1&2: nuclear receptors and GPCRs. Lecture presented at PHAR 423 Lecture in UIC College of Pharmacy,
MDI 301, a synthetic retinoid, depressed levels of matrix metalloproteinases and oxidative stress in diabetic dermal fibroblasts
/, 2017, Vol. 8, (No. 27), pp: 43889-43896 MDI 301, a synthetic retinoid, depressed levels of matrix metalloproteinases and oxidative stress in diabetic dermal fibroblasts Jianhua Zhai 1 and Yuli Wang
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
Cell counting (EtBr) Before cell-lysis. Cell-lysis by 3% SDS beads beating. After cell-lysis
Key words Sample Cell counting (EtBr) DNA extraction Cell-lysis by 3% SDS beads beating Before cell-lysis After cell-lysis Cell-lysis efficiency (Maintained70%) PCR PCR amplification of partial fragments
Supplementary Table S1: PCR protocols used for genotyping
Supplementary Table S1: PCR protocols used for genotyping Forward primer Reverse primer Sensor WT Sensor MUT ADRB1 Ser49Gly (rs1801252) gtcgccgcccgcctcgtt MgCl 2 concentration CCATgCCCgCTgTCCACTgCT 6-FAM-CCAgCgAAAgCCCCgAgCC-DB
Mitochondrial biogenesis and diabetes, functional of confirmation mtdna transcription factors. Chan Bae Park Ajou Univ. School of Medicine
Mitochondrial biogenesis and diabetes, functional of confirmation mtdna transcription factors Chan Bae Park Ajou Univ. School of Medicine Mitochondria perform diverse functions (Courtesy of K. R. Porter,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
Anti-diabetic effects of seaweeds: potential mechanisms. By: Z. Janahmadi
Anti-diabetic effects of seaweeds: potential mechanisms By: Z. Janahmadi Presentation outline Diabetes mellitus Marine algae *Unsaturated fatty acids *Dietary Fibers *α-glucosidase inhibitors *Glucose
Supporting Information for
Supporting Information for CuO Nanoparticle Interaction with Arabidopsis: Toxicity, Parent-Progeny Transfer and Gene Expression Zhenyu Wang,, Lina Xu, Jian Zhao,,, Xiangke Wang, Jason C. White, and Baoshan
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor
DEVELOPMENT OF A NOVEL DIAGNOSTIC TEST USING PODOCYTURIA AS A BIOMARKER FOR DETECTION OF KIDNEY DAMAGE. An Undergraduate Research Scholars Thesis
DEVELOPMENT OF A NOVEL DIAGNOSTIC TEST USING PODOCYTURIA AS A BIOMARKER FOR DETECTION OF KIDNEY DAMAGE An Undergraduate Research Scholars Thesis by EESHA FAROOQI Submitted to Honors and Undergraduate Research
Overexpression of the brassinosteroid biosynthetic gene DWF4 in Brassica napus simultaneously increases seed yield and stress tolerance
Overexpression of the brassinosteroid biosynthetic gene DWF4 in Brassica napus simultaneously increases seed yield and stress tolerance Authors Sangita Sahni 1+, Bishun D. Prasad 1+, Qing Liu 2, Vojislava
Properties of Allosteric Enzymes
Properties of Allosteric Enzymes (1) An allosteric enzyme possesses at least spatially distinct binding sites on the protein molecules the active or the catalytic site and the regulator or the allosteric
Rabbit polyclonal antibody LN1436 was raised against synthetic peptide corresponding to residues
Supplementary Data Supplementary Materials and Methods Antibody Rabbit polyclonal antibody LN46 was raised against synthetic peptide corresponding to residues 47-46 (HDIENVLLKPENLYN) at the extreme C-terminus
Platelet Activating Factor affects Sigmoid Smooth Muscle Contraction in UC
Platelet Activating Factor affects Sigmoid Smooth Muscle Contraction in UC Sharad Kunnath 1, Victor E. Pricolo 2, Karen M. Harnett 3, Neal S. Leleiko 1, Weibiao Cao 3 1 Department of Pediatrics, 2 Surgery
Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Expression profiles of DNA repair-related genes in rat target organs under subchronic cadmium exposure
Expression profiles of DNA repair-related genes in rat target organs under subchronic cadmium exposure Y.X. Lei, Q. Lu, C. Shao, C.C. He, Z.N. Lei and Y.Y. Lian School of Public Health, Guangzhou Medical